CN103257231A - Enzyme-linked immunosorbent assay vector and kit for detecting avian leukosis P27 - Google Patents
Enzyme-linked immunosorbent assay vector and kit for detecting avian leukosis P27 Download PDFInfo
- Publication number
- CN103257231A CN103257231A CN2013101611741A CN201310161174A CN103257231A CN 103257231 A CN103257231 A CN 103257231A CN 2013101611741 A CN2013101611741 A CN 2013101611741A CN 201310161174 A CN201310161174 A CN 201310161174A CN 103257231 A CN103257231 A CN 103257231A
- Authority
- CN
- China
- Prior art keywords
- avian leukosis
- kit
- monoclonal antibody
- enzyme
- elisa plate
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to the technical field of animal epidemic disease serological diagnosis, and relates to an enzyme-linked immunosorbent assay vector and a kit for detecting avian leukosis P27. The avian leukemia virus (P27) enzyme linked immunosorbent assay kit comprises a 96 hole elisa plate coating a avian leukosis P27 polyclonal antibody, P27 monoclonal antibody marked by alkaline phosphatase, a substrate solution, a stop solution and a cleaning solution. The vian leukosis P27 polyclonal antibody and the P27 monoclonal antibody marked by alkaline phosphatase effectively improve the sensitivity, the specificity and the stability of the detection. The invention provides an efficient and sensitive ELISA (enzyme linked immunosorbent assay) detection kit for sifting out and purifying avian leukosis positive chickens and cultivating new species with heredity resistance, and the kit is low in cost and simple and convenient to operate, and is applicable to promotion in animal husbandry.
Description
Technical field
The invention belongs to animal epidemic serodiagnosis technical field, relate to a kind of enzyme linked immunoassay carrier and kit for detection of avian leukosis P27.
Technical background
(Avian Leukosis is to belong to fowl retroviruse (Avian Leukosis Virus, the general designation of a kind of bird kinds of tumors disease that ALV) causes by Retroviridae first type retroviruse AL) to avian leukosis.Oneself is classified to 10 subgroups avian leukosis virus, and called after A subgroup is to the J subgroup respectively.A～D subgroup is exogenous ALV, and the E subgroup is endogenous ALV; A, B subgroup once were considered to the most general exogenous virus subgroup of (especially Leghorn) among the commercial laying hen group, and the report that C subgroup and D subgroup infect is extremely rare, and E subgroup virus has then comprised extremely general low pathogenicity endogenous leukemia virus; The F subgroup is separated from Chinese ring-necked pheasant, and the G subgroup is located away from golden yellow pheasant, also has the H subgroup of Hungary chicken and the I subgroup of Gambia quail in addition; The J subgroup is a kind of new virus that is located away from broiler chicken early 1990s; The E subgroup is ubiquitous, but mainly exists with endogenic provirus type.Owing to used the method that some eradicate ALV, the tumor incidence that is caused by leukemia virus or sarcoma virus and their correlated virus is generally all very low in the past more than 30 year, and virus shows the relative stability in the heredity.
This disease is worldwide distribution, the infection rate height, can cause chicken death, become thin, reduce chicken group's productive capacity, be one of principal disease of serious harm aviculture development.Preventing this sick main method is to cultivate the new varieties with heredity resistibility, eliminates positive chicken, purifies population, and seed selection purifies no leukaemia chicken group through several generations.Therefore set up a kind of effectively and responsive avian leukosis detection method has important role to prevention and the monitoring of avian leukosis.
Avian leukosis virus gag gene nucleotide high conservative, A, B, C, D subgroup and the J subgroup homology found recently be more than 96%, gag gene code group specific antigen (gsa).P27 albumen is a kind of important protein in the group specific antigen (gsa) of gag gene code, and its content height accounts for more than 30% of viral total protein component, is the first-selected antigen that preparation detects antibody.Application number is that 200310113280.9 Chinese invention patents disclose a kind of P27 protein detection kit, but its specificity and susceptibility.
Avian leukosis P27 gene is the gene of one section high conservative between the different subgroups of avian leukosis virus.Avian leukosis P27 albumen is the principal ingredient of ALV core capsid protein, is a kind of non-glycosylated protein of high conservative, and many viral antigen points are arranged, and is the first-selected antigen that preparation detects antibody.Yet, but there is not method can give expression to the very strong P27 albumen of avian leukosis antigentic specificity in the prior art, therefore specificity and the accuracy with the avian leukosis antigen P27 Protein Detection antibody of art methods gained is not very high.
From 1868, since the Roloff report avian leukosis, the research worker just carried out long term studies to it, and is obtaining sizable achievement aspect separation, evaluation, detection and the diagnosis of virus.Set up a lot of avian leukosis both at home and abroad and detected diagnostic method, for example virus neutralization tests, agar gel diffusion test, complement fixation test (CFT), ELISA, radio-immunity, immunofluorescence technique etc.But mostly these methods are for laboratory study, seldom can enter the clinical practice stage.Can carry out clinical detection method the earliest is agar diffusion test, but its susceptibility is relatively poor, and has certain false positive to occur, and therefore, people turn to more responsive, special, easy to operate ELISA detection method with sight.Yet, up to the present the avian leukosis antigen that can detect all subgroups simultaneously do not arranged yet and has efficient, responsive, special enzyme-linked immunologic detecting kit.
Summary of the invention
According to demand and the deficiency in above-mentioned field, the object of the present invention is to provide a kind of enzyme linked immunoassay carrier and kit for detection of avian leukosis P27.The inventor gives expression to the very strong P27 albumen of avian leukosis antigentic specificity through big quantity research, and filter out the optimum response system of kit, utilize P27 gene high conservative between the different subgroups of avian leukosis virus, the characteristic that content is high, for the positive chicken group's of avian leukosis superseded, purification, to cultivate the new varieties with heredity resistibility a kind of efficient, responsive ELISA detection kit is provided, its cost is low, easy and simple to handle, be suitable for popularization and application that animal husbandry is produced.
Technical scheme of the present invention is as follows:
A kind of enzyme linked immunoassay carrier for detection of avian leukosis P27 directly or indirectly is coated with avian leukosis P27 monoclonal antibody, it is characterized in that, described monoclonal antibody is that the hybridoma cell strain secretion of CGMCC No.7456 gets by preserving number.Described monoclonal antibody can combine by antigen specific and to be checked, guarantees the specificity that detects.
Described monoclonal antibody is by alkali phosphatase enzyme mark.Described monoclonal antibody can combine by antigen specific and to be checked, and the alkaline phosphatase of mark reads absorbance by microplate reader, thereby calculates antigenic content to be checked with the substrate generation enzymatic reaction that adds afterwards and colour developing.
A kind of enzyme linked immunological kit that detects avian leukosis P27 is characterized in that, comprises above-mentioned reaction carriers.
Also comprise the ELISA Plate of avian leukosis P27 polyclonal antibody bag quilt in the mentioned reagent box, as the antigen of the avian leukosis virus P27 expression and purification of positive control, and as the negative serum of the healthy chicken that did not infect avian leukosis of feminine gender.Specific antigen-antibody reaction takes place in avian leukosis P27 polyclonal antibody and the antigen to be checked of coated elisa plate, effectively improve the susceptibility of kit, the monoclonal antibody of mark alkaline phosphatase can combine by antigen specific and to be checked, the P27 monoclonal antibody of avian leukosis P27 polyclonal antibody of the present invention and alkali phosphatase enzyme mark has effectively improved the susceptibility, specificity and the stability that detect.
Described ELISA Plate is 96 orifice plates, and concentration of avian leukosis P27 polyclonal antibody of its bag quilt is 1.2～1.5ug/ml, described 96 orifice plate bags by the time bag that adopts to be cushioned liquid be 0.05mol/l, the pH value is 9.5 sodium bicarbonate solution.The inventor adopts the square formation test to determine to wrap by the monoclonal antibody best effort concentration of polyclonal antibody and alkali phosphatase enzyme mark: vertically use the P27 polyclonal antibody, by 10.0,5.0,2.0,1.5,1.0, the serial dilution degree bag of 0.5ug/ml is by 96 orifice plates, vertically by 1:200,1:400,1:800,1:1000,1:2000 enzyme being marked monoclonal anti dilutes, 450nm measures the OD value, is best near the corresponding bag in 1.0 hole by the dilutability of concentration and monoclonal antibody linked with peroxidase.
The P27 monoclonal antibody of alkali phosphatase enzyme mark is to adopt the crosslinked alkaline phosphatase of glutaraldehyde single stage method and P27 monoclonal antibody gained.
Described kit also comprises substrate solution, stop buffer and cleansing solution, and described substrate solution is para-nitro-pheneye phosphate, i.e. p-nitropheny-phosate, and pNPP, described cleansing solution are the PBS damping fluid that contains 0.05%Tween-20;
Described stop buffer is with sodium chloride 9.0g, and diethanolamine 105g, NaOH 80g, EDTA0.37g add deionized water to 1 liter and get.
The preparation method of above-mentioned enzyme linked immunological kit the steps include:
1) taking-up by 96 orifice plates, adds 50 μ l samples with avian leukosis P27 polyclonal antibody bag in 96 orifice bores;
2) negative control of adding 50 μ l in A1 and B1, the positive control of adding 50 μ l in C1 and D1, described A1, B1, C1 and D1 are that 96 holes bag is by application of sample position in the plate;
3) cover 96 orifice plates, under 22～27 ℃, hatched 60 minutes;
4) sucking-off or pour out content in 96 orifice bores is washed 5 times with cleansing solution, and pat on thieving paper gently in 400 μ l/ holes;
5) add 50 μ l enzymes mark avian leukosis P27 monoclonal antibody in each hole, cover reaction plate, under 22-27 ℃, hatched 30 minutes;
6) repeating step 4) wash plate;
7) add 50 μ l substrates and hold solution in each hole, cover reaction plate, under 22-27 ℃ of temperature, hatched 15 minutes;
8) add 50 μ l stop buffers in each hole, cessation reaction;
9) be longer than the absorbance that microplate reader is measured contrast and sample with the ripple of 450nm.
Described cleansing solution is the PBS damping fluid that contains 0.05%Tween-20.
The expression of avian leukosis antigen P27 albumen is characterized in that its step is as follows in order:
(1) will contain the recombinant plasmid transformed of avian leukosis virus P27 gene in e. coli bl21;
(2) be inoculated in the LB solid medium that contains ampicillin (Amp) resistance 37 ℃ of incubated overnight;
(3) get the single colony inoculation of 3-4 step (2) gained in the LB fluid nutrient medium that contains Amp, 37 ℃ of vibrations (250rpm) are cultured to OD600=0.6;
(4) add IPTG(isopropyl-β-D-sulfo-galactopyranoside again) to final concentration be 1mmol/l, continue to cultivate 3 hours, and got expressing protein for 37 ℃;
Said method gained avian leukosis P27 antigen.
Above-mentioned antigen immune rabbit gained avian leukosis P27 polyclonal antibody.
Above-mentioned antigen immune BALB/c mouse gained avian leukosis P27 monoclonal antibody.
A1, B1, C1 and D1 all are that kit of the present invention 96 holes bag is by application of sample tick lables in the plate.
Avian leukosis P27 albumen is the principal ingredient of virus core shell, is the viral antigen that is easy to detect, and is the first-selected antigen of preparation group specificity antibody and monoclonal antibody.The present invention utilizes avian leukosis P27 gene high conservative between the different subgroups of avian leukosis virus, the characteristic that content is high, eliminating, purifying for the positive chicken group of avian leukosis, the new varieties that cultivation has the heredity resistibility provide a kind of efficient, responsive ELISA detection kit, its cost is low, easy and simple to handle, be suitable for popularization and application that animal husbandry is produced.
The present invention is optimized the condition of expressing protein in the prior art, analyse in depth research, filter out best bacterial classification, optimum culturing temperature, derivant concentration, induce reagent and incubation time, simultaneously also according to cooperatively interacting between these expression conditions, complement each other, avian leukosis P27 expressing quantity, purity that the inventive method gives expression to are all higher.
Avian leukosis virus of the present invention (P27) ELISA detection kit adopts the principle of sandwich ELISA to use avian leukosis P27 polyclonal antibody bag by 96 orifice plates, forms antigen antibody complex with avian leukosis antigen to be checked.The P27 monoclonal antibody specific adsorption of alkali phosphatase enzyme mark is in antigen antibody complex, after adding the substrate colour developing, judge yin and yang attribute according to absorbance (OD value), the P27 monoclonal antibody of described avian leukosis P27 polyclonal antibody and alkali phosphatase enzyme mark can effectively improve susceptibility, specificity and the stability of detection.
Avian leukosis P27 polyclonal antibody of the present invention, its preparation process is to adopt hybridoma cell technology, the recombinant plasmid transformed that will contain avian leukosis P27 gene is expressed in Escherichia coli (BL21), adopts SDS-PAGE and Western-blot to detect its purity behind the P27 protein purification of expression.Avian leukosis P27 antigen immune rabbit behind chromatographic purifying, the subcutaneous immunity of subcutaneous multiple spot for the first time, antigen adds Freund's complete adjuvant 2ml altogether.Subcutaneous multiple spot immunity for the second time after 10 days, antigen add incomplete Freund 2ml altogether.Subcutaneous multiple spot immunity for the third time after 10 days, antigen add incomplete Freund 2ml altogether.The 4th booster immunization after 10 days.Survey antibody titer after 10 days, ELISA identifies the P27 polyclonal antibody, and serum is collected in bloodletting, and purifying avian leukosis P27 polyclonal antibody.
Described P27 MONOCLONAL ANTIBODIES SPECIFIC FOR process is that behind the P27 antigen of expression and purification and the equivalent Freund's complete adjuvant mixing, abdominal cavity and subcutaneous multi-point injection BALB/c mouse in immune three times of 2 weeks of interval, are taken a blood sample to survey and tired.Preceding the 4th booster immunization of Fusion of Cells.The splenocyte of immune mouse and SP2/0 cell merged obtain hybridoma (avian leukosis ALV-P27 hybridoma, preserving number are CGMCC No.7456), cultivate the screening monoclonal antibody specific.
The present invention adopts 0.05mol/l when using avian leukosis virus P27 polyclonal antibody bag by 96 orifice plates, and the sodium bicarbonate solution of pH9.5 is cushioned liquid as bag.Described positive control is the antigen of avian leukosis virus P27 expression and purification, and described negative control is the negative serum that did not infect the healthy chicken of avian leukosis.
Described substrate solution be para-nitro-pheneye phosphate (p-nitropheny-phosate, pNPP).PNPP generates paranitrophenol (pNP) under the effect of alkaline phosphatase, the OD value has absorption maximum at the 405nm place.
Described cleansing solution is the PBS damping fluid that contains 0.05%Tween-20.
Described stop buffer is by diethanolamine, sodium chloride EDTA and NaOH preparation.
The criterion of this kit: in order to obtain correct testing result, the mean light absorbency of negative control is below 0.15, and the difference of the mean value of positive control and the mean value of negative control is not less than 0.5.
The calculating of S/P ratio:
S/P value 〉=0.2, the expression sample contains P27 antigen and thinks the positive.
The present invention compared with prior art has the following advantages:
1. the avian leukosis P27 albumen that gives expression to of the inventive method, the conservative property height is the first-selected antigen of preparation group specificity antibody and monoclonal antibody;
2. using the polyclonal antibody bag is ELISA Plate by 96 orifice plates, and the susceptibility height can purify breeding to avian leukosis targetedly;
3. use monoclonal antibody linked with peroxidase, specificity is good, the accuracy height;
Detection time short, stability is high, cost is low, easily promotes, and is suitable for the Developing of Animal Industry demand.
Hybridoma preservation information:
Hybridoma cell strain title: avian leukosis virus P27 monoclonal antibody hybridoma cell strain ALV-P27
Strain classification: mouse hybridoma cell system
Deposit number is: CGMCC No.7456
Preservation date: on April 23rd, 2013
Depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center (being called for short CGMCC)
The preservation address is: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City
Description of drawings
Fig. 1 is that embodiment 2 expressed proteins are through the figure as a result of SDS-PAGE and Western-blot evaluation
Among the figure, 1 for inducing 3h; 2 for inducing 4h; 3 is Mark (KD): 97.2,66.4,44.3,29.0,20.1,14.3; 4 is the about 36KD of albumen behind the purifying.
Embodiment
It is in order further to understand the present invention better that following embodiment is provided; be not limited to described preferred forms; content of the present invention and protection domain are not construed as limiting; anyone makes up with the feature of other prior aries under enlightenment of the present invention or with the present invention and the identical or akin method of any and the present invention and the product that draw, all drops within protection scope of the present invention.
Biomaterial:
Bacterial classification, plasmid: e. coli bl21 is purchased in China Veterinary Drugs Supervisory Inst., and prokaryotic expression carrier pET-32a purchases in Dalian treasured bioengineering company limited.
Animal, cell: 6 the week age BALB/c mouse inbred lines available from Experimental Animal Center.
Preserve in this laboratory of SP2/0 murine myeloma cell.
Applicant's statement, above biomaterial all has preservation in the applicant laboratory, can provide to the public to be used for demonstration test in 20 years applyings date.
Reagent:
SDS-PAGE low-molecular-weight Marker, Tricine and Tris purchase the company in sigma;
Ampicillin is purchased the company in amresco;
T4DNA ligase, GoTaq enzyme, dNTP, restriction enzyme are available from TaKaRa company;
The bag filter of polyglycol 8000, the molecular weight 7000kD that dams is purchased the company in Green Bird;
0.20 μ m, 0.45 μ m air sterilization filter are purchased in Sai Duolisi, 15mL3kD ultra filtration membrane centrifuge tube is purchased the company in Millipore;
Plasmid extraction kit, glue recovery kit etc. are purchased the company in Omega;
96 hole ELISA Plate plates are purchased the living worker in Shanghai;
Complete Freund's adjuvant, incomplete Freund's adjuvant are purchased in Beijing ancient cooking vessel state company.
Alkaline phosphatase, enzyme is used in experiment, alkaline phosphatase 5ku, the approach that is purchased obtains, purchases in sigma,
The agency of China is Shanghai Ru Ji biotechnology Development Co., Ltd;
The LB solid medium is pressed following preparation: with tryptone 10g, yeast extract 5g, NaCl10g are dissolved in the 950ml distilled water, transfer pH to 7.0 to be settled to 1L with NaOH and form;
The preparation of LB fluid nutrient medium: with yeast extract 5g, peptone 10g NaCl10g joins in the container; Adding distil water is regulated pH7.0～7.2 to 1000ml with NaOH and HCl again, the packing sterilization.
Instrument
Table 1 instrument source, model
The preparation of the recombinant plasmid of embodiment 1. avian leukosis virus P27 genes
(this sequence is 1381agactggctg atacggtcaggaccaagggc ttacgatccc cgatcactat ggcggaggtg to the RSV P27 gene nucleotide series of including according to GenBank
1441?gaagcgctta?tgtcctcccc?gctgctgccg?catgacgtta?cgaatctaat?gagagttatt
1501?ttaggacctg?ccccatatgc?cttgtggatg?gacgcttggg?gtgtccaact?acagacggtt
1561?atagcggcag?ccactcgcga?cccccgacac?ccagcgaatg?gtcaagggcg?gggggaacgg
1621?actaatttgg?atcgcttaaa?gggtttagct?gatgggatgg?tgggcaaccc?gcagggtcag
1681?gccgcattat?taagaccggg?ggaattggtt?gctattacgg?cgtcggctct?ccaggcattt
1741?agagaggttg?cccggctggc?ggaacctgct?ggtccatggg?cggacattac?gcagggacca
1801?tctgagtcct?ttgttgattt?tgccaatcgg?cttataaagg?cggttgaggg?gtcagatctc
1861?ccgccttccg?cgcgagctcc?ggtgatcatt?gactgcttta?ggcagaagtc?acagccagat
1921?atccagcagc?ttatacgggc?agcaccctcc?acgctgacca?ccccaggaga?gataatcaaa
1981 tatgtgctag acaggcagaa gactgcccct cttacggatc aaggcatagc cgcggcc), application software designs a pair of primer amplification P27 gene.Upstream primer is introduced EcoR I restriction endonuclease sites and initiation codon ATG, and downstream primer is introduced Sal I restriction endonuclease sites and terminator codon CTA.Pcr amplification P27 gene reclaims product and is connected the recombinant plasmid that makes up avian leukosis virus P27 gene with the pET-32a carrier.
Applicant's statement simultaneously, the recombinant plasmid of avian leukosis virus P27 gene has preservation in the applicant laboratory, can provide to the public to be used for demonstration test in 20 years applyings date.
The expression of embodiment 2. avian leukosis virus P27 albumen
The abduction delivering of avian leukosis P27 gene in Escherichia coli: with recombinant plasmid transformed in the e. coli bl21 bacterium, be inoculated in the LB solid medium that contains ampicillin (Amp) resistance, after 37 ℃ of incubated overnight, get 3～4 single colony inoculations in the LB fluid nutrient medium that contains Amp, 37 ℃ of vibrations (250rpm) are cultured to OD
600=0.6, add IPTG(isopropyl-β-D-sulfo-galactopyranoside) to final concentration be 1mmol/l, 37 ℃ are continued to cultivate 3 hours, get expressing protein, its avian leukosis P27 expressing quantity is 565mg/L.Cultivate simultaneously and do not induce negative control.Expressed proteins identifies that through SDS-PAGE and Western-blot the result as shown in Figure 1.
The purifying of embodiment 3. avian leukosis virus P27 albumen
The bacterial classification that embodiment 1 screens adds GuNTA-0Buffer and PMSF ultrasonication cell at low temperatures, and 4 ℃, centrifugal 15 minutes of 12000r/min gets supernatant ,-20 ℃ of preservations.With Ni-NTA purifying resin the cracking thalline is carried out affinity chromatography, sample is added in the chromatographic column, and flow velocity 15ml/h collects penetrating component.Chromatography is with the GuNTA-60Buffer wash-out of 5 times of NTA volumes, and flow velocity 15ml/h collects eluent.With 0.5mol/L NaCl and 20mmol/L Tris-HCl solution dialysis in 24 hours eluent, the avian leukosis P27 albumen behind the purifying carries out SDS-PAGE and Western-blot testing goal purity of protein up to 97%, and the molecular weight size is 36KD.
Adopt hybridoma cell technology, with the avian leukosis P27 antigen immune rabbit behind the purifying, the subcutaneous immunity of subcutaneous multiple spot for the first time, antigen adds Freund's complete adjuvant 2ml altogether.Subcutaneous multiple spot immunity for the second time after 10 days, antigen add incomplete Freund 2ml altogether.Subcutaneous multiple spot immunity for the third time after 10 days, antigen add incomplete Freund 2ml altogether.The 4th booster immunization after 10 days.Survey antibody titer after 10 days, ELISA identifies the P27 polyclonal antibody, and serum is collected in bloodletting, and chromatographic purifying avian leukosis P27 polyclonal antibody.
The preparation of embodiment 5. avian leukosis P27 polyclonal antibodies 96 hole ELISA Plate
Determine that with the square formation test best bag is by concentration, vertically use the P27 polyclonal antibody, by 10.0,5.0,2.0,1.5,1.0, the serial dilution degree bag of 0.5ug/ml is by 96 hole ELISA Plate, laterally by 1:200,1:400,1:800,1:1000,1:2000 monoclonal antibody linked with peroxidase is diluted, 450nm measures the OD value, is 1:1000 the best near the corresponding bag in 1.0 hole by concentration 1.2～1.5ug/ml and dilutability.
| The OD value | 1:200 | 1:400 | 1:800 | 1:1000 | 1:2000 |
| 10.0 | 3.287 | 2.734 | 2.186 | 1.864 | 1.455 |
| 5.0 | 2.490 | 2.147 | 1.762 | 1.437 | 1.205 |
| 2.0 | 1.851 | 1.618 | 1.406 | 1.298 | 1.178 |
| 1.5 | 1.762 | 1.399 | 1.184 | 1.024 | 0.896 |
| 1.0 | 1.693 | 1.285 | 1.137 | 0.947 | 0.789 |
| 0.5 | 1.368 | 1.113 | 0.890 | 0.821 | 0.745 |
96 hole ELISA Plate are placed humidistat, interior with thieving paper in the humidistat.Humidistat is built airtight.After+4 ° of C are hatched 12 hours, clean 4 times with washing plate liquid, draw the 0.25ml confining liquid in every hole.96 hole ELISA Plate are built with lid, discard confining liquid in incubated at room after minimum 2 hours, place on the thieving paper on the shelf dryly, and minimum placement at room temperature made it fully dry in 16 hours.
Embodiment 6. avian leukosis P27 MONOCLONAL ANTIBODIES SPECIFIC FOR
The P27 MONOCLONAL ANTIBODIES SPECIFIC FOR: BALB/c mouse hypodermic injection P27 antigen, with the emulsification of equivalent Freund's complete adjuvant, every of 0.2ml/l only contains antigen dose 100ug/.Two week back immunity for the second time are with the emulsification of equivalent incomplete Freund, 0.2ml/l hypodermic injection.Immunity for the third time is with for the second time after two weeks.Booster immunization is with for the third time after two weeks.Merged preceding 3 days, the eyeball blood sampling detects antibody horizontal with ELISA after the separated plasma.Splenocyte and the SP2/0 cell of immune mouse are merged, and the centrifugal 5min of cell 1000r/min with after merging abandons supernatant, with 37 spend the water-bath preheatings to contain the HAT nutrient solution resuspended.Adding has in 96 well culture plates of feeder cells, and 37 degree are put in the 100ul/ hole, 5% carbon dioxide, and saturated humidity is cultivated.Cultivate fused cell, when treating that cell clone grows to the 1/3-1/2 in hole, get the supernatant cell in HI method detection specificity antibody positive hole, clone three times with limiting dilution assay, make positive rate reach 100%, in time freeze-stored cell enlarges then and cultivates preparation ascites, and the ELISA antigen coated by P27 detects, screening one strain is at avian leukosis poison P27 monoclonal antibody specific and secrete the hybridoma of this monoclonal antibody.
The enzyme markization of embodiment 7. avian leukosis P27 monoclonal antibodies
1ml P27 monoclonal antibody (3mg/ml) is added 5mg alkaline phosphatase (alkaline phosphatase, AP) dissolving; The bag filter 0.01mol/l that packs into, dialysis is 18 hours under the pH7.2PBS4 degree; Add 2.5% glutaraldehyde 20uL, room temperature (20 degree) is placed 2h.4 degree 0.01mol/L, pH7.2PBS dialysed overnight; Move in 0.05mol/L, the pH8.0Tris-HCl damping fluid 4 ℃ of dialysed overnight; Take out labelled antibody, be diluted to 4mL with the Tris-HCl damping fluid that contains %BSA and 0.02%NaN3, be enzyme labeling monoclonal antibody stoste.
The composition of embodiment 8. kits
The composition of table 2 kit
| Reagent | Packing specification |
| 5 bags are by plate | 14cm |
| 1 bottle of (1.5ml) negative control | 5.0ml the clean vial of |
| 1 bottle of (1.5ml) positive control | 5.0ml the clean vial of |
| 1 bottle of (30ml) enzyme mark monoclonal antibody | The opaque sample bottle of |
| 1 bottle of (55ml) substrate solution | The opaque sample bottle of |
| 1 bottle of (55ml) stop buffer | The brown sample bottle of |
| 2 bags of (12.8g) washing lotions | 9cm 2Masking foil |
In the kit there be used reagent:
Bag is by 96 orifice plates of the prepared avian leukosis P27 polyclonal antibody bag quilt of plate: embodiment 5;
The antigen of the avian leukosis virus P27 expression and purification of positive control: embodiment 2 and 3 gained;
Negative control: the negative serum that did not infect the healthy chicken of avian leukosis;
Substrate solution: para-nitro-pheneye phosphate (p-nitropheny-phosate, pNPP);
Cleansing solution: the PBS damping fluid that contains 0.05%Tween-20;
Stop buffer: with sodium chloride 9.0g, diethanolamine 105g, NaOH 80g, EDTA0.37g add deionized water to 1 liter and get.
Monoclonal antibody linked with peroxidase: the product of the monoclonal antibody-embodiment 7 of alkali phosphatase enzyme mark
The preparation of embodiment 9. avian leukosis virus P27ELISA detection kit (used kit equipment is with embodiment 8)
From sealing bag, take out 96 hole ELISA Plate with P27 polyclonal antibody bag quilt; Add 50 μ l samples in corresponding ELISA Plate hole; The negative control that in A12 and B12, adds 50 μ l, the positive control of adding 50 μ l in C12 and D12; With cap covers 96 hole ELISA Plate, under room temperature (22-27 ℃), hatched 60 minutes; Content in sucking-off (pouring out) hole is washed (every hole 400 μ l) 5 times with washing lotion.On thieving paper, pat gently for the last time; Add 50 μ l enzymes mark P27 monoclonal antibody in each hole, use the cap covers reaction plate, under room temperature (22-27 ℃), hatched 30 minutes; Repeat to wash plate.Add 50 μ l substrate reagents in each hole, use the cap covers reaction plate, under room temperature (22-27 ℃), hatched 15 minutes.Add 50 μ l stop buffers in each hole, cessation reaction.With the air zeroing, be longer than the absorbance that microplate reader is measured contrast and sample with the ripple of 450nm.
Embodiment 10. specific detection
Materials and methods
1) avian leukosis virus (P27) detection kit
2) sample
15 parts of poultry diease specific criteria antigen samples that provided by Dutch GD company.Poultry infectious bursal disease (IBD), avian infectious bronchitis (IBV, the Beaudette strain), ewcastle disease (NDV), avian encephalomyelitis (AE), the fowl anaemia factor (CAV), infectious laryngotracheitis (ILT), synovia mycoplasma (MS), bird flu (AI, 0126 strain), reovirus (REO), avian infectious bronchitis (IBV, Mass strain), aviadenovirus (Phelp strain), aquatic bird/bird pox virus (FPV), fowl subtracts egg virus (EDS-76), Frustrate blood and mycoplasma (MG), paramyxovirus (APMV).
3) method of operating
Method of operating is with the method for operating of the specific detection of enzyme linked immunological kit of the prior art.
Table 3 specific detection data such as table 3:
Conclusion: avian leukosis virus of the present invention (P27) detection kit detects 15 parts of poultry diease specific criteria antigen samples, and the testing result of all samples is all feminine gender, shows the present invention and other poultry diease cause of disease no cross reactions, has good specificity.
Embodiment 11. sensitivity Detection
Materials and methods
1 material
1) kit: avian leukosis virus (P27) detection kit
2) sample: the positive chicken sample (pathology organs and tissues such as cloaca swab, liver kidney) of the avian leukosis of 60 42 ages in days is derived from the infected area chicken house.
2 methods
1) virus is separated: carry out according to a conventional method;
2) avian leukosis virus (P27) detection kit: with the operation of conventional enzyme-linked immunologic detecting kit;
3) histopathologic diagnosis: organizational routine is fixed, paraffin embedding, section, and HE dyeing is observed under the optical microscope and judged;
4) PCR detects: be used for somatotype and identify.Primer is according to avian leukosis virus (A, B, J hypotype), and 5 ' end of different subtype and the genetic fragment design of 3 ' end are synthetic.Be used for distinguishing the different subtype (A, B, J hypotype) of identifying avian leukosis virus.Operation according to a conventional method.
5) histopathologic diagnosis: H represents hemangioma, and ML represents myeloblastosis, and EL represents erythroblastosis.
Table 4 sensitivity Detection data
Conclusion: at first, avian leukosis virus of the present invention (P27) detection kit can detect avian leukosis cause of disease and A thereof, the cause of disease of J hypotype.Secondly, with viral separation test contrast, its susceptibility, specific coincidence rate are all more than 98%.
Embodiment 12. Detection of Stability
Avian leukosis virus of the present invention (P27) detection kit places 2～8 ℃ to preserve 0,, 3,6,9,12 months, during grab sample, the proterties of observing reagent in the kit is monitored susceptibility and the specificity of this kit, the stability of assessment kit simultaneously.
Materials and methods
1) avian leukosis virus (P27) detection kit is placed 2～8 ℃ preserve 0,3,6,9,12 and 15
Individual month, during grab sample, the proterties of observing reagent in the kit.
2) quality-control product of being preserved by this laboratory (PC-NC, P-1, P-2, P-3, IBD, IBV, NDV, REO, AE, SPF-1, SPF-2 SPF-3) monitors susceptibility and the specificity of this kit, the stability of assessment kit.
3) method: with the operation of conventional enzyme-linked immunologic detecting kit;
Table 5 Detection of Stability data
Conclusion: the result shows this kit 2～8 ℃ of preservations 12 months, and the proterties of all reagent and standard proterties have good homogeneity in the kit.Susceptibility, specificity result meet batch the examining report when providing, and experiment meets establishment condition.Shown that this kit still had very stable performance in 12 months 2～8 ℃ of preservations.
Embodiment 13. repeatability detect:
The different sample of three avian leukosis virus (J hypotype) antigen levels of concentration known (low, in, height).In the method, the kit of each lot number is divided into 4 experiments, all needs at least two laboratory technicians, continuous 7 batches kit at every turn.
Continuous 7 batches kit experimental result,
Rudimentary contrast CV number percent is 7.41%.
Middle rank contrast CV number percent is 7.37%.
Senior contrast CV number percent is 9.11%.
Same batch the kit certain hour of being separated by detects with same quality-control sample, and the CV number percent of sample is 5.43%.
Conclusion: avian leukosis virus of the present invention (P27) detection kit, batch between, batch in repeat stablize, CV number percent is all less than 10%.
Embodiment 14. artificial merit poison tests:
Materials and methods
1) animal used as test: be derived from 10 age in days chickens of Taiwan chicken house, be divided into three groups, first group of 15 chicken adopted collunarium eye droppings infectable infection ALV-J subtype virus (HPR-103 strain.Second group of 15 chicken adopts hypodermic injection to infect ALV-J subtype virus (HPR-103 strain).The 3rd group of 15 chickens do not infect negative control group.
2) avian leukosis virus (P27) detection kit
3) method of operating
Adopt avian leukosis virus (P27) detection kit to detect above three group the 2nd, 3,4 all samples, method of operating is with the operation of conventional enzyme-linked immunologic detecting kit;
Group 1: behind the injection ALV-J subtype virus (HPR-103 strain), the 2nd, 3,4 week samplings (cloaca swab); Group 2: behind the oral ALV-J subtype virus (HPR-103 strain), the 2nd, 3,4 week samplings (cloaca swab); Group 3: negative control group, the 2nd, 3,4 week samplings (cloaca swab)
The artificial merit poison of table 6 test figure
Conclusion: avian leukosis virus (P27) detection kit has good sensitivity, because this kit is behind the merit poison, the 2nd week began to detect ALV antigen.Along with the breeding of virus in the chicken body, in the 3rd, 4 weeks behind the merit poison, the positive rate of avian leukosis virus also increases thereupon.
Embodiment 15. the present invention and application number are the contrast test of 200310113280.9 Chinese invention patent kits
Request for utilization number is that the kit that the method for 200310113280.9 Chinese invention patents obtains is compared with kit of the present invention, and kit susceptibility of the present invention, specificity are higher, and Details as Follows:
Table 7 the present invention and application number are the difference contrast of 200310113280.9 Chinese invention patents
The present invention and application number are that 200310113280.9 Chinese invention patents are compared difference to such as table 7.
Table 8 susceptibility correlation data
The avian leukosis virus of adopting cell to cultivate carries out ELISA kit susceptibility comparison test, and the result shows that when being diluted to 100 times, result of the present invention is positive, and that application number is the result of 200310113280.9 patents is negative.Illustrate that susceptibility of the present invention is better.
Table 9 specificity correlation data
Adopt other poultry diease viruses to carry out ELISA kit specificity comparison test, it is all negative that the result shows that the present invention detects other poultry diease viruses, and specificity is fine.But being the kit of 200310113280.9 Chinese invention patents, application number have 2 kinds of disease detection results positive.
Claims (8)
1. the enzyme linked immunoassay carrier for detection of avian leukosis P27 directly or indirectly is coated with avian leukosis P27 monoclonal antibody, it is characterized in that, described monoclonal antibody is that the hybridoma cell strain secretion of CGMCC No.7456 gets by preserving number.
2. reaction carriers according to claim 1 is characterized in that, described monoclonal antibody is by alkali phosphatase enzyme mark.
3. an enzyme linked immunological kit that detects avian leukosis P27 is characterized in that, includes the described reaction carriers of claim 2.
4. according to the described kit of claim 3, it is characterized in that, also comprise the ELISA Plate of avian leukosis P27 polyclonal antibody bag quilt in the kit, as the antigen of the avian leukosis virus P27 expression and purification of positive control, and as the negative serum of the healthy chicken that did not infect avian leukosis of feminine gender.
5. enzyme linked immunological kit according to claim 4, it is characterized in that, the concentration of the avian leukosis P27 polyclonal antibody of described ELISA Plate bag quilt is 1.2～1.5ug/ml, described ELISA Plate bag by the time bag that adopts to be cushioned liquid be 0.05mol/l, the pH value is 9.5 sodium bicarbonate solution.
6. enzyme linked immunological kit according to claim 5 is characterized in that, described alkali phosphatase enzyme mark P27 monoclonal antibody is to adopt the crosslinked alkaline phosphatase of glutaraldehyde single stage method and P27 monoclonal antibody.
7. enzyme linked immunological kit according to claim 6, it is characterized in that, described kit also comprises substrate solution, stop buffer and cleansing solution, described substrate solution is para-nitro-pheneye phosphate, be p-nitropheny-phosate, pNPP, described cleansing solution are the PBS damping fluid that contains 0.05%Tween-20;
Described stop buffer is with sodium chloride 9.0g, and diethanolamine 105g, NaOH 80g, EDTA0.37g add deionized water to 1 liter and get.
8. the preparation method of the arbitrary described enzyme linked immunological kit of claim 3～7 the steps include:
1) takes out the ELISA Plate of using avian leukosis P27 polyclonal antibody bag quilt, add 50 μ l samples in the ELISA Plate hole;
2) negative control of adding 50 μ l in A1 and B1, the positive control of adding 50 μ l in C1 and D1, described A1, B1, C1 and D1 are that 96 holes bag is by application of sample position in the plate;
3) cover ELISA Plate, under 22～27 ℃, hatched 60 minutes;
4) sucking-off or pour out content in the ELISA Plate hole is washed 5 times with cleansing solution, and pat on thieving paper gently in 400 μ l/ holes;
5) add 50 μ l enzymes mark avian leukosis P27 monoclonal antibody in each hole, cover reaction plate, under 22～27 ℃, hatched 30 minutes;
6) repeating step 4);
7) add 50 μ l substrates and hold solution in each hole, cover reaction plate, under 22～27 ℃ of temperature, hatched 15 minutes;
8) add 50 μ l stop buffers in each hole, cessation reaction;
9) be longer than the absorbance that microplate reader is measured contrast and sample with the ripple of 450nm;
Described cleansing solution is the PBS damping fluid that contains 0.05%Tween-20.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310161174.1A CN103257231B (en) | 2013-05-03 | 2013-05-03 | A kind of enzyme linked immunoassay carrier for detecting avian leukosis P27 and test kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310161174.1A CN103257231B (en) | 2013-05-03 | 2013-05-03 | A kind of enzyme linked immunoassay carrier for detecting avian leukosis P27 and test kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103257231A true CN103257231A (en) | 2013-08-21 |
| CN103257231B CN103257231B (en) | 2016-08-03 |
Family
ID=48961265
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310161174.1A Active CN103257231B (en) | 2013-05-03 | 2013-05-03 | A kind of enzyme linked immunoassay carrier for detecting avian leukosis P27 and test kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103257231B (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106290861A (en) * | 2016-08-04 | 2017-01-04 | 广东温氏食品集团股份有限公司 | A kind of detection method of exogenous avian leukosis virus |
| CN107271685A (en) * | 2017-06-30 | 2017-10-20 | 中国农业大学 | A kind of method and its dedicated kit for detecting the content of fowl leukocyte interleukin 2 |
| CN107286241A (en) * | 2017-07-10 | 2017-10-24 | 中国农业大学 | A kind of method and its dedicated kit for detecting fowl interferon content |
| CN109521199A (en) * | 2018-11-29 | 2019-03-26 | 中国动物疫病预防控制中心(农业农村部屠宰技术中心) | A kind of gold-immunochromatographyreagent reagent for assay box and its application for detecting avian leukosis virus |
| CN110261607A (en) * | 2019-05-28 | 2019-09-20 | 北京市动物疫病预防控制中心 | For detecting the fluorescence polarization immunoassay kit and method of avian leukosis poison |
| CN110438261A (en) * | 2019-07-29 | 2019-11-12 | 华南农业大学 | For detecting molecular labeling, primer, kit and the application of F subgroup avian leucosis virus |
| CN113325175A (en) * | 2021-06-02 | 2021-08-31 | 贵州大学 | Double-antibody sandwich indirect ELISA method for detecting avian leukosis group specific antigen |
| CN113325176A (en) * | 2021-06-02 | 2021-08-31 | 贵州大学 | Double-antibody sandwich direct ELISA (enzyme-Linked immuno sorbent assay) method for detecting avian leukosis P27 |
| CN113341140A (en) * | 2021-06-02 | 2021-09-03 | 贵州大学 | Indirect ELISA (enzyme-linked immunosorbent assay) method for detecting avian leukosis P27 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1616478A (en) * | 2003-11-13 | 2005-05-18 | 中国农业大学 | Expression of P27 protein and its use |
| CN102636644A (en) * | 2012-04-18 | 2012-08-15 | 中国农业科学院哈尔滨兽医研究所 | Double-antibody sandwich ELISA (enzyme linked immunosorbent assay) kit used for detecting avian leukosis group specific antigen |
| CN103243077A (en) * | 2013-05-03 | 2013-08-14 | 中国农业科学院兰州畜牧与兽药研究所 | Avian leukosis P27 monoclonal antibody hybridoma cell strain and application thereof |
-
2013
- 2013-05-03 CN CN201310161174.1A patent/CN103257231B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1616478A (en) * | 2003-11-13 | 2005-05-18 | 中国农业大学 | Expression of P27 protein and its use |
| CN102636644A (en) * | 2012-04-18 | 2012-08-15 | 中国农业科学院哈尔滨兽医研究所 | Double-antibody sandwich ELISA (enzyme linked immunosorbent assay) kit used for detecting avian leukosis group specific antigen |
| CN103243077A (en) * | 2013-05-03 | 2013-08-14 | 中国农业科学院兰州畜牧与兽药研究所 | Avian leukosis P27 monoclonal antibody hybridoma cell strain and application thereof |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106290861A (en) * | 2016-08-04 | 2017-01-04 | 广东温氏食品集团股份有限公司 | A kind of detection method of exogenous avian leukosis virus |
| CN107271685A (en) * | 2017-06-30 | 2017-10-20 | 中国农业大学 | A kind of method and its dedicated kit for detecting the content of fowl leukocyte interleukin 2 |
| CN107286241A (en) * | 2017-07-10 | 2017-10-24 | 中国农业大学 | A kind of method and its dedicated kit for detecting fowl interferon content |
| CN109521199A (en) * | 2018-11-29 | 2019-03-26 | 中国动物疫病预防控制中心(农业农村部屠宰技术中心) | A kind of gold-immunochromatographyreagent reagent for assay box and its application for detecting avian leukosis virus |
| CN110261607A (en) * | 2019-05-28 | 2019-09-20 | 北京市动物疫病预防控制中心 | For detecting the fluorescence polarization immunoassay kit and method of avian leukosis poison |
| CN110438261A (en) * | 2019-07-29 | 2019-11-12 | 华南农业大学 | For detecting molecular labeling, primer, kit and the application of F subgroup avian leucosis virus |
| CN110438261B (en) * | 2019-07-29 | 2022-08-12 | 华南农业大学 | Molecular marker, primer, kit and application for detecting F subgroup avian leukosis virus |
| CN113325175A (en) * | 2021-06-02 | 2021-08-31 | 贵州大学 | Double-antibody sandwich indirect ELISA method for detecting avian leukosis group specific antigen |
| CN113325176A (en) * | 2021-06-02 | 2021-08-31 | 贵州大学 | Double-antibody sandwich direct ELISA (enzyme-Linked immuno sorbent assay) method for detecting avian leukosis P27 |
| CN113341140A (en) * | 2021-06-02 | 2021-09-03 | 贵州大学 | Indirect ELISA (enzyme-linked immunosorbent assay) method for detecting avian leukosis P27 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103257231B (en) | 2016-08-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103257231A (en) | Enzyme-linked immunosorbent assay vector and kit for detecting avian leukosis P27 | |
| CN102636644B (en) | Double-antibody sandwich ELISA (enzyme linked immunosorbent assay) kit used for detecting avian leukosis group specific antigen | |
| Houpikian et al. | Western immunoblotting for Bartonella endocarditis | |
| Ignjatovic et al. | Monoclonal antibodies to three structural proteins of avian infectious bronchitis virus: characterization of epitopes and antigenic differentiation of Australian strains | |
| CN101900731B (en) | ELISA kit for distinctively detecting antibodies of classical swine fever (CSF) vaccine immunity and wild virus infection and preparation method thereof | |
| CN109254155A (en) | A kind of detection African swine fever virus antigen colloidal gold immune chromatography test paper and preparation method and application | |
| CN103123353A (en) | Immunodetection assay for mycobacterium tuberculosis complex | |
| CN103243077A (en) | Avian leukosis P27 monoclonal antibody hybridoma cell strain and application thereof | |
| CN106771260A (en) | Detect the indirect ELISA reagent kit and its detection method of the type aviadenovirus antibody of serum 4 | |
| CN110218668A (en) | A kind of inert carrier salmonella and its potential application | |
| CN110257276A (en) | A kind of inert carrier Escherichia coli and its potential application | |
| Srinivasappa et al. | Isolation of a monoclonal antibody with specificity for commonly employed vaccine strains of Newcastle disease virus | |
| Birg et al. | Isolation of Rickettsia prowazekii from blood by shell vial cell culture | |
| CN103773736B (en) | Secrete the foundation that anti-duck source NDV separates the hybridoma cell strain of strain monoclonal antibody | |
| Chiba et al. | Virus excretion and antibody response in saliva in natural mumps | |
| Croppo et al. | Identification of the microsporidian Encephalitozoon hellem using immunoglobulin G monoclonal antibodies | |
| CN103197078A (en) | Application of salmonella pullorum secreted protein SpiC | |
| Liang et al. | Differentiation of Bartonella species by a microimmunofluorescence assay, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and Western immunoblotting | |
| Davis et al. | Poliomyelitis and aseptic meningitis: A two-year field and laboratory study in Connecticut | |
| McCrae | Nucleic Acid‐Based Analyses of Non‐Group A Rotaviruses | |
| CN100455662C (en) | Avianinflu virus H5 subtype emulsion agglutination kit and its use | |
| Urquhart et al. | Immunofluorescence for routine diagnosis of respiratory syncytial virus infection | |
| CN112946285B (en) | ELISA kit for detecting highly pathogenic PRRSV infection | |
| CN114921418B (en) | Hybridoma cell strain 1D3 of O-type foot-and-mouth disease virus particle monoclonal antibody, kit and detection method | |
| LU500582B1 (en) | Muscovy Duck Parvovirus POCT Test Strip, Preparation Method Therefor and Application Thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |