CN103275938B - Preparation method of PCV2 (Porcine Circovirus2)-D - Google Patents
Preparation method of PCV2 (Porcine Circovirus2)-D Download PDFInfo
- Publication number
- CN103275938B CN103275938B CN201310165696.9A CN201310165696A CN103275938B CN 103275938 B CN103275938 B CN 103275938B CN 201310165696 A CN201310165696 A CN 201310165696A CN 103275938 B CN103275938 B CN 103275938B
- Authority
- CN
- China
- Prior art keywords
- pcv2
- pcv
- pet30a
- codon
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a preparation method of PCV2 (Porcine Circovirus2)-D. The microorganism preservation number of PCV2 (Porcine Circovirus2) is CGMCC (China General Microbiological Culture Collection Center) No.7245. According to the preparation method, the preference of genetic codon of the PCV2 is modified, and the preferred codon is modified into non-preference codon, so that the expressions of the components of the virus are reduced, further, the copy rate of the virus in host cells is lowered, the virus is weakened, and the PCV2-D is obtained by genetic modification. Furthermore, the proliferation speed of the PCV2-D is compared with that of wild type strains at a cellular level. The detection of PCR (Polymerase Chain Reaction) and IFA (Indirect Immunofluorescence Assay) prove that the PCV2-D can be infected and copied in cells, and has certain infection.
Description
Technical field
The present invention relates to a kind of preparation method of pig circular ring virus attenuated vaccine strain.
Background technology
Pig circular ring virus (Porcine circovirus, PCV) belongs to PCV-II section, Circovirus, is sub-thread minus strand cyclic DNA virus.The virus particle diameter 14 ~ 25nm of this section is 20 body symmetrical structures, without cyst membrane, is one of known minimum animal virus.
PCV can be divided into PCV l and PCV2 two serotypes.From the PCV no pathogenicity that PK-15 clone obtains, be decided to be PCV l type; And there is pathogenic PCV be decided to be PCV2 type.
PCV2 type causes pmws (Post weaning multisystemic wastingsyndrome, PMWS) main pathogen, clinically, morbidity swinery shows as gradual becoming thin or growth retardation, expiratory dyspnea, inguinal lymphadenopathy, diarrhoea, anaemia and jaundice.It is also scorching relevant with PRDC (porcine respiratory disease complex) with nephrotic syndrome with Hypertrophic necrotizing pneumonia, sow breeding difficulty, pigskin.Since PCV2 broke out in Canadian swinery from 1991; involve the whole world rapidly, cause heavy losses to whole world pig industry, China's large-scale pig farm feeding and management level backwardness relatively; PCV2 and Other diseases accompanying infection cause mortality ratio to increase, and cause tremendous economic to lose.
PCV2 full-length genome 1767bp or 1768bp, 11 reading frames (ORFs) may be contained, wherein ORFl, 2,3,6,7 has certain homology, all the other ORF are without any homology, confirmed that PCV2 has 2 main reading frames after deliberation: ORFl and ORF2, wherein ORF1 is maximum reading frame, is positioned at viral genome chain, encode viral copies relevant Rep albumen, with virus copy transcribe relevant; ORF2 is positioned at viral genome complementary strand, encode viral major structural protein and Cap protein.
Mainly contain following 4 kinds of commercial PCV2 vaccines in the market: 1) the PCV2 totivirus deactivation vaccine of Cimmeria animal health company research and development, 2) Boehringer Ingelheim animal health company, 3) the PCV2 subunit vaccine of Intervet/Schering Plough animal health company, 4) the embedded virus inactivated vaccine of Fu Dao animal health company.But due to PCV-II totivirus deactivation vaccine, to there is titre low, high in cost of production problem, but and subunit vaccine faces the shortcomings such as immunizing dose is large, vaccine common feature of all these external imports is exactly expensive, brings very large economic pressures to pig farmer.The security of totivirus deactivation vaccine is high, good immune effect, but due to PCV-II copy number in culturing cell low, cause virus titer very low, directly cause vaccine preparation cost remain high, be difficult to be used widely.Therefore, improve virus culture titre, reduce inactivated virus vaccine cost, the disease caused control PCV2 is significant.
Attenuated vaccine has that inoculum size is little, inoculation times is few, immune effect is better, maintain that immunization time is longer, low cost and other advantages, and thus developing pig circular ring virus attenuated vaccine has good application prospect.The method of traditional acquisition low virulent strain vaccine need go down to posterity over a long time, but PCV-II genome is very conservative, makes virus weakening abnormal difficult by going down to posterity.
Summary of the invention
Technical problem to be solved by this invention is the preparation method providing a kind of pig circular ring virus attenuated vaccine strain, to make up the defect of prior art.
As everyone knows, bacterium, fungi, animal, plant all define oneself preference codon system in organic evolution process, because virus relies on host cell to breed, therefore viral genome has adapted to host cell preference codon system, and viral protein is preferentially expressed.PCV2 genome is less, easily carry out genetic modification, therefore, the application is by the preferences of its codon of amendment, the preference codon of PCV2 gene is changed into non-preferences codon, reduces the accurate translation of viral each integral part, thus reduce virus at host cell multiple-copy rate, make it cause weak, both prepare pig circular ring virus PCV 2 low virulent strain vaccine by genetic modification.
Described pig circular ring virus attenuated vaccine strain PCV2-D(Porcine circovirus, PCV), its microbial preservation number is CGMCC No.7245.The preservation time is: on 04 24th, 2013, preservation address was: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica; Depositary institution: China Microbiological preservation management committee's common micro-organisms center.
The preparation method of described pig circular ring virus attenuated vaccine strain, comprises the following steps:
First, according to the PCV2 complete genome sequence announced in GenBank, design a pair Auele Specific Primer: PCV-F/R, pcr amplification goes out the whole genome sequence of PCV2, obtains the specificity cloned sequence of a 1767bp, and its nucleotide sequence is as shown in SEQ ID No.1.This amplified fragments is cloned in pMD18-T carrier check order, successful for order-checking clone is cut connection by enzyme again PCV2 is building up on pET-30a carrier, obtain recombinant plasmid pET30a-PCV2.
Secondly, design a pair mutant primer: PCV(suddenlys change)-F/R, the T base mutation making 685 places in pET30a-PCV2 plasmid is C base, thus obtains PstI(CTGCAG) restriction enzyme site.Be pET30a-PCV2-M by successful for sudden change clone designation, its nucleotide sequence is as shown in SEQ ID No.2.
3rd, by the preferences of amendment PCV2 codon, preference codon is made to change into non-preferences codon, design a pair and exchange primer: PCV exchange-F/R, the DNA replication dna enzyme gene of the codon that external synthesis preferences changes, and by the viral original rdrp gene fragment of the sequence fragment of synthesis displacement, obtain recombinant plasmid pET30a-PCV2-D, its nucleotide sequence is as shown in SEQ ID No.3.
Finally, pET30a-PCV2 and the pET30a-PCV2-D plasmid of above-mentioned acquisition is reclaimed PCV2 glm gene group DNA and cyclisation after EcoR I enzyme is cut, uses Lipofectamine
tM2000 transfection PK15 cells, collect virus liquid after cultivating 72-96h and go down to posterity, and obtain strain PCV2 and low virulent strain vaccine PCV2-D respectively.
Further, the increment speed difference of this low virulent strain vaccine PCV2-D and PCV2 strain vaccine is compared on a cellular level.Detect with PCR and indirect immunofluorescence assay (IFA), show that the application successfully obtains low virulent strain vaccine PCV2-D by genetic modification, and PCV2-D energy infection duplication in cell, the low virulent strain PCV2-D of acquisition has infectivity.
Show through animal experiment, the security of the pig circular ring virus low virulent strain vaccine PCV2-D that the present invention obtains is good, can produce specific antibody after immunity.
Therefore, the attenuated vaccine strain PCV2-D obtained by the present invention can be used for preparation prevention or treatment pig circular ring virus 2 cytotoxic drug.Vaccine composition can also be made with the carrier of pharmaceutical acceptable or auxiliary material combination, be used for the treatment of or prepare pig circular ring virus disease.
Accompanying drawing explanation
Fig. 1 is PCV2 complete genome sequence pcr amplification electrophorogram, and wherein M is 100bp ladder DNA marker, and 1 is PCV2 full-length genome PCR primer.
Fig. 2 is that pET30a-PCV2 recombinant plasmid enzyme cuts qualification result, and wherein M is 100bp ladder DNAmarker, and 1 is that the ECORI enzyme of pET30a-PCV2 plasmid cuts result.
Fig. 3 is that the enzyme of pET30a-PCV2 and pET30a-PCV2-D plasmid cuts result, and wherein M is 100bp ladderDNA maker, and 1 is that the ECOR I enzyme of pET30a-PCV2 cuts result, and 2 is that the ECORI enzyme of pET30a-PCV2-D cuts result.
Fig. 4 is the PCR detected result after PCV2 copies increment, wherein 1,2,3,4,5,6 be respectively PCV2 first, second, third and fourth, five, six generation PCR detected results; NTC is negative control; 7,8,9,10,11,12 be respectively PCV2-D first, second, third and fourth, five, six generation PCR detected results.
Fig. 5 is IFA Immunofluorescence test result, and wherein 1 is the IFA detected result of strain vaccine PCV2, and 2 is that the IFA of strain vaccine PCV2-D surveys result, and 3 is blank IFA detected result.
Embodiment
Below in conjunction with specific embodiment, technical scheme of the present invention is described in further detail.Should be noted that, following examples are only in order to illustrate technical scheme of the present invention and unrestricted, although with reference to preferred embodiment to invention has been detailed description, those of ordinary skill in the art is to be understood that, can modify to the technical scheme of invention or equivalent replacement, and not departing from the spirit and scope of technical solution of the present invention, it all should be encompassed in right of the present invention.
1. material
1.1 Host Strains, cell and plasmid
Colon bacillus (E.coli) plants TOP10, PK15 cell and PET-30a plasmid is commercially available, is preserved by poultry disease prevention and control research laboratory of Animal Husbandary and Veterinary Inst., Shanghai Academy of Agricultural Science.
Other materials and reagent, if no special instructions, be commercially available.
1.2 substratum and main agents preparation
(1) LB liquid nutrient medium: during preparation 400mL substratum, should add in 350mL deionized water:
Tryptone (Tryptone) 4g
Yeast extract (Yeast extract) 2g
Sodium-chlor (NaCl) 4g
Shake container until solute dissolves completely, with 4mol/L NaOH adjust pH to 7.0.400mL is settled to, at 15 pounds of (1.05kg/cm with deionized water
2) steam sterilizing 20min under high pressure, room temperature storage is for subsequent use.
(2) LB solid medium: according to the LB liquid nutrient medium 400mL of above-mentioned formulated, add Bacto-agar powder 6g after constant volume, at 15 pounds of (1.05kg/cm
2) steam sterilizing 20min under high pressure.
When temperature is down to 55 ~ 60 DEG C, adding kantlex to final concentration is 100ug/uL, in super clean bench, pour it into aseptic flat board lentamente, and after substratum cooled and solidified, put into 4 DEG C of storages for subsequent use.
(3) kantlex: 0.5g kantlex powder adds 5mL ddH
2o is mixed with 100mg/mL solution ,-20 DEG C of storages.
(4) 1 × PBS solution (pH7.4): preparation 400mL solution, should to 350mL ddH
2add in O:
With 0.5mol/L HCl adjust pH to 7.4, add ddH
2o constant volume to 400ml, 15 pounds of (1.05kg/cm
2) high pressure steam sterilization 15min, 4 DEG C of storages are for subsequent use.
The structure of embodiment 1pET30a-PCV2 full genome, exchange recombinant plasmid
The extraction of 2.1PCV2DNA: extract by phenol chloroform ordinary method.
2.2PCV2 complete genome sequence increases
2.2.1 design of primers and synthesis
With reference to the sequences Design pair of primers on Genbank, be labeled as PCV-F/R, concrete sequence is as follows, and italic is restriction enzyme site, estimates amplified fragments total length 1767bp.Primer is synthesized by Shanghai Jierui Biology Engineering Co., Ltd.
PCV-F：AGAATTCAACCTTAACCTTTCT
PCV-R：AGAATTCTGGCCCTGCTCC
2.2.2PCR amplification
PCR reaction system: the DNA profiling 2 μ L of extracting in pathological material of disease, 10 × Buffer(Mg
2+free) 2.5 μ L, MgSO
4the each 1 μ L of PCV-F, R primer of the dNTP2.5 μ L of 2 μ L, 2mmol/L, 10 μm of ol/L, KOD-Plus enzyme 1 μ L, ddH
2o13 μ L, cumulative volume 25 μ L; Mix on ice.
PCR reaction parameter: 94 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 54 DEG C of annealing 30s, 68 DEG C extend 2min, 5 circulations, then 94 DEG C of sex change 30s, 49 DEG C of annealing 30s, and 68 DEG C extend 2min, 30 circulations, and last 68 DEG C extend 10min.
Result: get 3 ~ 5uL electrophoresis on the sepharose of 1%, gained PCV2 gene product is identical with expection size, and be the fragment of 1 1767bp, electrophoresis result is referring to Fig. 1.
The molecular cloning of 2.3PCV2 complete genome sequence
PMD18-T carrier is connected after the PCV2 full genome that above-mentioned KOD-Plus enzymatic amplification goes out is added A tail, transform TOP10 competent cell, obtain recombinant plasmid pMD18-T-PCV2, cut through enzyme and send to Shanghai, Beijing Liuhe Huada Genomics Technology Co., Ltd branch office carry out sequencing with the positive colony of PCR qualification, order-checking is as shown in SEQ IDNo.1, by cloned plasmids extracting correct for sequence after comparison, cut also glue with EcoR I enzyme and reclaim this PCV2 full genome fragment, be connected into the corresponding site of the pET-30a plasmid cutting process through EcoR I enzyme, transform TOP10 competent cell, enzyme is cut and is obtained recombinant plasmid pET30a-PCV2 with PCR qualification is rear.
Result, referring to Fig. 2, cuts qualification through enzyme, shows that recombinant plasmid pET30a-PCV2 successfully constructs.
The point mutation of 2.4PET30a-PCV2 recombinant plasmid
2.4.1 design of primers and synthesis
According to principle and the principle of site-directed point mutation design of primers, devise a pair mutant primer: PCV(suddenlys change)-F/R, concrete sequence is as follows, by 685 places in the recombinant plasmid pET30a-PCV2 of above-mentioned structure T base mutation be C base, thus obtain PstI(CTGCAG) restriction enzyme site, for displacement fragment afterwards lays the first stone.
PCV(suddenlys change)-F:GAATAAAGAATACTGCAGTAAAGAAG
PCV(suddenlys change)-R:CTTCTTTACTGCAGTATTCTTTATTC
2.4.2PCR amplification
PCR reaction system: pET30a-PCV2 plasmid DNA template 2 μ L, 10 × Buffer(Mg
2+free) 2.5 μ L, MgSO
4the PCV-(sudden change of the dNTP2.5 μ L of 2 μ L, 2mmol/L, 10 μm of ol/L) each 1 μ L of F, R primer, KOD-Plus enzyme 1 μ L, ddH
2o13 μ L, cumulative volume 25 μ L; Mix on ice.
PCR reaction parameter: 94 DEG C of denaturation 5min, 94 DEG C of sex change 30s, 58 DEG C of annealing 30s, 68 DEG C extend 5min, 30 circulations, and last 68 DEG C extend 10min.
2.4.3PCR product conversion
By the above-mentioned PCR primer amplified through DpnI enzyme 37 DEG C process 3h, 65 DEG C of process 1h, transform TOP10 competent cell afterwards, filter out positive colony, send to Shanghai, Beijing Liuhe Huada Genomics Technology Co., Ltd branch office and carry out sequencing.
Sequencing result is as shown in SEQ ID No.2, and analysis shows, in gene 685 places T base successfully sport C base, be pET30a-PCV2-M by successful for this point mutation clone designation.
2.5pET30a-PCV2 exchanges the structure of recombinant plasmid
The codon-bias of software analysis PCV2 replicative enzyme, changes into non-preferences codon by preference codon, the DNA replication dna enzyme gene of the codon that external synthesis preferences changes, and by the viral original rdrp gene fragment of the sequence fragment of synthesis displacement.
2.5.1PCV2 the design of primer is exchanged
It is as follows that PCV2 exchanges primer sequence, and introduce PstI and ScaII restriction enzyme site.Primer is synthesized by Shanghai Jierui Biology Engineering Co., Ltd.
PCV exchange-F:
TCTGCAGTAAAGAAGGCAACATATTAATGGAGTGTGGAGCTCCTAGATCTCAGGGACAACGGAGTGACTTATCTACTGCTGTGAGTACCTT
PCV exchange-R:
TCCGCGGAAATTTCTGACAAACGTTACAGGGTGCTGCTCTGCAACGGTCACTAAACTCCCGCTCTCTAATAAGGTACTCACAGCAGTAGAT
2.5.2PCV2 the molecular cloning of fragment is exchanged
Primer PCV exchanges after-F and PCV exchanges-R anneal and cuts and glue recovery PCV2 exchange fragment with PstI and ScaII enzyme, be connected into the corresponding site of cutting the pET30a-PCV2-M cloned plasmids of process through Pst I and Sca II enzyme, transform TOP10 competent cell, send to Shanghai, Beijing Liuhe Huada Genomics Technology Co., Ltd branch office through the successful clone of bacterium colony PCR screening and carry out sequencing.
Sequencing result, as shown in SEQ ID No.3, shows that PCV2 exchanges fragment and successfully replaces, by the recombinant plasmid called after pET30a-PCV2-D of this acquisition by analysis.
The structure of embodiment 2PCV2 and PCV2-D strain
2.6pET30a-PCV2 and pET30a-PCV2-D plasmid enzyme restriction
PET30a-PCV2 plasmid enzyme restriction: pET30a-PCV2 plasmid 20 μ L, 3 μ L10 × buffer for EcoR I, 3 μ LEcoR I, 4 μ L ddH
2o, reaction cumulative volume is 30 μ L; 37 DEG C of water-bath 2 ~ 3h.
PET30a-PCV2-D plasmid enzyme restriction: pET30a-PCV2-D plasmid 20 μ L, 3 μ L10 × buffer for EcoR I, 3 μ LEcoR I, 4 μ L ddH
2o, reaction cumulative volume is 30 μ L; 37 DEG C of water-bath 2 ~ 3h.
Result: after 1% agarose gel electrophoresis qualification digestion completely, reclaim test kit with miniprep dna glue and reclaim PCV2 full genome and PCV2-D gene fragment.Enzyme cuts result referring to Fig. 3, shows that the PCV2 gene fragment size before and after transforming conforms to.
2.7 Ligation in vitro cyclisation and recovery
2.6 steps are reclaimed linear PCV2 full genome and PCV2-D gene fragment carry out Ligation in vitro cyclisation and build PCV2 full genome strain and PCV2-D strain.
Linear PCV2 full genome fragment 20 μ L, the Buffer for T43 μ L reclaimed, T4 ligase enzyme 3 μ L, ddH
2o4 μ L cumulative volume 30 μ L, 16 DEG C of connections are spent the night.
Linear PCV2-D gene fragment 20 μ L, the Buffer for T43 μ L reclaimed, T4 ligase enzyme 3 μ L, ddH
2o4 μ L cumulative volume 30 μ L, 16 DEG C of connections are spent the night.
Phenol-chloroform method reclaims and connects product, to add in appropriate TE-20 DEG C and saves backup.
Embodiment 3 transfection PK-15 cell and copy the detection of propagation
2.8 cell transfection assay
(1) take out the good pk15 cell of one bottle of growth conditions, reach in 24 orifice plates, every hole inoculation about 1.25 × 10
5individual cell not containing in antibiotic DMEM perfect medium, puts into 37 DEG C of CO in 500 μ L
2cultivate in incubator.Guarantee before transfection that in each hole, attached cell grows to 90% ~ 95%.
(2) cyclized DNA and transfection reagent dilution
The cyclisation PCV2 obtained in 2.7 steps and PCV2-D plasmid are respectively got 0.6ug to 50 μ L not contain in the DMEM of microbiotic and serum.
Get transfection reagent Lipofectamine
tM20002.4 μ L to 100 μ L do not contain in the MEM of microbiotic and serum, mixing of vibrating gently, incubated at room 5min.
(3) cyclized DNA diluted and each 50 μ L equal-volumes of transfection reagent are mixed, incubated at room 20min.
(4) discarded by the old nutrient solution in 24 orifice plates, wash twice with PBS, then wash once with DMEM, every hole adds 300 μ LDMEM.
(5) add in cell hole by 100 μ L cyclized DNAs and transfection reagent mixture again, vibrate 24 orifice plates gently, puts into 37 DEG C of CO
2cultivate in incubator.
The serum of 5% is added in every hole after (6) 2 hours.
After (7) 6 ~ 8h, old nutrient solution is discarded, add the complete DMEM substratum of 500 μ L.
(8) collect cells and supernatant respectively after 72h, both obtain 1st generation PCV2 and PCV2-D virus liquid.
(9) respectively PCV2 and the PCV2-D virus liquid that (8) step obtains respectively is got 50 μ L and infect PK15 cell in 24 orifice plates again, plating cells conditional synchronization rapid (1).Discarded by virus liquid in 24 orifice plates after virus infection 1.5h, PBS washes 2 times, adds the DMEM substratum containing 2% serum, collects cells and supernatant respectively after 72h, has both obtained 2nd generation PCV2 and PCV2-D virus liquid.
(10) in the same way PCV2 and PCV2-D virus liquid is gone down to posterity after.
The increment of 2.9PCV2 virus replication detects
Get the virus liquid in consecutive infection 6 generation in 2.8, per in generation, gets 200ul virus liquid extracting genomic dna respectively, carries out PCR detection afterwards.Detected result is referring to Fig. 4.Can find out that from detected result the multiple-copy rate of improved strain PCV2-D in host cell obviously reduces, and also be obtain same result after revision test several times, show that the present invention successfully obtains low virulent strain vaccine PCV2-D by genetic modification.
3.0 Immunofluorescence test (IFA)
Get PCV2 and PCV2-D cells and supernatant respectively and infect PK15 cell, carry out IFA detection after cultivating 72-96h, detected result is referring to Fig. 5.Can find out that from detected result the low virulent strain vaccine PCV2-D that the present invention obtains has certain infectivity.
Embodiment 4 experimentation on animals
The mouse immuning test of 3.1 attenuated vaccine strain PCV2-D
Choose healthy mice 12 in 6 ~ 8 week age, be divided into 2 groups at random, the 1st group is immune PCV2-D low virulent strain vaccine, and route of inoculation and dosage of inoculation are respectively: only, leg muscle injection 0.2mL/ only for abdominal injection 0.3mL/.2nd group of blank group, the physiological saline of route of inoculation and dosage of inoculation equivalent replaces.Every immunity in 10 days once, continuous immunity three times, within after the third immunization the 10th day, from mouse tail blood sampling, separation of serum, carries out IFA antibody test.Specificity PCV2 antibody can be detected in mice serum after detected result shows immunity.
3.2 challenge test
Only get the PCV2 pathological material of disease suspension 0.5mL/ of 3 abdominal injection aseptically process 6 mouse after exempting from from the 1st group three at random, this group attacks malicious group after being set to immunity.From the 2nd group of blank group, only also get the PCV2 pathological material of disease suspension 0.5mL/ of 3 abdominal injection aseptically process at random, this group is set to positive controls.In 2nd group, only, this group is set to negative control group to remaining 3 mouse peritoneals injection stroke-physiological saline solution 0.5mL/.
3.3 mouse cuts open inspection and PCR detection after attacking poison
Get and attack the poison each group of aseptic dissection of mouse of latter 14th day, get spleen respectively, lungs, liver is for subsequent use.The spleen getting each group of mouse extracts genomic dna by phenol chloroform ordinary method.Carry out PCR detection afterwards.Result positive controls detects the existence of PCV2, and negative control group does not detect PCV2, and attack after immunity poison group PCV2 do not detected yet.Malicious mouse of attacking against each other after vaccine immunity is described can produce certain provide protection.
3.4PCV2-D attenuated vaccine pig body immunity test
The weanling pig of 6 PCV2 feminine genders is divided into 2 groups at random, the 1st group of immunity PCV2-D attenuated vaccine, route of inoculation and dosage of inoculation are respectively: musculi colli injection 2mL/ only.2nd group of blank group, the physiological saline of route of inoculation and dosage of inoculation equivalent replaces.Every immunity in 10 days once, continuous immunity three times, within after the third immunization the 10th day, take a blood sample from the oxter of pig, separation of serum, carries out IFA antibody test.Specificity PCV2 antibody can be detected in pig body serum after detected result shows immunity.
Claims (4)
1. a strain pig circular ring virus attenuated vaccine strain PCV2-D, it is characterized in that, its microbial preservation number is: CGMCC No.7245.
2. the preparation method of pig circular ring virus attenuated vaccine strain PCV2-D according to claim 1, is characterized in that, comprise the following steps:
First, according to the PCV2 complete genome sequence announced in GenBank, design a pair Auele Specific Primer: PCV-F/R, pcr amplification goes out the whole genome sequence of PCV2, obtains the specific fragment of a 1767bp, and its nucleotide sequence is as shown in SEQ ID No.1; This amplified fragments is cloned in pMD18-T carrier check order, successful for order-checking clone is cut connection by enzyme again PCV2 is building up on pET-30a carrier, obtain recombinant plasmid pET30a-PCV2;
Described specific primer sequence is as follows, and wherein italic is restriction enzyme site,
PCV-F：A
GAATTCAACCTTAACCTTTCT；
PCV-R：A
GAATTCTGGCCCTGCTCC；
Secondly, design a pair mutant primer: PCV sudden change-F/R, the T base mutation at 685 places in pET30a-PCV2 plasmid is made to be C base, thus obtain PstI (CTGCAG) restriction enzyme site, be pET30a-PCV2-M by successful for sudden change clone designation, its nucleotide sequence is as shown in SEQ ID No.2;
Described mutant primer sequence is as follows:
PCV sudden change-F:GAATAAAGAATACTGCAGTAAAGAAG
PCV sudden change-R:CTTCTTTACTGCAGTATTCTTTATTC;
3rd, by the preferences of amendment PCV2 codon, preference codon is made to change into non-preferences codon, design a pair and exchange primer: PCV exchange-F/R, the DNA replication dna enzyme gene that external synthesis codon-bias sexually revises, and by the viral original rdrp gene fragment of the sequence fragment of synthesis displacement, obtain recombinant plasmid pET30a-PCV2-D, its nucleotide sequence is as shown in SEQ ID No.3;
Described exchange primer sequence is as follows:
PCV exchange-F:
T
CTGCAGTAAAGAAGGCAACATATTAATGGAGTGTGGAGCTCCTAGATCTCAGGGACAACGGAGTGACTTATCTACTGCTGTGAGTACCTT；
PCV exchange-R:
T
CCGCGGAAATTTCTGACAAACGTTACAGGGTGCTGCTCTGCAACGGTCACTAAACTCCCGCTCTCTAATAAGGTACTCACAGCAGTAGAT；
Finally, pET30a-PCV2 and the pET30a-PCV2-D plasmid of above-mentioned acquisition is reclaimed PCV2 glm gene group DNA and cyclisation after EcoR I enzyme is cut, uses Lipofectamine
tM2000 transfection PK15 cells, collect virus liquid after cultivating 72-96h and go down to posterity, extracting DNA, and after being detected by PCR, through comparing, two groups of strains find that the multiple-copy rate of PCV2-D in host cell obviously reduces, obtain pig circular ring virus attenuated vaccine strain PCV2-D.
3. the application of attenuated vaccine strain PCV2-D according to claim 1 in preparation prevention or treatment pig circular ring virus 2 cytotoxic drug.
4. a vaccine composition for treatment or prevention Porcine circovirus desease, is characterized in that, is made up of the carrier of attenuated vaccine strain PCV2-D according to claim 1 and pharmaceutical acceptable or auxiliary material.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310165696.9A CN103275938B (en) | 2013-05-07 | 2013-05-07 | Preparation method of PCV2 (Porcine Circovirus2)-D |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310165696.9A CN103275938B (en) | 2013-05-07 | 2013-05-07 | Preparation method of PCV2 (Porcine Circovirus2)-D |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103275938A CN103275938A (en) | 2013-09-04 |
| CN103275938B true CN103275938B (en) | 2015-02-25 |
Family
ID=49058561
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310165696.9A Expired - Fee Related CN103275938B (en) | 2013-05-07 | 2013-05-07 | Preparation method of PCV2 (Porcine Circovirus2)-D |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103275938B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107723281B (en) * | 2017-09-09 | 2021-02-12 | 中国农业科学院哈尔滨兽医研究所 | Recombinant hog cholera lapinized virus vaccine strain for expressing porcine circovirus type 2 Cap protein and application thereof |
| CN113355292B (en) * | 2021-06-04 | 2024-02-06 | 天康制药股份有限公司 | Porcine circovirus gene modified attenuated strain, construction method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101932700A (en) * | 2007-12-21 | 2010-12-29 | 惠氏有限责任公司 | Methods and compositions for immunizing pigs against porcine circovirus |
-
2013
- 2013-05-07 CN CN201310165696.9A patent/CN103275938B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101932700A (en) * | 2007-12-21 | 2010-12-29 | 惠氏有限责任公司 | Methods and compositions for immunizing pigs against porcine circovirus |
Non-Patent Citations (3)
| Title |
|---|
| Molecular characterization of porcine circovirus 2 isolated from diseased pigs co-infected with porcine reproductive and respiratory syndrome virus;Jianzhong Yi et al.;《Virology Journal》;20101027;摘要，第2.1、3.1节，序列GU124593 * |
| Porcine circovirus 2 isolate sh0901, complete genome;Yi,J., Chen,B. and Liu,C.;《GenBank: GU124593.1》;20091130;全文 * |
| Virus Attenuation by Genome-Scale Changes in Codon Pair Bias;J. Robert Coleman et al.;《Science》;20080627;1784-1786 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103275938A (en) | 2013-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104248762B (en) | A kind of pig epidemic diarrhea vaccine combination and its preparation method and application | |
| CN101935637A (en) | Recombinant low-virulent vaccine strain of chicken infectious bursal disease viruses (IBDV) and application thereof | |
| CN102757942A (en) | Recombinant vaccine strain for foot-and-mouth disease type A as well as preparation method thereof and application thereof | |
| CN103509761B (en) | Recombinant porcine pseudorabies virus strain used for expression of porcine circovirus type II (PCV2) ORF2 gene, and preparation method thereof | |
| CN107899008A (en) | Sick three subunit vaccines of a kind of pig epidemic diarrhea, transmissible gastroenteritis of swine, pig fourth type coronavirus | |
| CN102787100B (en) | High-prolificacy porcine circovirus type-2 strain and application thereof | |
| CN104593388A (en) | Crucian herpesvirus disease JDORF25 vaccine as well as preparation method and application thereof | |
| CN104450559A (en) | New mycoplasma hyopneumoniae strain and vaccine composite of new mycoplasma hyopneumoniae | |
| CN101838658B (en) | O type foot-and-mouth disease virus variant as well as coding gene and application thereof | |
| CN114807060A (en) | Coxsackie virus A6 type strain and immunogenic composition and application thereof | |
| CN103275938B (en) | Preparation method of PCV2 (Porcine Circovirus2)-D | |
| CN102727883B (en) | Combined live vaccine against porcine reproductive and respiratory syndrome and swine fever, and application thereof | |
| CN107823639B (en) | Inactivated vaccine for bovine viral diarrhea virus and preparation method thereof | |
| CN103614387B (en) | The carrying Cap gene of porcine circovirus type 2 gene optimized and recombinant plasmid and application | |
| CN102533798B (en) | Recombinant denovirus for expressing foot-and-mouth disease virus type A empty capsid, and application thereof | |
| CN102747092A (en) | Recombinant defective adenoviruses expressing O type foot and mouth disease virus empty capsid, and applications thereof | |
| CN102604993B (en) | Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof | |
| CN111647568A (en) | Reverse genetic vaccine strain of novel variant strain of chicken infectious bursal disease virus and application thereof | |
| CN103204942B (en) | Pig gyrate virus II type genetic engineering subunit vaccine and its preparation method and application | |
| CN103103205A (en) | Gene for encoding recombinant porcine circovirus type 2 (PCV2) Cap protein and application of gene | |
| CN106929480A (en) | Porcine reproductive and respiratory syndrome virus strain and its application | |
| CN102363770A (en) | Recombinant baculovirus capable of expressing porcine circovirus type 2 Cap protein and somatostatin in fusion manner, and subunit vaccine thereof | |
| CN110974951B (en) | Bivalent inactivated vaccine and preparation method thereof | |
| CN108586585A (en) | A kind of canine distemper genetic engineering subunit vaccine | |
| CN1242065C (en) | Pig breeding and respiratory syndrome recombined adenovirus and vaccine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150225 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |