CN103266168A - RCA method for detecting hepatitis B virus drug resistance gene - Google Patents

Abstract

The invention discloses a RCA method for detecting hepatitis B virus drug resistance gene. The method comprises the following steps: (1) carrying out HBV genome PCR amplification; and (2) carrying out single RCA, then carrying out 1.0% agarose gel electrophoresis, and adopting a gel imager to observe the electrophoresis result. According to the present invention, the padlock probe and RCA combined technology is a new gene locus mutation detection method, wherein the padlock probe is adopted to specifically recognize a point mutation locus of a target gene, the RCA amplification amplifies a detection signal, and the method has characteristics of no requirement of special equipment, simple operation, good specificity and high sensitivity, and has unique advantages in the field of pathogen drug resistance locus mutation detection.

Description

Detect the RCA method of hepatitis-B virus drug-tolerant gene

Technical field

The present invention relates to biological technical field, specifically, relate to a kind of RCA method of detection hepatitis-B virus drug-tolerant gene.

Background technology

Pathogenic micro-organism greatly reduces the result for the treatment of of antibacterials to the tolerance of antibacterials, has become the needle-holding hand problem that the clinical infectious disease treatment faces.Studies show that the transgenation of pathogenic micro-organism is that it produces chemical sproof basic reason.The resistance of pathogenic micro-organism such as bacterium, fungi can be monitored by drug resistant gene detection and external drug sensitive experiment, but viruses such as HBV, HCV still do not have external drug sensitive experiment, can only carry out drug resistant gene and detect.Therefore, the resistance site is detected in the treatment of various infectious diseases, has important clinical value for the selection of instructing anti-infectives and rational Application.At present, gene mutation site detects sequencing, chip hybridization method etc.Gene order surveying method is loaded down with trivial details, expense costliness, length consuming time; Chip hybridization is prone to false positive based on round pcr.(rolling circle amplification is the linear amplification technique of a kind of constant temperature RCA) to rolling circle amplification, and advantage such as fast simple, highly sensitive and high specificity is subjected to extensive concern with it.Padlock probe is made up of 5 ' Side Template land, middle catenation sequence district and 3 ' Side Template land.Wherein 3 ' end terminal bases is generally the mutational site cog region.When 5 ' end and 3 ' end and the complete complementation of template, the probe two ends form phosphodiester bond and are connected to ring under the effect of dna ligase, for the RCA amplification provides annular template, the latter and primer hybridization also start the rolling circle amplification reaction under the effect of archaeal dna polymerase, form a dna single chain that contains the complementary tumor-necrosis factor glycoproteins of a large amount of annular templates.When 5 ' end and 3 ' end and template can not match fully the time, probe can't connect into ring and keep wire, also just the RCA amplified reaction can not take place.Thereby need explore a kind of rolling circle amplification technology of utilizing, detect the method for viruses such as HBV in conjunction with padlock probe.

Summary of the invention

Technical problem to be solved by this invention is to provide a kind of RCA method that detects hepatitis-B virus drug-tolerant gene, this detection method is simple to operate, cycle detection time is short, testing cost is few, combine by PCR, single loop RCA and padlock probe, can detect the method for hepatitis-B virus drug-tolerant gene accurately.

Technical scheme of the present invention is as follows: a kind of RCA method that detects hepatitis-B virus drug-tolerant gene, finish according to following steps:

(1), HBV genome pcr amplification:

A, extraction HBV genome:

1), in 1.5ml screw-cap centrifuge tube, adds 0.1ml serum sample and 0.6mlQlysis-V Reagent, room temperature placement 10min behind the vibration 30s mixing;

2), the 0.7ml Virahol is joined in the mixing solutions of step 1) gained, behind the vibration 30s mixing, the centrifugal 15min of 15000g room temperature;

3), with step 2) the centrifugal product of gained moves and abandons supernatant liquor, adds 1.0ml70% ethanol again, the centrifugal 5min of 15000g room temperature after the vibration several seconds;

4), the centrifugal product of step 3) gained moved abandons supernatant liquor, add the 100ul deionized water again, blow and beat at the bottom of the centrifuge tube official repeatedly and the membranaceous precipitation of tube wall, make its dissolving ,-20 degree are preserved standby;

B, pcr amplification HBV genome:

Primer RT-F 5 '-CGTGAAGCTTGACTCGTGGTGGACTTCTCTCA-3 ' SEQ NO1;

Primer RT-R 5 '-ATATGGTACCGGCATTAAAGCAGGATAACCACATTG-3 ' SEQ NO2;

1), pcr amplification system 30ul:

2), PCR circulating system:

Get the pcr amplification product that makes with 3.0% agarose gel electrophoresis, observe electrophoresis result by the gel imaging instrument;

(2), single loop RCA:

Cyclisation connection and the enzyme of a, padlock probe are cut: the padlock probe 2 μ l of deionized water 12 μ l, 1 μ mol/L, the PCR product 2 μ l that step (1) makes and 10 * E.coli Buffer2 μ l, mixing, 95 ℃ of 5min, 45 ℃ hatch 40min after, add 10 * BSA damping fluid 2 μ l and 0.2 μ lE.coliDNA ligase enzyme, mixing, 37 ℃ are carried out cyclisation ligation 40min; Add 10 * Exonuclease I Buffer2 μ l and Exonuclease I exonuclease 2 μ l again, mixing, 37 ℃ of reactions 1h, deactivation Exonuclease I exonucleases under 95 ℃ of conditions at last;

B, RCA amplification: get the probe cyclisation that makes among the step a and connect product 24 μ l, add 100 μ mol/L primers, 1 μ l and 10 * phi29Buffer3 μ l, 95 ℃ of 5min, ice bath 1min; Add phi29DNA polysaccharase 1 μ l, dNTP liquid 1 μ l, 37 ℃ are carried out RCA reaction 2h behind the mixing;

C, get amplified production that step b makes with 1.0% agarose gel electrophoresis, observe electrophoresis result by the gel imaging instrument;

Designed primer for the RCA reaction is in the described step (2):

Primer 5 '-ATGGGCACCGAAGAAGCA-3 ' SEQ NO3;

Probe is:

Padlock probe

5 '-CCTACGAACCACTGAACTGCTTCTTCGGTGCCCATACATCAAATGCCACGTTAACA GTCAGGCCTAGTGGGGGAAAGC-3 ', 5 of probe ' end carries out phosphorylation modification SEQ NO4.

Adopt technique scheme, the present invention is a kind of novel method that detects gene point mutation by padlock probe in conjunction with the RCA technology, by the point mutation site of padlock probe specific recognition target gene, and RCA amplification amplification detection signal.This method do not need specific installation, simple to operate, specificity good, highly sensitive, have unique advantage in pathogenic agent resistance site mutation context of detection.

The specificity of RCA amplified reaction:

Detect the mutant template that final concentration is respectively 5pM, 50pM, 500pM and 5nM with method of the present invention, the gene order of mutant template is:

5 '-ACTAGTGCCATTTGTTCAGTGGTTCGTAGGACTTTCCCCCACTGTTTGGCTT-3 ' SEQ NO5, the specificity of discussion RCA amplified reaction.Electrophoresis result shows that the mutant template of each concentration there is no obvious amplified production band (Fig. 1), proves the high specificity of the RCA amplified reaction that this experiment is set up.

The minimal detectable concentration of RCA amplified reaction:

Adopt method of the present invention to detect different concns wild-type template, the gene order of wild-type template is:

5 '-ACTAGTGCCATTTGTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTT-3 ' SEQ NO6; RCA amplified production electrophoresis result as shown in Figure 2.The result shows that single loop RCA there is no amplified production below template final concentration 5pmol/L, the band that all as seen becomes clear more than the template final concentration 50pmol/L, and the minimal detectable concentration that shows single loop RCA is 50pmol/L.Results suggest, single loop RCA can satisfy the detection of low virus load sample preferably.

Beneficial effect: padlock probe of the present invention is a kind of novel method that detects gene point mutation in conjunction with the RCA technology, by the point mutation site of padlock probe specific recognition target gene, and RCA amplification amplification detection signal.This method do not need specific installation, simple to operate, specificity good, highly sensitive, have unique advantage in pathogenic agent resistance site mutation context of detection.

Description of drawings

Fig. 1 single loop RCA detects the HBV tynofovir resistant mutational site electrophoresis result (the 1st, 2,3,4,5 swimming lanes represent the blank group respectively, final concentration is 5pmol/L, 50pmol/L, 500pmol/L and 5nmol/L mutant template group amplified production electrophoresis result) of different concns.

Fig. 2 single loop RCA detects the wild-type template electrophoresis result (the 1st, 2,3,4,5 swimming lanes represent the blank group respectively, final concentration is 5pmol/L, 50pmol/L, 500pmol/L and 5nmol/L wild-type template group amplified production electrophoresis result) in different concns HBV tynofovir resistance site.

The electrophoresis result of Fig. 3 PCR product (2 swimming lanes are the blank group, and 3,4,5,6,7,8,9 swimming lanes are the 1st to No. 7 sample PCR product group electrophoresis result).

Fig. 4 PCR product carries out the electrophoresis result (2 are the blank group, and 3,4,5,6,7,8,9 is the 1st to No. 7 sample RCA product group electrophoresis result) that RCA detects.

The matched sequence figure of target sequence and wild-type template in Fig. 5 sample 1 sequencing result (the line part is target sequence in the sequencing result among the figure).

The matched sequence figure of target sequence and wild-type template in Fig. 6 sample 2 sequencing results (the line part is target sequence in the sequencing result among the figure).

The matched sequence figure of target sequence and wild-type template in Fig. 7 sample 3 sequencing results (the line part is target sequence in the sequencing result among the figure).

The matched sequence figure of target sequence and wild-type template in Fig. 8 sample 4 sequencing results (the line part is target sequence in the sequencing result among the figure).

The matched sequence figure of target sequence and wild-type template in Fig. 9 sample 5 sequencing results (the line part is target sequence in the sequencing result among the figure).

The matched sequence figure of target sequence and wild-type template in Figure 10 sample 6 sequencing results (the line part is target sequence in the sequencing result among the figure).

The matched sequence figure of target sequence and wild-type template in Figure 11 sample 7 sequencing results (the line part is target sequence in the sequencing result among the figure).

Embodiment

The present invention is further illustrated below in conjunction with embodiment:

Embodiment 1

A kind of RCA method that detects hepatitis-B virus drug-tolerant gene, finish according to following steps:

(1), HBV genome pcr amplification:

A, extraction HBV genome:

1), in 1.5ml screw-cap centrifuge tube, adds 0.1ml serum sample and 0.6mlQlysis-V Reagent, room temperature placement 10min behind the vibration 30s mixing;

2), the 0.7ml Virahol is joined in the mixing solutions of step 1) gained, behind the vibration 30s mixing, the centrifugal 15min of 15000g room temperature;

3), with step 2) the centrifugal product of gained moves and abandons supernatant liquor, adds 1.0ml70% ethanol again, the centrifugal 5min of 15000g room temperature after the vibration several seconds;

4), the centrifugal product of step 3) gained moved abandons supernatant liquor, add the 100ul deionized water again, blow and beat at the bottom of the centrifuge tube official repeatedly and the membranaceous precipitation of tube wall, make its dissolving ,-20 degree are preserved standby;

B, pcr amplification HBV genome:

Primer RT-F 5 '-CGTGAAGCTTGACTCGTGGTGGACTTCTCTCA-3 ' SEQ NO1;

Primer RT-R 5 '-ATATGGTACCGGCATTAAAGCAGGATAACCACATTG-3 ' SEQ NO2;

1), pcr amplification system 30ul:

2), PCR circulating system:

Get the pcr amplification product that makes with 3.0% agarose gel electrophoresis, observe electrophoresis result by the gel imaging instrument;

(2), single loop RCA:

Cyclisation connection and the enzyme of a, padlock probe are cut: the padlock probe 2 μ l of deionized water 12 μ l, 1 μ mol/L, the PCR product 2 μ l that step (1) makes and 10 * E.coli Buffer2 μ l, mixing, 45 ℃ hatch 40min after, add 10 * BSA damping fluid 2 μ l and 0.2 μ lE.coli dna ligase, mixing, 37 ℃ are carried out cyclisation ligation 40min.Add 10 * Exonuclease I Buffer2 μ l and Exonuclease I exonuclease 2 μ l again, mixing, 37 ℃ of reactions 1h, deactivation Exonuclease I exonucleases under 95 ℃ of conditions at last;

B, RCA amplification: get the probe cyclisation that makes among the step a and connect product 24 μ l, 100 μ mol/L primers, 1 μ l and 10 * phi29Buffer3 μ l, 95 ℃ of 5min, ice bath 1min.Add phi29DNA polysaccharase 1 μ l, dNTP liquid 1 μ l, 37 ℃ are carried out RCA reaction 2h behind the mixing;

C, get amplified production that step b makes with 1.0% agarose gel electrophoresis, observe electrophoresis result by the gel imaging instrument;

Designed primer for the RCA reaction is in the described step (2):

Primer 5 '-ATGGGCACCGAAGAAGCA-3 ' SEQ NO3;

Probe is:

Padlock probe

5 '-CCTACGAACCACTGAACTGCTTCTTCGGTGCCCATACATCAAATGCCACGTTAACA GTCAGGCCTAGTGGGGGAAAGC-3 ', 5 of probe ' end carries out phosphorylation modification SEQ NO4.

Detection method by embodiment 1 detects 7 routine hepatitis B patient serum samples:

1, the PCR product detects:

Detection method by embodiment 1 is carried out genome RT district pcr amplification after 7 routine hepatitis B patient serum samples are extracted the HBV genomes.As a result, by gel electrophoresis target stripe bright (Fig. 3).Band does not appear in the blank group, illustrates that amplification procedure is not comtaminated, credible result.

2, the RCA product detects:

The PCR product of 7 samples is carried out the RCA detection, and the result is positive (Fig. 4) all.

3, sequencing result:

Target sequence and wild-type template middle probe 5 ˊ hold 3 ˊ terminal sequence matched sequence (ACTAGTGCCATTT in 7 sample sequencing results GTTCAGTGGTTCGTAGGGCTTTCCCCCACTGTTTGGCTT, the line part is held 3 ˊ terminal sequence matched sequences for probe 5 ˊ) fit like a glove.Because the detected result of 7 samples is positive entirely, and this experiment detection method rate of accuracy reached 100%(Fig. 5 to Figure 11 is described).

Claims (1)

1. a RCA method that detects hepatitis-B virus drug-tolerant gene is characterized in that, finishes according to following steps:

(1), HBV genome pcr amplification:

A, extraction HBV genome:

1), in 1.5ml screw-cap centrifuge tube, adds 0.1ml serum sample and 0.6ml Qlysis-V Reagent, room temperature placement 10min behind the vibration 30s mixing;

2), the 0.7ml Virahol is joined in the mixing solutions of step 1) gained, behind the vibration 30s mixing, the centrifugal 15min of 15000g room temperature;

3), with step 2) the centrifugal product of gained moves and abandons supernatant liquor, adds 1.0ml70% ethanol again, the centrifugal 5min of 15000g room temperature after the vibration several seconds;

4), the centrifugal product of step 3) gained moved abandons supernatant liquor, add the 100ul deionized water again, blow and beat at the bottom of the centrifuge tube official repeatedly and the membranaceous precipitation of tube wall, make its dissolving ,-20 degree are preserved standby;

B, pcr amplification HBV genome:

Primer RT-F5 '-CGTGAAGCTTGACTCGTGGTGGACTTCTCTCA-3 ' SEQ NO1;

Primer RT-R5 '-ATATGGTACCGGCATTAAAGCAGGATAACCACATTG-3 ' SEQ NO2;

1), pcr amplification system 30ul:

2), PCR circulating system:

Continue by following parameter PCR cyclic amplification:

Get the pcr amplification product that makes with 3.0% agarose gel electrophoresis, observe electrophoresis result by the gel imaging instrument;

(2), single loop RCA:

Cyclisation connection and the enzyme of a, padlock probe are cut: the padlock probe 2 μ l of deionized water 12 μ l, 1 μ Mol/L, the PCR product 2 μ l that step (1) makes and 10 * E.coli Buffer2 μ l, mixing, 95 ℃ of sex change 5min, 45 ℃ hatch 40min after, add 10 * BSA damping fluid 2 μ l and 0.2 μ l E.coli dna ligase, mixing, 37 ℃ are carried out cyclisation ligation 40min; Add 10 * Exonuclease I Buffer2 μ l and Exonuclease I exonuclease 2 μ l again, mixing, 37 ℃ of reactions 1h, deactivation Exonuclease I exonucleases under 95 ℃ of conditions at last;

B, RCA amplification: get the probe cyclisation that makes among the step a and connect product 24 μ l, add 100 μ mol/L primers, 1 μ l and 10 * phi29Buffer3 μ l, 95 ℃ of 5min, ice bath 1min; Add phi29DNA polysaccharase 1 μ l, dNTP liquid 1 μ l, 37 ℃ are carried out RCA reaction 2h behind the mixing;

C, get amplified production that step b makes with 1.0% agarose gel electrophoresis, observe electrophoresis result by the gel imaging instrument;

Designed primer for the RCA reaction is in the described step (2):

Primer 5 '-ATGGGCACCGAAGAAGCA-3 ' SEQ NO3;

Probe is:

Padlock probe

5′

-CCTACGAACCACTGAACTGCTTCTTCGGTGCCCATACATCAAATGCCACGTTAACA G TCAGGCCTAGTGGGGGAAAGC-3 ', 5 of probe ' end carries out phosphorylation modification SEQ NO4.

Images