CN110923362B - Colloidal gold chromatography kit for simultaneously detecting herpes simplex virus type I/II and application thereof - Google Patents
Colloidal gold chromatography kit for simultaneously detecting herpes simplex virus type I/II and application thereof Download PDFInfo
- Publication number
- CN110923362B CN110923362B CN201911315793.5A CN201911315793A CN110923362B CN 110923362 B CN110923362 B CN 110923362B CN 201911315793 A CN201911315793 A CN 201911315793A CN 110923362 B CN110923362 B CN 110923362B
- Authority
- CN
- China
- Prior art keywords
- probe
- herpes simplex
- type
- detection
- simplex virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000700584 Simplexvirus Species 0.000 title claims abstract description 55
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 title claims abstract description 34
- 238000004587 chromatography analysis Methods 0.000 title claims abstract description 22
- 239000000523 sample Substances 0.000 claims abstract description 158
- 238000001514 detection method Methods 0.000 claims abstract description 93
- 239000010931 gold Substances 0.000 claims abstract description 35
- 229910052737 gold Inorganic materials 0.000 claims abstract description 35
- 150000007523 nucleic acids Chemical class 0.000 claims abstract description 35
- 230000003321 amplification Effects 0.000 claims abstract description 33
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 33
- 108020004707 nucleic acids Proteins 0.000 claims abstract description 32
- 102000039446 nucleic acids Human genes 0.000 claims abstract description 32
- 102100034343 Integrase Human genes 0.000 claims abstract description 9
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 claims abstract description 9
- 101710137500 T7 RNA polymerase Proteins 0.000 claims abstract description 9
- 239000007788 liquid Substances 0.000 claims abstract description 6
- 239000013592 cell lysate Substances 0.000 claims abstract description 5
- 238000012360 testing method Methods 0.000 claims description 27
- 239000011248 coating agent Substances 0.000 claims description 12
- 238000000576 coating method Methods 0.000 claims description 12
- 108090000623 proteins and genes Proteins 0.000 claims description 9
- 241000282414 Homo sapiens Species 0.000 claims description 8
- 238000005516 engineering process Methods 0.000 claims description 8
- IAZDPXIOMUYVGZ-UHFFFAOYSA-N Dimethylsulphoxide Chemical compound CS(C)=O IAZDPXIOMUYVGZ-UHFFFAOYSA-N 0.000 claims description 6
- 238000003908 quality control method Methods 0.000 claims description 6
- 102000004190 Enzymes Human genes 0.000 claims description 5
- 108090000790 Enzymes Proteins 0.000 claims description 5
- 239000002245 particle Substances 0.000 claims description 5
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 5
- 101000938676 Homo sapiens Liver carboxylesterase 1 Proteins 0.000 claims description 4
- 102100030817 Liver carboxylesterase 1 Human genes 0.000 claims description 4
- 239000002250 absorbent Substances 0.000 claims description 4
- 230000002745 absorbent Effects 0.000 claims description 4
- 238000006243 chemical reaction Methods 0.000 claims description 4
- 239000003153 chemical reaction reagent Substances 0.000 claims description 3
- 238000002360 preparation method Methods 0.000 claims description 3
- QKNYBSVHEMOAJP-UHFFFAOYSA-N 2-amino-2-(hydroxymethyl)propane-1,3-diol;hydron;chloride Chemical compound Cl.OCC(N)(CO)CO QKNYBSVHEMOAJP-UHFFFAOYSA-N 0.000 claims description 2
- 101000898006 Homo sapiens Cocaine esterase Proteins 0.000 claims description 2
- 101100127888 Schizosaccharomyces pombe (strain 972 / ATCC 24843) les1 gene Proteins 0.000 claims description 2
- 238000000605 extraction Methods 0.000 claims description 2
- 238000000034 method Methods 0.000 abstract description 24
- 230000035945 sensitivity Effects 0.000 abstract description 11
- 238000011901 isothermal amplification Methods 0.000 abstract description 9
- 244000052769 pathogen Species 0.000 abstract description 9
- 230000001717 pathogenic effect Effects 0.000 abstract description 8
- 230000008569 process Effects 0.000 abstract description 7
- 230000009471 action Effects 0.000 abstract description 6
- 238000013518 transcription Methods 0.000 abstract description 3
- 230000035897 transcription Effects 0.000 abstract description 3
- 238000002123 RNA extraction Methods 0.000 abstract description 2
- 238000010839 reverse transcription Methods 0.000 abstract description 2
- 108020004414 DNA Proteins 0.000 description 31
- 241000700605 Viruses Species 0.000 description 8
- 244000005700 microbiome Species 0.000 description 7
- 238000009004 PCR Kit Methods 0.000 description 6
- 239000002299 complementary DNA Substances 0.000 description 6
- 239000012528 membrane Substances 0.000 description 6
- 238000011161 development Methods 0.000 description 5
- 230000018109 developmental process Effects 0.000 description 5
- 210000004379 membrane Anatomy 0.000 description 5
- 238000013461 design Methods 0.000 description 4
- 238000010586 diagram Methods 0.000 description 4
- 238000012163 sequencing technique Methods 0.000 description 4
- 238000005507 spraying Methods 0.000 description 4
- 238000012795 verification Methods 0.000 description 4
- 102000053602 DNA Human genes 0.000 description 3
- 208000009889 Herpes Simplex Diseases 0.000 description 3
- 230000009286 beneficial effect Effects 0.000 description 3
- 238000003745 diagnosis Methods 0.000 description 3
- 238000010790 dilution Methods 0.000 description 3
- 239000012895 dilution Substances 0.000 description 3
- 208000015181 infectious disease Diseases 0.000 description 3
- 239000000243 solution Substances 0.000 description 3
- 241000709687 Coxsackievirus Species 0.000 description 2
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 description 2
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 description 2
- 241000711386 Mumps virus Species 0.000 description 2
- 241000725643 Respiratory syncytial virus Species 0.000 description 2
- 230000006578 abscission Effects 0.000 description 2
- 238000002405 diagnostic procedure Methods 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 238000002955 isolation Methods 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 210000005000 reproductive tract Anatomy 0.000 description 2
- 210000003708 urethra Anatomy 0.000 description 2
- 101150110188 30 gene Proteins 0.000 description 1
- 241000193830 Bacillus <bacterium> Species 0.000 description 1
- 241000894006 Bacteria Species 0.000 description 1
- 241001647372 Chlamydia pneumoniae Species 0.000 description 1
- 241000701022 Cytomegalovirus Species 0.000 description 1
- 206010013654 Drug abuse Diseases 0.000 description 1
- 206010058314 Dysplasia Diseases 0.000 description 1
- 238000002965 ELISA Methods 0.000 description 1
- 241000709661 Enterovirus Species 0.000 description 1
- 241001529459 Enterovirus A71 Species 0.000 description 1
- 241000606768 Haemophilus influenzae Species 0.000 description 1
- 244000309467 Human Coronavirus Species 0.000 description 1
- 241000701096 Human adenovirus 7 Species 0.000 description 1
- 241000193096 Human adenovirus B3 Species 0.000 description 1
- 241000701044 Human gammaherpesvirus 4 Species 0.000 description 1
- 241000342334 Human metapneumovirus Species 0.000 description 1
- 241000726041 Human respirovirus 1 Species 0.000 description 1
- 241000712003 Human respirovirus 3 Species 0.000 description 1
- 241001559187 Human rubulavirus 2 Species 0.000 description 1
- 241000712079 Measles morbillivirus Species 0.000 description 1
- 241000187479 Mycobacterium tuberculosis Species 0.000 description 1
- 241000202934 Mycoplasma pneumoniae Species 0.000 description 1
- 241000588653 Neisseria Species 0.000 description 1
- 241000588650 Neisseria meningitidis Species 0.000 description 1
- 206010061308 Neonatal infection Diseases 0.000 description 1
- 239000000020 Nitrocellulose Substances 0.000 description 1
- 108020004711 Nucleic Acid Probes Proteins 0.000 description 1
- 201000005702 Pertussis Diseases 0.000 description 1
- 241000589517 Pseudomonas aeruginosa Species 0.000 description 1
- 238000012952 Resampling Methods 0.000 description 1
- 241000710799 Rubella virus Species 0.000 description 1
- 241000191967 Staphylococcus aureus Species 0.000 description 1
- 241000193998 Streptococcus pneumoniae Species 0.000 description 1
- 241000193996 Streptococcus pyogenes Species 0.000 description 1
- 241000194024 Streptococcus salivarius Species 0.000 description 1
- 101150068034 UL30 gene Proteins 0.000 description 1
- 206010000210 abortion Diseases 0.000 description 1
- 231100000176 abortion Toxicity 0.000 description 1
- 239000000427 antigen Substances 0.000 description 1
- 108091007433 antigens Proteins 0.000 description 1
- 102000036639 antigens Human genes 0.000 description 1
- 230000015556 catabolic process Effects 0.000 description 1
- 210000003169 central nervous system Anatomy 0.000 description 1
- 238000004132 cross linking Methods 0.000 description 1
- 238000012136 culture method Methods 0.000 description 1
- 238000005520 cutting process Methods 0.000 description 1
- 125000004122 cyclic group Chemical group 0.000 description 1
- 230000009089 cytolysis Effects 0.000 description 1
- 238000006731 degradation reaction Methods 0.000 description 1
- 238000012938 design process Methods 0.000 description 1
- 201000010099 disease Diseases 0.000 description 1
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 230000001605 fetal effect Effects 0.000 description 1
- 210000004392 genitalia Anatomy 0.000 description 1
- 229940047650 haemophilus influenzae Drugs 0.000 description 1
- 230000036541 health Effects 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000010369 molecular cloning Methods 0.000 description 1
- 210000004877 mucosa Anatomy 0.000 description 1
- 210000004400 mucous membrane Anatomy 0.000 description 1
- 229920001220 nitrocellulos Polymers 0.000 description 1
- 231100000252 nontoxic Toxicity 0.000 description 1
- 230000003000 nontoxic effect Effects 0.000 description 1
- 239000002853 nucleic acid probe Substances 0.000 description 1
- 230000036285 pathological change Effects 0.000 description 1
- 231100000915 pathological change Toxicity 0.000 description 1
- 239000002994 raw material Substances 0.000 description 1
- 238000003753 real-time PCR Methods 0.000 description 1
- 238000005070 sampling Methods 0.000 description 1
- 230000000405 serological effect Effects 0.000 description 1
- 238000009589 serological test Methods 0.000 description 1
- 210000002966 serum Anatomy 0.000 description 1
- 238000004904 shortening Methods 0.000 description 1
- 208000017520 skin disease Diseases 0.000 description 1
- 238000011895 specific detection Methods 0.000 description 1
- 239000011550 stock solution Substances 0.000 description 1
- 229940031000 streptococcus pneumoniae Drugs 0.000 description 1
- 208000011117 substance-related disease Diseases 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 230000002194 synthesizing effect Effects 0.000 description 1
- 125000003396 thiol group Chemical group [H]S* 0.000 description 1
- 244000052613 viral pathogen Species 0.000 description 1
- 230000000007 visual effect Effects 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a colloidal gold chromatography kit for simultaneously detecting herpes simplex virus type I/II and application thereof. The kit releases pathogen nucleic acid after a collected sample is cracked by cell lysate, and then the pathogen nucleic acid fragments are amplified through reverse transcription and transcription processes under the action of reverse transcriptase and T7RNA polymerase. The amplified RNA product is identified and captured by a specific probe in the detection liquid to form an RNA amplification product-specific probe-gold probe complex, and the complex is fixed on an NC film through lateral flow chromatography to form a visible strip, so that the detection of pathogen nucleic acid is realized. The invention has the advantages of no RNA extraction process, no special instrument, no pollution in the actual detection based on RNA isothermal amplification, high sensitivity, strong specificity and simple operation, and makes the wide application of the detection of the I type and II type nucleic acid of the herpes simplex virus possible.
Description
Technical Field
The invention relates to the technical field of biological detection, in particular to a kit for detecting I/II type nucleic acid of herpes simplex virus based on RNA isothermal amplification-gold probe chromatography technology and application thereof.
Background
Herpes simplex virus (Herpes Simplex Virus, HSV) is a viral pathogen that severely harms human health and causes skin diseases and venereal diseases. HSV is transmitted primarily by direct contact, and clinically about 80% of infected individuals appear asymptomatic, which is the leading cause of HSV prevalence. HSV can be classified into two serotypes, HSVI and HSVII, depending on antigenicity. HSVI mainly causes the infection of skin mucous membrane of the waist and mouth and central nervous system, has lighter symptoms and is easy to treat; HSVII mainly causes skin mucosa at genital area and neonatal infection, and pregnant women infected with HSVII may induce fetal dysplasia or abortion. Because the HSVII type infection is easy to relapse, the administration period of the medicine is longer than that of the HSVI type infection. Therefore, it is necessary to perform typing detection to avoid drug abuse.
There are many laboratory diagnostic methods for HSV infection, and they can be generally classified into direct smear method, virus isolation culture method, serological test method and PCR method. The direct smear method has the advantages of quick detection, low cost and visual result, but the detection result is easily affected by the sampling position and the pathological change time. Virus isolation and culture is a gold standard for HSV detection, and although the method is reliable, the method has high requirements on experimental conditions, takes a long time (2 to 3 weeks) and is easy to pollute, so that the method cannot be effectively applied clinically. The serological detection mainly adopts ELISA method to detect antigen or antibody in serum, the method has moderate specificity and sensitivity, is simple, convenient and quick, is also a detection method commonly used in clinic at present, but has the problem of false negative false positive which is difficult to solve. The PCR method can directly detect HSV nucleic acid, has high sensitivity, strong specificity and higher detection speed, has considerable advantages in shortening the detection window period and improving the pathogen detection rate, but has certain requirements on hardware facilities, has special PCR diagnosis laboratories and expensive laboratory instruments, and is not beneficial to popularization and application in communities and remote hospitals. Therefore, there is still a need to find a simple, rapid and inexpensive diagnostic method for herpes simplex virus.
Disclosure of Invention
In view of the above-mentioned shortcomings of the prior art, the present invention aims to provide a kit for combined detection of herpes simplex virus type I/II nucleic acid based on RNA isothermal amplification-gold probe chromatography technology and application thereof. The kit releases pathogen nucleic acid after a collected sample is cracked by cell lysate, and then the pathogen nucleic acid fragments are amplified through reverse transcription and transcription processes under the action of reverse transcriptase and T7RNA polymerase. The amplified RNA product is identified and captured by a specific probe in the detection liquid to form an RNA amplification product-specific probe-gold probe complex, and the complex is fixed on an NC membrane through lateral flow chromatography to form a visible strip, so that the detection of pathogen nucleic acid is realized. Therefore, the invention has the advantages of no complex RNA extraction process, no special instrument, no pollution in the actual detection based on the characteristic of easy degradation of RNA molecules, high sensitivity, strong specificity and simple operation, and makes the wide application of the detection of the I/II type nucleic acid of the herpes simplex virus possible.
In order to achieve the above object, the present invention adopts the following technical scheme:
in a first aspect, there is provided a herpes simplex virus type I/II nucleic acid joint detection colloidal gold chromatography kit, the kit being based on RNA isothermal amplification-gold probe chromatography technology, comprising:
1) Amplification reaction solution: containing 40mM Tris-HCl (pH 8.0), 12mM MgCl 2 70mM KCl,15%DMSO,5mM DTT each dNTP was 1mM, each NTP was 2mM, and each amplification primer was 0.2. Mu.M; wherein the amplification primers comprise three pairs: the type I herpes simplex virus, the type II herpes simplex virus and the human internal reference genes are specifically as follows:
(1) Amplification primers for herpes simplex virus type I (sequence of a conserved region of the UL30 gene):
HSVI-F(5’-3’)：CGTCGGGTCGGGCGGCTTCT；
HSVI-R(5’-3’)：TAATACGACTCACTATAGGGAGAGGTGTGATGGCGTCCATAAA；
(2) Amplification primers for herpes simplex virus type II (UL 30 gene, a conserved region sequence):
HSVII-F(5’-3’)：CCACCGTCACCGTCTTCCAC；
HSVII-R(5’-3’)：AATACGACTCACTATAGGGAGAACCTCCGCCTTGTTCATGTAAA；
(3) Amplification primers for reference gene (a conserved region sequence of human 18 SRRNA):
18S-F(5’-3’)：AGAAACGGCTACCACATCC；
18S-R(5’-3’)：TAATACGACTCACTATAGGGAGACACCAGACTTGCCCTCCA；
because the homology of the type I herpes simplex virus sequence and the type II herpes simplex virus sequence is about 50%, sequences with high sequence conservation and large difference between the two types are selected as much as possible when designing the primer. The amplification efficiency of each single primer is ensured to be high, and meanwhile, different primers are ensured to have no interference with each other. The T7RNA polymerase promoter sequence is introduced into the 5' end of the R primer of the three pairs of primers.
2) Amplification enzyme: comprises three, reverse transcriptase (such as AMV or M-MLV), T7RNA polymerase and RNASEH.
3) Cell lysate (available from sign company, usa, cat No. CL-0001): cells can be lysed to release nucleic acids.
4) Detection liquid: the kit comprises a colloidal gold particle marked nucleic acid probe (gold probe), specific probes of each index and a C line chromogenic probe, wherein each index specific probe comprises two types, namely a CES series and an LES series, and a plurality of CES series and LES series can be designed, and the specific (5 '-3') is as follows:
(1) Specific probes for I-type herpes simplex virus
HSVI-CES1：GGCCGCGGCGCTCGCGCCTTTTTATCTATAGCTGGTGT；
HSVI-CES2：TGTGGGGCGGCGTGGACCTTTTTATCTATAGCTGGTGT；
HSVI-LES1：ACGCCCCGGCGGGGTTCATTTTCGCAGTGCTCGAGCTCTGAGC；
HSVI-LES2：ACCCCACCGTCACCGTCTTTTTCGCAGTGCTCGAGCTCTGAGC；
HSVI-LES3：TTCACGTGTATGACATCCTTTTCGCAGTGCTCGAGCTCTGAGC；
(2) Specific probes for II-type herpes simplex virus
HSVII-CES1:GCGTACAGCATGCGCGCCGCTTTTCTATGTATCTGTGAGT；
HSVII-CES2:CCAGCTCCACGAGCGATTTATTTTCTATGTATCTGTGAGT；
HSVII-LES1:TGGACGCCATCACGCCCGCCTTTTCGCAGTGCTCGAGCTCTGAGC；
HSVII-LES2:GGGACCGTCATCACGCTTCTTTTTCGCAGTGCTCGAGCTCTGAGC；
HSVII-LES3:GGGTCTGACCCCCGAAGGCCTTTTCGCAGTGCTCGAGCTCTGAGC；
(3) Reference specific probe
Internal reference CES1: AAGGAAGGCAGCAGGCTTTTATCTGTATAGTGTCTG;
internal reference CES2: GCGCAAATTACCCACTTTTTATCTGTATAGTGTCTG;
an internal reference LES1: CCCGACCCGGGGAGGTTTTTCGCAGTGCTCGAGCTCTGAGC;
an internal reference LES2: AGTGACGAAAAATAACTTTTCGCAGTGCTCGAGCTCTGAGC;
an internal reference LES3: AATACAGGACTCTTTCTTTTCCGCAGTGCTCGAGCTCTGAGC;
(4) C line chromogenic probe (5 '-3')
TCAGATCACTATGTACTTTTCGCAGTGCTCGAGCTCTGAGC；
(5) Gold probe
The 5' end of the gold probe is modified by sulfhydrylation, and the sequence is as follows:
5’-CCTACTCTGCAGTGCTCCATCGTACGTCTGTCATTTTTGCTCAGAGCTCGAGCACTGCG-3’；
5) Test strip: the test strip is fixed on a PVC bottom plate, and a sample pad, an NC film and water absorbing paper are sequentially arranged from left to right; the NC film is provided with a C line (quality control line) and three T lines (detection lines), and the directions from the sample pad to the absorbent paper are HSVII-T, HSVI-T, internal reference-T and the C line (as shown in figure 3); the specific sequences (5 '-3') of the HSVI-T coated HSVI coated probe, the HSVII-T coated HSVII coated probe, the internal reference-T coated internal reference coated probe and the C line coated probe are as follows:
c line coating probe: GTACATAGTGATCTGATTTTGTACATAGTGATCTGA;
internal reference wire coating probe: CAGACACTATACAGATTTTTCAGACACTATACAGAT;
HSVI wire coated probe: ACACCAGCTATAGATATTTTACACCAGCTATAGATA;
HSVII wire coating probe: ACTCACAGATACATAGTTTTACTCACAGATACATAG.
The invention provides a method for detecting I/II type nucleic acid of herpes simplex virus by using the kit for detecting I/II type nucleic acid of herpes simplex virus based on RNA isothermal amplification-gold probe chromatography technology, which comprises the following steps:
(1) Isothermal amplification of RNA
The detection indexes of the invention are three: type I herpes simplex virus, type II herpes simplex virus and human internal reference gene. A pair of (F/R primers) amplification primers was designed for each index, wherein the 5' end of the R primer carries a T7RNA polymerase promoter. The invention realizes the amplification of each index nucleic acid in the same amplification tube, and specifically comprises the following steps: during amplification, under the action of an R primer with a T7 promoter and reverse transcriptase, converting RNA to be detected into RNA, namely cDNA heterozygote; RNA in cDNA is digested by RNaseH in the amplified enzyme to obtain single-stranded cDNA; synthesizing a second strand under the action of the F primer and the DNA polymerase function of reverse transcriptase to form double-stranded DNA with a T7 promoter; double-stranded DNA with a T7 promoter is transcribed by T7RNA polymerase to produce an RNA molecule product. The transcribed RNA molecular product can enter a cyclic amplification process, firstly, F primer can combine with the transcribed RNA molecular product, and the transcribed RNA is converted into RNA by reverse transcriptase; RNA in cDNA is digested by RNaseH in the amplified enzyme to obtain single-stranded cDNA; the R primer is then bound to the single-stranded cDNA, the second strand is synthesized by the action of the reverse transcriptase DNA polymerase, and is again enriched to form more double-stranded DNA molecules with the T7 promoter, so that more transcription templates are provided for the T7RNA polymerase, and a large amount of RNA molecule products are transcribed by the action of the T7RNA polymerase (as shown in figure 1).
The invention designs the detection of the internal reference genes of the human beings to monitor the effectiveness of sample collection and the effectiveness of an amplification system. When the sample is collected to be qualified, the sample must contain human abscission cells, the human abscission cells must be detected in detection, the internal reference is positive in detection of the sample, otherwise, the whole detection needs resampling for retesting.
(2) Gold probe chromatography
a, designing a specific probe, a gold probe, a C line chromogenic probe and a coating probe
Specific probes: each index-specific probe includes two types: CES series and LES series, each probe may be designed in multiple pieces. Wherein the CES probe comprises two parts, one end of the CES probe can be specifically combined with amplified RNA products, the other end of the CES probe can be assembled with a coated probe coated on an NC membrane to play a role in fixing the amplified RNA products, and the two parts are linked by 4-5T. Each LES probe also comprises two parts, one end of each LES probe can be specifically combined with the amplified RNA product, the other end of each LES probe can be combined with the gold probe, the LES probe plays a role in linking the color development of the gold probe, and the two parts are linked by 4-5T.
Gold probe: the 5' end of the gold probe is modified by sulfhydrylation, and the sulfhydryl group can form a covalent bond with the colloidal gold particles and is marked on the colloidal gold particles. The gold probe may be bound to one end of the specific probe LES.
Coating a probe: the coated probe is fixed on the NC film and can be combined with one end of the specific probe CES to play a role in fixation. Each coated probe contains two copies, which are linked by 4-5T's.
C line chromogenic probe: comprising two parts linked by 4-5T. One end of the probe can be combined with a gold probe, and the other end of the probe can be combined with a C line coated probe coated on an NC film. During chromatography, no matter whether RNA amplification products exist or not, the C-line chromogenic probe can form a C-line chromogenic probe-gold probe complex, and the complex can be captured and intercepted by a C-line coating probe on an NC film during chromatography to form a macroscopic strip. The probe can control the quality of the test strip and the detection liquid, and the chromatography process is correct.
The specific probes are required to be free from crossing among probes with different indexes in the design process, and CES series with gold probes and coated probes are required to be free from crossing so as to ensure the detection specificity.
The CES and LES series of the specific probes are designed in a plurality of strips in order to improve immobilization efficiency and bind more gold probes, thereby improving detection sensitivity.
b, test paper strip detection
The test strip is provided with a detection line and a quality control line, wherein the detection line comprises an HSVI-T, HSVII-T and an internal reference-T, and an HSVI coated probe coated at the HSVI-T can specifically bind with one end of a CES series probe of the I type herpes simplex virus; the HSVII coated probe coated at the HSVII-T can be specifically combined with one end of a CES series probe of the II type herpes simplex virus; the internal reference coated probe coated at the internal reference-T can be specifically combined with one end of an internal reference CES series probe. And the C line coating probe coated on the quality control line (C line) can be specifically combined with the C line chromogenic probe. And (3) hybridizing a specific probe CES, a specific probe LES, a gold probe and a specific amplified product of the nucleic acid to be detected, then dripping the hybridized specific probe CES, the hybridized specific probe LES, the gold probe and the specific amplified product of the nucleic acid to be detected on a test strip for chromatography, wherein the color development of a detection line indicates that the nucleic acid to be detected exists, and the color development of a quality control line indicates that the detection is effective.
In combination with the principle, the working process of the method of the invention is described as follows:
(1) Nucleic acid extraction
Collecting genital tract or urethra swab samples of suspected herpes simplex virus patients, and releasing virus nucleic acid molecules by using a cell lysate lysis method.
(2) Isothermal amplification of RNA
To 17. Mu.L of an amplification reaction solution containing type I herpes simplex virus, type II herpes simplex virus and an internal reference, 2. Mu.L of a nucleic acid extract was added, and the mixture was heated at 95℃for two minutes, preheated at 42℃for 2 minutes, 1. Mu.L of an amplification enzyme was added, and the mixture was amplified at 42℃for 1 hour at a constant temperature. If the sample to be detected contains herpes simplex virus nucleic acid, a large amount of amplification and enrichment are carried out on the index RNA molecules during amplification.
(3) Test strip chromatography
a, prehybridization
The RNA isothermal amplification product was mixed with detection solutions (including specific probes, gold probes, and C-line chromogenic probes) and prehybridized at 42℃for 10 min. The amplified RNA molecules are complementarily paired with specific probes (including CES-series probes and LES-series probes). One end of CES series probes is hybridized and complementarily paired with RNA molecules, and the other end of CES series probes is combined with coated probes on NC films; one end of the LES series probes is hybridized and complementarily paired with the RNA molecules, and the other end of the LES series probes can be complementarily paired with the gold probes for combination, and a CES probe-RNA molecule-LES probe-gold probe complex can be formed when amplification products exist.
b, chromatographic detection
The prehybridization product is dripped on a test strip sample pad, the prehybridization liquid is chromatographed along the NC film towards the direction of absorbent paper, when the RNA amplified product to be detected exists, a CES probe-RNA molecule-LES probe-gold probe complex is formed, and the CES probe-RNA molecule-LES probe-gold probe complex is intercepted by a coating probe coated on the NC film during chromatography to form a macroscopic strip, which is positive (as shown in figure 4).
If no RNA product to be detected is amplified, a CES probe-RNA molecule-LES probe-gold probe complex is not formed, colloidal gold particles cannot be aggregated at the T line, and macroscopic bands are not formed, which is negative (as shown in FIG. 4).
The C-line chromogenic probe can form a C-line chromogenic probe-gold probe complex no matter whether the RNA product to be detected is amplified or not, the complex can flow forwards along the NC membrane during chromatography, and when the complex reaches the C-line, the complex is combined with the probe coated at the C-line, so that the complex stays at the C-line to form a macroscopic colored band, and the experimental result is effective (as shown in figure 4).
In a second aspect, the application of the kit for detecting the I/II type nucleic acid of the herpes simplex virus based on RNA isothermal amplification-gold probe chromatography technology in preparation of the I and/or II type detection reagent of the herpes simplex virus is provided.
Compared with the prior art, the invention has the following beneficial effects:
1. the invention can amplify three indexes of I type herpes simplex virus, II type herpes simplex virus and internal reference gene simultaneously in the same tube by the RNA isothermal amplification method, the amplified nucleic acid product is RNA, the RNA is easy to degrade in natural environment, and compared with the PCR method, the amplified DNA has the effect of preventing pollution more easily. The isothermal amplification of RNA is carried out in an environment of 42 ℃, and even one water bath kettle can realize the amplification reaction, so that the requirement of an experimental instrument is reduced to the greatest extent.
2. As the homology of the sequences of the type I and type II herpes simplex viruses is up to about 50%, the sequences with high sequence conservation and large difference between the two types are selected as much as possible when designing the primers, so that the two types of viruses can be fully covered and the purpose of typing detection can be achieved. Meanwhile, the invention ensures that each single primer has high amplification efficiency, different primers have no interference with each other and the whole amplification effect is good through multiple rounds of tests when designing the primers.
3. The invention introduces the specific probe CES series and the specific probe LES series with the function of bridging molecule components during design, and the two probes successfully combine gold probes and RNA nucleic acid amplified fragments in series to realize the specific detection of the index RNA nucleic acid fragments. The use of the two sets of probes ensures that any one set of probes and the index nucleic acid amplification fragment cannot be successfully immobilized on the NC membrane due to hybridization failure, so that a positive detection result cannot be generated, and the detection specificity is ensured. The detection results of the kit of the invention on 32 other microorganisms listed in table 3 are all negative, and the fact that the kit of the invention has no cross reaction with other microorganisms is proved. More than two probes can be designed for each set of probes, and the design is beneficial to improving the sensitivity of the test strip. The minimum detection limit of the kit disclosed by the invention on the HSVI (ATCC VR-539) is 8.0TCID50/mL, and the minimum detection limit of the HSVII (ATCC VR-540) is 6.4TCID50/mL. The detection sensitivity and specificity of the type I and type II herpes simplex virus detection on 464 diagnosis results and clinical samples related to herpes simplex virus infection are higher than those of a commercial detection type I and type II herpes simplex virus fluorescent quantitative PCR kit.
4. The invention adopts the RNA isothermal amplification technology and the test strip chromatography technology, which not only applies the characteristic of low requirement on instruments by RNA isothermal amplification, but also successfully fuses the characteristic of rapid colloidal gold. The nucleic acid is detected by the test strip, and the result can be interpreted only for about 10 minutes. The method is also quite simple in operation, has low technical requirements on experimental staff, does not need special instruments and equipment, and is easy to popularize in basic level and remote rural medical institutions for detecting the herpes simplex virus nucleic acid.
Drawings
FIG. 1 is a schematic diagram of isothermal amplification of RNA;
FIG. 2 is a schematic diagram of the strip color development;
FIG. 3 is a schematic diagram of a test strip;
FIG. 4 is a schematic diagram of detecting yin and yang;
a: HSVI negative, HSVII negative, internal reference negative;
b: HSVI negative, HSVII negative, internal reference positive;
c: HSVI positive, HSVII negative, internal reference positive;
d: HSVI negative, HSVII positive, internal reference positive;
e: HSVI positive, HSVII positive, internal reference positive;
Detailed Description
A further understanding of the nature and advantages of the present invention may be realized by reference to the remaining portions of the specification taken in conjunction with the drawings. The examples provided are merely illustrative of the methods of the present invention and are not intended to limit the remainder of the disclosure in any way whatsoever.
The experimental procedure, which does not specify specific conditions in the following examples, is generally followed by conventional conditions, such as "molecular cloning: the conditions described in laboratory Manual 3 rd edition (New York: cold Spring Harbor laboratory Press, 2005) were followed.
Example 1 preparation of nucleic acid detection test strip
The main raw materials required in preparing the nucleic acid detection test strip are as follows: nitrocellulose membrane (NC membrane), sample pad, absorbent paper, PVC base plate, etc.
1. Spraying a film:
detection line HSVII-T: CES sequence of the combined HSVII specific probe can be captured, 10 mu M of HSVII coated probe is sprayed, and the film spraying amount is that: 2-3 mu L/cm;
detection line HSVI-T: CES sequence of the combined HSVI specific probe can be captured, the HSVI coated probe is 10 mu M, and the film spraying amount is as follows: 2-3 mu L/cm;
detection line internal reference-T: CES sequence of the combined reference specific probe can be captured, 10 mu M of reference coated probe is sprayed with the film: 2-3 mu L/cm;
quality control line (C line): the color development probe sequence of the combined C line can be captured, the coating probe of 10 mu M C lines is sprayed with the film: 2-3 mu L/cm;
after film spraying, the film is automatically crosslinked once in an ultraviolet crosslinking instrument, and the film is dried in a clean constant temperature box at 37 ℃ for 2 hours and stored in a dry environment for standby.
2. Test strip assembly
And respectively cutting water absorbing paper with the length of 2cm, a coated NC film and a sample pad, and sequentially fixing the water absorbing paper, the coated NC film and the sample pad on a PVC bottom plate from top to bottom to obtain the detection test paper strip. The assembly structure of the test strip is shown in FIG. 3.
Example 2 sensitivity test
The minimum detection limit of the gradient dilution is determined by carrying out gradient dilution on virus stock solutions of the HSVI (ATCC No. VR-539) and the HSVII (ATCC No. VR-540) which are derived from ATCC, 3 to 5 parts of each gradient virus dilution is repeated, 20 times of repeated detection are carried out on each part, and the virus level with the positive detection rate of 90 to 95 percent is taken as the minimum detection limit, and the detection result is as follows:
HSVI minimum detection limit detection
TABLE 1.1 detection experimental data for different titres HSVI
TABLE 1.2 HSVI minimum limit of detection experimental data
HSVII minimum detection limit detection
TABLE 2.1 test data for different titres HSVII
TABLE 2.2 HSVII minimum detection limit experimental data
The detection sensitivity of the kit of the invention is finally determined as follows:
| detection index | Virus strain | Minimum detection limit |
| HSVI | ATCC VR-539 | 8.0TCID 50 /mL |
| HSVII | ATCC VR-540 | 6.4TCID 50 /mL |
[ example 3 ] specificity verification
1, test strains
After extracting nucleic acid from different microorganisms, detecting, and verifying the design specificity of the primer and the probe of the kit. The relevant pathogens and titers were as follows:
TABLE 3 specificity verification test Strain information
| Microorganism | Concentration of | Microorganism | Concentration of |
| Adenovirus 3 | 1.58×10 7 TCID 50 /mL | Mumps virus | 6.3×10 9 TCID 50 /mL |
| Adenovirus 7 type | 1.58×10 8 TCID 50 /mL | Respiratory syncytial virus A | 1.58×10 7 TCID 50 /mL |
| Coxsackievirus B group 5 | 2.8×10 8 TCID 50 /mL | Respiratory syncytial virus B | 8.89×10 5 TCID 50 /mL |
| Epstein-Barr virus type 9 | 1.58×10 7 TCID 50 /mL | Chlamydia pneumoniae | 1.58×10 8 TCID 50 /mL |
| Enterovirus 71 type | 1.58×10 6 TCID 50 /mL | Coli bacterium | (12～14)×10 8 cfu/mL |
| Coxsackie virus group A16 | 1.58×10 5 TCID 50 /mL | Haemophilus influenzae | 2.4×10 6 cfu/mL |
| Human parainfluenza virus 1 | 1.58×10 4 TCID 50 /mL | Nontoxic mycobacterium tuberculosis | 3.2×10 6 cfu/mL |
| Human parainfluenza virus 2 | 2.8×10 6 TCID 50 /mL | Streptococcus pneumoniae | 2.6×10 6 cfu/mL |
| Human parainfluenza virus 3 | 1.58×10 7 TCID 50 /mL | Streptococcus pyogenes | 2.0×10 6 cfu/mL |
| Measles virus | 3.2×10 9 TCID 50 /mL | Streptococcus salivarius | 2.1×10 6 cfu/mL |
| Mumps virus | 8.89×10 5 TCID 50 /mL | Human coronavirus | 1.6×10 6 TCID 50 /mL |
| Rubella virus | 3.2×109TCID 50 /mL | Cytomegalovirus | 3.0×10 6 TCID 50 /mL |
| Mycoplasma pneumoniae | 10 6 cfu/mL | Rhinovirus 1A type | 4.0×10 6 TCID 50 /mL |
| Pseudomonas aeruginosa | (14～22)×10 8 cfu/mL | Pertussis bacillus | 5.5×10 6 cfu/mL |
| Staphylococcus aureus | (24～40)×10 8 cfu/mL | Neisseria meningitidis | 6×10 6 cfu/mL |
| Gonococcus | 1.0×10 6 cfu/mL | Human metapneumovirus | 2.8×10 6 TCID 50 /mL |
2 test results
The test results were as follows:
TABLE 4 specificity verification test results
3 conclusion
From the data, the detection results of the kit provided by the invention on the microorganisms are negative, and the fact that the kit provided by the invention has no cross reaction with other microorganisms is proved, so that the kit is high in pathogen detection specificity.
Example 4 verification of clinical samples
1 clinical sample information
In 464 parts of genital tract or urethra swab samples were co-tested in the first hospital of wuhan, hubei province, with 176 and 288 cases of male and female specimens, respectively, accounting for 37.93% and 62.07%, respectively. In 464 specimens, the patients were aged 67 years at maximum, 1 month, 28.13 years on average, 10.5 years on standard deviation, and 30 years in median. The diagnosis results of the patients in the group are all related to herpes simplex virus infection,
2, detection result
(1) Type I herpes simplex virus detection results
When in detection, the kit and a commercial fluorescent PCR kit for detecting the I type and II type herpes simplex viruses are used for simultaneously detecting samples, and detection results are assembled into a four-grid table, wherein the detection results are as follows:
retesting is carried out on 3 inconsistent samples by adopting a gene sequencing method, and 1 sample is positive, namely the detection of the patent positive and the detection of the negative sample by using a commercial detection type I and type II herpes simplex virus fluorescent PCR kit. Sequencing results show that the fluorescent PCR kit for detecting the I type and II type herpes simplex viruses has one missed detection case and 2 false positive cases, and obviously, the kit has higher detection sensitivity and stronger specificity when detecting clinical samples.
(2) Detection result of II type herpes simplex virus
When in detection, the kit and a commercial fluorescent PCR kit for detecting the I type and II type herpes simplex viruses are used for simultaneously detecting samples, and detection results are assembled into a four-grid table, wherein the detection results are as follows:
retesting is carried out on 9 inconsistent samples by adopting a gene sequencing method, and 5 samples are positive, namely the detection of the patent positive and the detection of the negative sample by using a commercial detection type I and type II herpes simplex virus fluorescent PCR kit. Sequencing results show that the fluorescent PCR kit for detecting the type I and type II herpes simplex viruses has 5 missed detection cases and 4 false positive cases, and obviously, the type II herpes simplex viruses have higher detection sensitivity and stronger specificity when the kit is used for detecting clinical samples.
Sequence listing
<110> Wu Hanzhong Account of Biotech Co., ltd
<120> colloidal gold chromatography kit for simultaneously detecting herpes simplex virus type I/II and application thereof
<160> 27
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
cgtcgggtcg ggcggcttct 20
<210> 2
<211> 43
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
taatacgact cactataggg agaggtgtga tggcgtccat aaa 43
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
ccaccgtcac cgtcttccac 20
<210> 4
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
aatacgactc actataggga gaacctccgc cttgttcatg taaa 44
<210> 5
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
agaaacggct accacatcc 19
<210> 6
<211> 41
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
taatacgact cactataggg agacaccaga cttgccctcc a 41
<210> 7
<211> 38
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
ggccgcggcg ctcgcgcctt tttatctata gctggtgt 38
<210> 8
<211> 38
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
tgtggggcgg cgtggacctt tttatctata gctggtgt 38
<210> 9
<211> 43
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
acgccccggc ggggttcatt ttcgcagtgc tcgagctctg agc 43
<210> 10
<211> 43
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
accccaccgt caccgtcttt ttcgcagtgc tcgagctctg agc 43
<210> 11
<211> 43
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
ttcacgtgta tgacatcctt ttcgcagtgc tcgagctctg agc 43
<210> 12
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
gcgtacagca tgcgcgccgc ttttctatgt atctgtgagt 40
<210> 13
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
ccagctccac gagcgattta ttttctatgt atctgtgagt 40
<210> 14
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
tggacgccat cacgcccgcc ttttcgcagt gctcgagctc tgagc 45
<210> 15
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
gggaccgtca tcacgcttct ttttcgcagt gctcgagctc tgagc 45
<210> 16
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
gggtctgacc cccgaaggcc ttttcgcagt gctcgagctc tgagc 45
<210> 17
<211> 36
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
aaggaaggca gcaggctttt atctgtatag tgtctg 36
<210> 18
<211> 36
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
gcgcaaatta cccacttttt atctgtatag tgtctg 36
<210> 19
<211> 41
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 19
cccgacccgg ggaggttttt cgcagtgctc gagctctgag c 41
<210> 20
<211> 41
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 20
agtgacgaaa aataactttt cgcagtgctc gagctctgag c 41
<210> 21
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 21
aatacaggac tctttctttt ccgcagtgct cgagctctga gc 42
<210> 22
<211> 41
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 22
tcagatcact atgtactttt cgcagtgctc gagctctgag c 41
<210> 23
<211> 59
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 23
cctactctgc agtgctccat cgtacgtctg tcatttttgc tcagagctcg agcactgcg 59
<210> 24
<211> 36
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 24
gtacatagtg atctgatttt gtacatagtg atctga 36
<210> 25
<211> 36
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 25
cagacactat acagattttt cagacactat acagat 36
<210> 26
<211> 36
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 26
acaccagcta tagatatttt acaccagcta tagata 36
<210> 27
<211> 36
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 27
actcacagat acatagtttt actcacagat acatag 36
Claims (3)
1. A combined detection colloidal gold chromatographic kit for herpes simplex virus type I/II nucleic acid is characterized in that the kit is based on RNA isothermal amplification-gold probe chromatography technology and comprises the following components:
1) Amplification reaction solution: containing 40mM Tris-HCl, pH 8.0, 12mM MgCl 2 70mM KCl,15% DMSO,5mM DTT, 1.1 mM each dNTP, 2mM each NTP, 0.2. Mu.M each amplification primer; wherein the amplification primers comprise three pairs: the type I herpes simplex virus, the type II herpes simplex virus and the human internal reference genes are specifically as follows:
(1) Type I herpes simplex virus amplification primers:
HSVI-F（5’-3’）：CGTCGGGTCGGGCGGCTTCT；
HSVI-R（5’-3’）：TAATACGACTCACTATAGGGAGAGGTGTGATGGCGTCCATAAA；
(2) Type II herpes simplex virus amplification primers:
HSVII-F（5’-3’）：CCACCGTCACCGTCTTCCAC；
HSVII-R（5’-3’）：AATACGACTCACTATAGGGAGAACCTCCGCCTTGTTCATGTAAA；
(3) Amplification primers of reference gene:
18S-F（5’-3’）：AGAAACGGCTACCACATCC；
18S-R（5’-3’）：TAATACGACTCACTATAGGGAGACACCAGACTTGCCCTCCA；
2) Amplification enzyme: comprises three, reverse transcriptase, T7RNA polymerase and RnaseH;
3) Nucleic acid extraction reagent: cell lysate;
4) Detection liquid: the kit comprises a colloidal gold particle marked nucleic acid gold probe, specific probes of each index and a C line chromogenic probe, wherein each index specific probe comprises two types, namely a CES series and an LES series, wherein the CES series and the LES series can be designed into a plurality of types, and the specific probes are as follows:
(1) Specific probe of I type herpes simplex virus (5 '-3')
HSVI-CES1：GGCCGCGGCGCTCGCGCCTTTTTATCTATAGCTGGTGT；
HSVI-CES2：TGTGGGGCGGCGTGGACCTTTTTATCTATAGCTGGTGT；
HSVI-LES1：ACGCCCCGGCGGGGTTCATTTTCGCAGTGCTCGAGCTCTGAGC；
HSVI-LES2：ACCCCACCGTCACCGTCTTTTTCGCAGTGCTCGAGCTCTGAGC；
HSVI-LES3：TTCACGTGTATGACATCCTTTTCGCAGTGCTCGAGCTCTGAGC；
(2) Specific probe of II type herpes simplex virus (5 '-3')
HSVII-CES1: GCGTACAGCATGCGCGCCGCTTTTCTATGTATCTGTGAGT；
HSVII-CES2: CCAGCTCCACGAGCGATTTATTTTCTATGTATCTGTGAGT；
HSVII-LES1: TGGACGCCATCACGCCCGCCTTTTCGCAGTGCTCGAGCTCTGAGC；
HSVII-LES2: GGGACCGTCATCACGCTTCTTTTTCGCAGTGCTCGAGCTCTGAGC；
HSVII-LES3: GGGTCTGACCCCCGAAGGCCTTTTCGCAGTGCTCGAGCTCTGAGC；
(3) Reference specific probe (5 '-3')
Internal reference CES1: AAGGAAGGCAGCAGGCttttATCTGTATAGTGTCTG;
internal reference CES2: GCGCAAATTACCCACTttttATCTGTATAGTGTCTG;
an internal reference LES1: CCCGACCCGGGGAGGTttttCGCAGTGCTCGAGCTCTGAGC;
an internal reference LES2: AGTGACGAAAAATAACttttCGCAGTGCTCGAGCTCTGAGC;
an internal reference LES3: AATACAGGACTCTTTCttttCCGCAGTGCTCGAGCTCTGAGC;
(4) C line chromogenic probe (5 '-3')
TCAGATCACTATGTACttttCGCAGTGCTCGAGCTCTGAGC；
(5) Gold probe
The 5' end of the gold probe is modified by sulfhydrylation, and the sequence is as follows:
5’-CCTACTCTGCAGTGCTCCATCGTACGTCTGTCATTTTTGCTCAGAGCTCGAGCACTGCG-3’ ；
5) Test strip: the test strip is fixed on a PVC bottom plate, and a sample pad, an NC film and water absorbing paper are sequentially arranged from left to right; the NC film is provided with a quality control line C line and three detection lines T lines, and the directions from the sample pad to the absorbent paper are HSVII-T, HSVI-T, internal reference-T and C lines respectively; the specific sequences (5 '-3') of the HSVI-T coated HSVI coated probe, the HSVII-T coated HSVII coated probe, the internal reference-T coated internal reference coated probe and the C line coated probe are as follows:
c line coating probe: GTACATAGTGATCTGAttttGTACATAGTGATCTGA;
internal reference wire coating probe: CAGACACTATACAGATttttCAGACACTATACAGAT;
HSVI wire coated probe: ACACCAGCTATAGATAttttACACCAGCTATAGATA;
HSVII wire coating probe: ACTCACAGATACATAGttttACTCACAGATACATAG.
2. The kit of claim 1, wherein the reverse transcriptase is AMV or M-MLV.
3. Use of a kit according to claim 1 or 2 for the preparation of a type I and/or type II herpes simplex virus detection reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911315793.5A CN110923362B (en) | 2019-12-19 | 2019-12-19 | Colloidal gold chromatography kit for simultaneously detecting herpes simplex virus type I/II and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911315793.5A CN110923362B (en) | 2019-12-19 | 2019-12-19 | Colloidal gold chromatography kit for simultaneously detecting herpes simplex virus type I/II and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110923362A CN110923362A (en) | 2020-03-27 |
| CN110923362B true CN110923362B (en) | 2023-06-06 |
Family
ID=69864297
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911315793.5A Active CN110923362B (en) | 2019-12-19 | 2019-12-19 | Colloidal gold chromatography kit for simultaneously detecting herpes simplex virus type I/II and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110923362B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114790493B (en) * | 2021-11-04 | 2023-06-16 | 江汉大学 | MNP (MNP) marking site of herpes simplex virus, primer composition, kit and application of MNP marking site |
Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004016219A2 (en) * | 2002-08-14 | 2004-02-26 | The Board Of Regents Of The University Of Texas System | Clinical assays for the detection and typing of human herpesviruses |
| WO2004097029A2 (en) * | 2003-04-25 | 2004-11-11 | Becton, Dickinson And Company | Detection of herpes simplex virus types 1 and 2 by nucleic acid amplification |
| WO2009122201A1 (en) * | 2008-04-03 | 2009-10-08 | Genomica S.A.U. | Method for detection of herpesvirus in a test sample |
| CN102618665A (en) * | 2012-01-16 | 2012-08-01 | 中山大学达安基因股份有限公司 | Kit for fluorescence PCR detection of herpes simplex virus I |
| CN103276066A (en) * | 2013-05-17 | 2013-09-04 | 武汉中帜生物科技有限公司 | Nucleic acid detection kit and method for detecting nucleic acid by amplifying plurality of biotin signals |
| CN104263838A (en) * | 2014-10-13 | 2015-01-07 | 天津市动物疫病预防控制中心 | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for Listeria monocytogenes |
| CN105301237A (en) * | 2015-10-12 | 2016-02-03 | 武汉中帜生物科技股份有限公司 | Method for detecting nucleic acid by colloidal gold chromatography technology and reagent kit |
| CN105624329A (en) * | 2014-10-29 | 2016-06-01 | 上海仁度生物科技有限公司 | Real-time fluorescence nucleic acid isothermal amplification detection kit for human herpesvirus 1 |
| CN106676198A (en) * | 2016-12-30 | 2017-05-17 | 上海星耀医学科技发展有限公司 | High-sensitivity quantitative detection kit for herpes virus 4 and herpes virus 5 |
| CN106834542A (en) * | 2017-02-17 | 2017-06-13 | 东莞市儿童医院 | A kind of primer of synchronous amplification detection HCMV, HSV1, HSV2 and B19, probe, kit and method |
| WO2019042307A1 (en) * | 2017-09-01 | 2019-03-07 | 康希诺生物股份公司 | Cell strain for reducing production of reproducible adenovirus, and construction method and use |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102485906A (en) * | 2010-12-03 | 2012-06-06 | 武汉中帜生物科技有限公司 | Dual-amplification method of template linear amplification and multi-biotin signal amplification |
| CN105203759B (en) * | 2015-10-12 | 2017-03-01 | 武汉中帜生物科技股份有限公司 | A kind of method of use colloidal gold chromatographic technology for detection mycoplasma pneumoniae nucleic acid and test kit |
| CN105154565A (en) * | 2015-10-12 | 2015-12-16 | 武汉中帜生物科技股份有限公司 | Method and kit for realizing multiple detection of nucleic acid through colloidal gold chromatographic technology |
-
2019
- 2019-12-19 CN CN201911315793.5A patent/CN110923362B/en active Active
Patent Citations (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004016219A2 (en) * | 2002-08-14 | 2004-02-26 | The Board Of Regents Of The University Of Texas System | Clinical assays for the detection and typing of human herpesviruses |
| WO2004097029A2 (en) * | 2003-04-25 | 2004-11-11 | Becton, Dickinson And Company | Detection of herpes simplex virus types 1 and 2 by nucleic acid amplification |
| WO2009122201A1 (en) * | 2008-04-03 | 2009-10-08 | Genomica S.A.U. | Method for detection of herpesvirus in a test sample |
| CN102618665A (en) * | 2012-01-16 | 2012-08-01 | 中山大学达安基因股份有限公司 | Kit for fluorescence PCR detection of herpes simplex virus I |
| CN103276066A (en) * | 2013-05-17 | 2013-09-04 | 武汉中帜生物科技有限公司 | Nucleic acid detection kit and method for detecting nucleic acid by amplifying plurality of biotin signals |
| CN104263838A (en) * | 2014-10-13 | 2015-01-07 | 天津市动物疫病预防控制中心 | LAMP-LFD (loop-mediated isothermal amplification and lateral flow dipstick) detection kit and detection method for Listeria monocytogenes |
| CN105624329A (en) * | 2014-10-29 | 2016-06-01 | 上海仁度生物科技有限公司 | Real-time fluorescence nucleic acid isothermal amplification detection kit for human herpesvirus 1 |
| CN105301237A (en) * | 2015-10-12 | 2016-02-03 | 武汉中帜生物科技股份有限公司 | Method for detecting nucleic acid by colloidal gold chromatography technology and reagent kit |
| CN106676198A (en) * | 2016-12-30 | 2017-05-17 | 上海星耀医学科技发展有限公司 | High-sensitivity quantitative detection kit for herpes virus 4 and herpes virus 5 |
| CN106834542A (en) * | 2017-02-17 | 2017-06-13 | 东莞市儿童医院 | A kind of primer of synchronous amplification detection HCMV, HSV1, HSV2 and B19, probe, kit and method |
| WO2019042307A1 (en) * | 2017-09-01 | 2019-03-07 | 康希诺生物股份公司 | Cell strain for reducing production of reproducible adenovirus, and construction method and use |
Non-Patent Citations (2)
| Title |
|---|
| Evaluation of a nanophosphor lateral-flow assay for self-testing for herpes simplex virus type 2 seropositivity;Heather J Goux等;PLOS One;第14卷;e0225365 * |
| 环介导等温扩增技术的研究进展;黄火清;郁昂;;生物技术(第03期);94-98 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110923362A (en) | 2020-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111778357B (en) | CRISPR/Cas12 a-based respiratory syncytial virus nucleic acid rapid detection kit and detection method thereof | |
| FI63596C (en) | MICROBIA DIAGNOSIS FOERFARANDE SOM GRUNDAR SIG PAO SKIKTSHYBRIDISERING AV NUCLEINSYROR OCH VID FOERFARANDET ANVAENDA KOMBINATIONER AV REAGENSER | |
| CN111455099B (en) | Novel coronavirus (2019-nCoV) nucleic acid detection colloidal gold chromatography kit and application thereof | |
| CN113005228B (en) | Detection kit for synchronously detecting multiple respiratory pathogens and detection method thereof | |
| CN109988867B (en) | Kit for detecting respiratory pathogens of community-acquired pneumonia | |
| WO2017026606A1 (en) | Biomarker microrna for diagnosing tuberculosis | |
| CN113322351A (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) probe primer group and kit for rapidly and qualitatively typing and detecting four types of human parainfluenza viruses | |
| CN110923362B (en) | Colloidal gold chromatography kit for simultaneously detecting herpes simplex virus type I/II and application thereof | |
| CN110964853A (en) | Kit for joint detection of respiratory syncytial virus, parainfluenza virus and adenovirus based on double amplification technology and application thereof | |
| CN102286639A (en) | Type A H1N1/influenza A virus nucleic acid dual fluorescent polymerase chain reaction (PCR) detection kit | |
| TW201139687A (en) | Nucleic acid detection | |
| in Chinghingyong et al. | Detection of Mycoplasma fermentans in human saliva with a polymerase chain reaction-based assay | |
| CN110878369B (en) | Kit for detecting neisseria gonorrhoeae nucleic acid based on RNA isothermal amplification-gold probe chromatography technology and application thereof | |
| CN101294226B (en) | RT-PCR method for testing hantavirus genome | |
| CN110904194B (en) | Mycoplasma pneumoniae and Chlamydia pneumoniae nucleic acid combined detection kit and application thereof | |
| CN110964852B (en) | Colloidal gold chromatographic kit for combined detection of respiratory syncytial virus and parainfluenza virus and application thereof | |
| CN110923344B (en) | Staphylococcus aureus and methicillin-resistant staphylococcus aureus drug-resistant gene mecA detection kit and application thereof | |
| CN110951918B (en) | Kit for combined detection of influenza A and B viruses based on RNA isothermal amplification-gold probe chromatography technology and application thereof | |
| CN115838834A (en) | Human rhinovirus type A and type C detection system based on RT-RAA and CRISPR/Cas12a | |
| CN110938710B (en) | Colloidal gold chromatography kit for combined detection of rotavirus and enteroadenovirus and application thereof | |
| CN114807435A (en) | Kit for detecting respiratory syncytial virus and application thereof | |
| CN111304295B (en) | Kit for simultaneously detecting nucleic acids of neisseria gonorrhoeae, chlamydia trachomatis and ureaplasma urealyticum and application thereof | |
| CN110923345B (en) | Colloidal gold chromatography kit for chlamydia trachomatis detection and application thereof | |
| CN118127235A (en) | Human metapneumovirus nucleic acid detection kit | |
| CN118127195A (en) | Mycoplasma genitalium nucleic acid detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |