CN103275883A - Xylanase recombined and expressed engineering bacterium - Google Patents

Abstract

The invention relates to a xylanase recombined and expressed engineering bacterium, that is, xylanase genes of aspergillus fumigatus are transformed into pichia pastoris by means of a genetic engineering technology, and a pichia pastoris engineering strain is constructed; and xylanase can be efficiently expressed, and the produced xylanase has higher activity and higher heat resistance as well as pepsin and trypsin tolerance at the same time under an acidic condition.

Description

The recombinant expressed engineering bacteria of a kind of zytase

Technical field

The invention belongs to gene engineering technology field, be specifically related to the recombinant expressed engineering bacteria of a kind of zytase.

Technical background

Xylan (xylan) is the main component of plant hemicellulose, extensively is present in occurring in nature, and its content is only second to Mierocrystalline cellulose, is the second abundant saccharan.Xylan accounts for the 15%-30% of dry matter weight in angiosperm, accounts for the 7%-12% of dry matter weight in gymnosperm.Xylan can not be digested and be absorbed in the digestive tube of animal, and can influence other nutrient absorbing utilization, has very strong anti-oxidant action, thereby has limited the application of being rich in xylan feed (barley, wheat, rye etc.) greatly.Zytase (Xylanase) refers to single-minded degradation of hemicellulose xylan to be the general name of one group of enzyme of xylo-oligosaccharide and wood sugar.People just begin as far back as the sixties to the research of zytase, and main research concentrates on the zytase of aspects such as food, feed, papermaking, energy industry.Studies show that, add zytase and can improve the feed conversion rate that the wheat class reaches unconventional feeds such as assorted dregs of rice class, promote Nutrients Digestion to absorb, keep intestinal microecology and reduce pollution.

Up to now, fewer about the report of acidic xylanase, the suitableeest action pH value of most of zytases is at 6-7.Acidic xylanase (still keeping the high enzyme activity when pH4.0 is following) has caused people's extensive concern.And the application of acidic xylanase in feedstuff industry, can destroy the covalent cross-linking in the xylan molecule effectively, significantly reduce the araboxylan molecular size, thereby reduce the viscosity of chyme, improve feed performance, reduce the anti-oxidant action that causes because of the viscosity increase.In China, to the research of having a liking for the sourwood glycanase seldom, use the genetic engineering means industrialization to produce to have a liking for sourwood glycanase product to yet there are no report.

Summary of the invention

The Pichia yeast engineering that the purpose of this invention is to provide a kind of recombinant expressed zytase, namely utilize the genetic engineering technique means, the xylanase gene of Aspergillus fumigatus (Aspergillus fumigatus) is transformed in the pichia spp, makes up pichia pastoris engineered strain; Can highly effective expression of xylanase, and the zytase of producing has greater activity under acidic conditions, have very strong thermotolerance and stomach en-, trypsinase tolerance simultaneously.

The present invention is used for the Pichia yeast engineering of recombinant expressed zytase, be pichia pastoris phaff H43(Pichia pastoris H43), on June 6th, 2013, be preserved in the Chinese typical culture collection center of Chinese Wuhan Wuhan University, preserving number is: CCTCC NO:M2013252.

Described zytase, its aminoacid sequence are SEQ ID NO:1.

Be used for the gene of the above-mentioned zytase of coding, its a kind of nucleotide sequence is SEQ ID NO:2.

Pichia yeast engineering of the present invention is for the production of zytase, and its recombinant expressed zytase is suitable under acidic conditions.

The high efficiency recombinant expressed zytase of Pichia yeast engineering energy that the present invention makes up, fermenting enzyme work can reach 10000U/ml; The zytase of its expression has higher enzymic activity in acid range, optimum pH is 5.0, can keep the activity more than 80% in the scope of pH4.0-5.5; Have very strong thermotolerance, optimal reactive temperature is 50 ℃, in temperature 35-60 ℃ scope, can keep the activity more than 50%, and behind 85 ℃ of processing 2min, 5min, enzyme residual rate alive is 50%, 48%; Stomach en-and trypsinase are had very strong tolerance, and behind pepsin 2h, enzyme residual rate alive is 68%, and behind the trypsin treatment 6h, enzyme residual rate alive is 87%, therefore can be widely used in fields such as food, fodder additives.

Description of drawings

Fig. 1: the pcr amplification agarose gel electrophoresis figure of xylanase gene XynH43.

Fig. 2: the process synoptic diagram of the recombinant expression vector pPIC9K-XynH43 of structure.

Fig. 3: Pichia yeast engineering fermented supernatant fluid SDS-PAGE electrophorogram, arrow is depicted as recombined xylanase XYNH43.

Fig. 4: the leaven line chart of recombinant expressed zytase XYNH43.

Fig. 5: the pH specificity analysis of recombinant expressed zytase XYNH43.

Fig. 6: the temperature of reaction analysis of recombinant expressed zytase XYNH43.

Fig. 7: the thermotolerance analysis of recombinant expressed zytase XYNH43.

Fig. 8: the albumen tolerance of recombined xylanase XYNH43 is analyzed.

Embodiment

Below in conjunction with example method of the present invention is described further.The experimental technique of unreceipted actual conditions among the embodiment, condition routinely usually, the condition described in " the molecular cloning experiment guide " write as J. Sa nurse Brooker (Sambrook) etc., or the condition operation of advising according to manufacturer.The relevant technician in this area can understand better and grasps the present invention by embodiment.But, the case that protection of the present invention and claim scope are not limited to provide.

The clone of embodiment 1, Aspergillus fumigatus xylanase gene

Consult the gene order among the GenBank, find an xylanase gene in glycoside hydrolase 11 families, this gene source is in Aspergillus fumigatus (Aspergillus fumigatus), and GenBank number is 70985696.By synthetic this xylanase gene of Shanghai Jierui Biology Engineering Co., Ltd, called after XynH43, the gene order of synthetic gene is SEQ ID NO:2, its amino acid sequence coded is SEQ ID NO:1.

Adopt PCR reaction clone xylanase gene XynH43 fragment, primer and reaction conditions are as follows:

Primer 1 (F): GCGC GAATTCGCCCCCGTCGAACCCGAGACCA

Primer 2 I:TAAA GCGGCCGCCTAGTAGACAGTGATGGAAGCA

Reaction conditions is: 94 ℃ of sex change 5min; 94 ℃ of sex change 30s then, 56 ℃ of renaturation 30s, 72 ℃ are extended 45s, after 30 circulations, 72 ℃ of insulation 10min.The PCR product carries out agarose gel electrophoresis and detects, agarose electrophoresis result as shown in Figure 1, the XynH43 gene is the fragment of big or small 633bp.

The structure of the Pichia yeast engineering of embodiment 2, recombinant expressed xylanase gene

1, the structure of expression vector

The xylanase gene XynH43 fragment that the clone is obtained, carry out double digestion with restriction enzyme EcoR I and Not I, it is as follows that 100 μ l enzymes are cut system: xylanase gene XynH43PCR product 40 μ l, 10 * H buffer10 μ l, 10 * BSA10 μ l, EcoR I5 μ l, Not I5 μ l, ddH ₂O30 μ l.After 37 ℃ of enzymes were cut 4h, agarose gel electrophoresis reclaimed.

Expression vector pPIC9K is earlier carried out single endonuclease digestion with restriction enzyme EcoR I, and it is as follows that 100 μ l enzymes are cut system: expression vector pPIC9K20 μ l, 10 * H buffer10 μ l, EcoR I5 μ l, ddH ₂O65 μ l.After 37 ℃ of enzymes were cut 4h, agarose gel electrophoresis reclaimed.To reclaim fragment and carry out single endonuclease digestion with restriction enzyme Not I again, it is as follows that 100 μ l enzymes are cut system: pPIC9K reclaims fragment 20 μ l, 10 * H buffer10 μ l, 10 * BSA10 μ l, 10 * Triton10 μ l, Not I5 μ l, ddH ₂O45 μ l.After 37 ℃ of enzymes were cut 4h, agarose gel electrophoresis reclaimed.

To be connected with expression vector pPIC9K through the XynH43 fragment of EcoR I and Not I double digestion, construction of expression vector pPIC9K-XynH43, as shown in Figure 2.Linked system is as follows: expression vector pPIC9K5 μ l, XynH43 fragment 3 μ l, 10 * T ₄Ligase buffer1 μ l, T ₄Ligase1 μ l.22 ℃ of connections are spent the night, and are transformed into bacillus coli DH 5 alpha, picking transformant sequence verification.The transformant that sequence verification is correct is transferred in the LB liquid nutrient medium, 37 ℃ of incubated overnight, and the upgrading grain is expression of recombinant yeast plasmid pPIC9K-XynH43, and plasmid map is seen Fig. 2.

2, transform and screen

PPIC9K-XynH43 carries out linearizing with Sal I with the expression of recombinant yeast plasmid, and the linearizing fragment transforms pichia spp GS115 by electroporation after using column purification test kit purifying, coating MD flat board.The bacterium colony that grows at the MD flat board is pichia pastoris engineered strain, is coated with the transformant of screening multiple copied on the YPD flat board that contains the different concns Geneticin then.

3, fermentation checking

The single positive transformant of picking is transferred in the BMGY substratum, and 30 ℃, behind the 250rpm shaking culture 1d, change over to again in the BMMY substratum, 30 ℃, the 250rpm shaking culture is added 0.5% methyl alcohol every day.Behind the abduction delivering 4d, centrifugal removal thalline carries out the SDS-PAGE electrophoresis detection with supernatant liquor.The result as shown in Figure 3, arrow indication band is recombinant expressed zytase XYNH43, its molecular weight is about 22.6kDa.With this positive transformant called after pichia pastoris phaff H43(Pichia pastoris H43), and be preserved in the Chinese typical culture collection center of Chinese Wuhan Wuhan University on June 6th, 2013, deposit number is CCTCC NO:M2013252.Supernatant liquor is carried out Xylanase activity measure, the result shows, shakes under bottle level that the expression amount of zytase XYNH43 reaches 247U/ml in this project bacterium.

Xylanase activity power detection method is as follows:

Get 2ml concentration and be 1% xylan substrate (pH5.5 acetic acid-sodium acetate buffer preparation), join in the colorimetric cylinder, 37 ℃ of balance 10min, adding 2ml more suitably dilutes and through 37 ℃ of acidic xylanase enzyme liquid that balance is good, mixing is in 37 ℃ of accurate insulation reaction 30min through pH5.5 acetic acid-sodium acetate buffer.After reaction finishes, add 5ml DNS reagent, mixing is with termination reaction.Boiling water bath boils 5min then, is cooled to room temperature with tap water, and adding distil water is settled to 25ml, behind the mixing, is blank with the blank sample of standard, measures light absorption value AE at the 540nm place.

The enzyme unit definition of living: be under 5.5 the condition at 37 ℃, pH value, per minute is that the needed enzyme amount of release 1 μ mol reducing sugar is an enzyme activity unit U the xylan solution of 5mg/ml from concentration.

Formula is calculated in enzyme work:

$X_D=\frac{[(A_E-A_B)\×K+C_0]}{M\×t}\×N\×1000$

In the formula: X _DBe the vigor of zytase in the dilution enzyme liquid, U/ml; A _EAbsorbancy for enzyme reaction solution; A _BAbsorbancy for the enzyme blank solution; K is the slope of typical curve; C ₀Intercept for typical curve; M is the molar mass of wood sugar, 150.2g/mol; T is the enzyme digestion reaction time, min; N is enzyme liquid extension rate; 1000 is transforming factor, 1mmol=1000 μ mol.

The application of embodiment 3 Pichia yeast engineerings in producing zytase

Carry out the fermentation of pichia spp H43 at 10 liters of fermentor tanks.

Fermentative medium formula: calcium sulfate 1.1g/L, potassium primary phosphate 5.5g/L, primary ammonium phosphate 55g/L, vitriolate of tartar 20.3g/L, sal epsom 16.4g/L, potassium hydroxide 1.65g/L, defoamer 0.05%.

Fermentation manufacturing technique: pH value 5.0,30 ℃ of temperature, stir speed (S.S.) 300rpm, ventilation 1.0-1.5(v/v), dissolved oxygen is controlled more than 20%.

Whole fermentation process is divided into three phases: the fs is the yeast culture stage, inserts seed in 7% ratio, cultivates 24-26h, is sign to have mended glucose for 30 ℃; Subordinate phase is the hungry stage, and after glucose had been mended, stream did not add any carbon source, when dissolved oxygen rises to more than 80%, shows this stage end, schedules to last about 30-60min; Phase III is the abduction delivering stage, and stream adds methanol induction, and keeps dissolved oxygen more than 20%, and incubation time is between 150-180h.After the fermentation ends, fermented liquid is handled the back by flame filter press obtain crude enzyme liquid.Live by the biomass in the mensuration different time sections fermented liquid and the enzyme of zytase XYNH43, make the course of fermentation curve.The result as shown in Figure 4, the final fermenting enzyme work of pichia spp H43 can reach 10000U/ml.

The zymologic property of embodiment 4 zytases is measured

1, the mensuration of optimal reaction pH

Employing pH value is respectively Sodium phosphate dibasic-citrate buffer solution of 2.0,2.5,3.0,4.0,4.5,5.0,5.5,6.0,7.0,8.0, the supernatant liquor of fermentation is carried out dilution metering, the xylan substrate is also prepared with the damping fluid of corresponding pH value respectively, carrying out Xylanase activity under 37 ℃ respectively measures, the calculating enzyme is lived, be 100% with the highest enzyme work, calculate relative enzyme and live, do the relative enzyme of the pH-curve of living.The result as shown in Figure 5, the zytase XYNH43 optimal reaction pH value that pichia spp H43 produces is 5.0, is acidic xylanase.

2, the mensuration of optimal reactive temperature

Under the pH5.5 condition, the Xylanase activity of fermented supernatant fluid is 100% with the highest enzyme work when measuring 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃ temperature respectively, calculates relative enzyme and lives, and does temperature-relative enzyme curve alive.The result as shown in Figure 6, the zytase XYNH43 optimal reactive temperature that pichia spp H43 produces is 50 ℃.

3, the mensuration of thermostability

The damping fluid of using differing temps (60 ℃, 65 ℃, 70 ℃, 75 ℃, 80 ℃, 85 ℃) preheating 5min respectively with diluted sample to 20U/ml, mix, (60 ℃, 65 ℃, 70 ℃, 75 ℃, 80 ℃, 85 ℃) handle 2min, 5min under this temperature condition respectively, sampling and dilution are cooled to room temperature during end, the enzyme of measuring then after diluting is lived, and calculates remnant enzyme activity.Be 100% with untreated samples, curve plotting.The result as shown in Figure 7, the zytase XYNH43 that pichia spp H43 produces has good thermostability.

4, simulated gastric fluid, simulated intestinal fluid tolerance are measured

By Chinese Pharmacopoeia (version in 2005) preparation simulated gastric fluid: get dilute hydrochloric acid (9.5%-10.5% gets 243ml hydrochloric acid and joins in the 1000ml water) 16.4ml, add water 800ml and stomach en-10g, after shaking up, thin up to 1000ml namely; Above-mentioned recombined xylanase crude enzyme liquid is diluted to about 100U/ml with simulated gastric fluid, behind 37 ℃ of processing 2h, take out immediately, be that acetic acid-sodium acetate buffer of 5.5 carries out next step dilution with pH then, measure xylanase activity power, the calculating residual enzyme is lived, and is 100% with the protoenzyme work of the sample do not handled, calculates residual rate.After handling 2h, enzyme residual rate alive is 68%.

Prepare artificial intestinal fluid: pH6.8 by Chinese Pharmacopoeia (version in 2005) and get potassium primary phosphate 6.8g, add water 500mL and make dissolving, regulate pH value to 6.8 with the 0.1mol/L sodium hydroxide solution, get pancreatin 10g, add water and make dissolving in right amount, after 2 liquid are mixed, thin up to 1000mL namely; The artificial intestinal fluid of preparation pH=6.8; Above-mentioned acidic xylanase crude enzyme liquid is diluted to about 100U/ml with simulated gastric fluid, behind 37 ℃ of processing 6h, take out immediately, be that acetic acid-sodium acetate buffer of 5.5 carries out next step dilution with pH then, measure xylanase activity power, the calculating residual enzyme is lived, and is 100% with the protoenzyme work of the sample do not handled, calculates residual rate.After handling 6h, enzyme residual rate alive is 87%.

Above-mentioned experimental result shows that the stomach en-of zytase XYNH43 and trypsinase that pichia spp H43 produces have very strong tolerance, therefore can be widely used in fields such as food, fodder additives.

Claims (6)

1. the Pichia yeast engineering of a recombinant expressed zytase, its deposit number is CCTCC NO:M2013252.

2. Pichia yeast engineering as claimed in claim 1 is characterized in that described zytase, and its aminoacid sequence is SEQ ID NO:1.

3. Pichia yeast engineering as claimed in claim 1 is characterized in that described zytase, and the nucleotides sequence of its encoding gene is classified SEQ ID NO:2 as.

4. the application of the described Pichia yeast engineering of claim 1 in producing zytase.

5. a zytase is to use the recombinant expressed preparation of the described Pichia yeast engineering of claim 1.

6. the described zytase of claim 5 is suitable under acidic conditions.

Images