CN103235140B - Enzyme-linked immune sorbent assay (ELISA) kit for detecting Shiga toxin II (StxII) - Google Patents
Enzyme-linked immune sorbent assay (ELISA) kit for detecting Shiga toxin II (StxII) Download PDFInfo
- Publication number
- CN103235140B CN103235140B CN201310137001.6A CN201310137001A CN103235140B CN 103235140 B CN103235140 B CN 103235140B CN 201310137001 A CN201310137001 A CN 201310137001A CN 103235140 B CN103235140 B CN 103235140B
- Authority
- CN
- China
- Prior art keywords
- stxii
- seq
- monoclonal antibody
- sequence
- sequence table
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses an enzyme-linked immune sorbent assay (ELISA) kit for detecting Shiga toxin II (StxII) and also discloses sequence information of monoclonal antibodies S2D8 and S2C6 in the ELISA kit and a preparation process of the monoclonal antibodies S2D8 and S2C6. The ELISA kit comprises the monoclonal antibody S2D8, the HRP-marked monoclonal antibody S2C6, a horse radish peroxidase substrate buffer solution, a protein standard product StxII (100 ug/ml, 0.1 ml), a negative control sample BSA and lotion (PBS+0.05%Tween20). The kit can sensitively detect the StxII content of samples, and the sensitivity can reach 4 ng/ml. The kit provided by the invention also can effectively identify subtype StxIIc and StxIIvha of the StxII.
Description
Technical field
The present invention relates to a kind of ELISA kit, in particular to the ELISA kit detecting II type shiga toxin (StxII), also relate to the preparation of monoclonal antibody S2D8 and S2C6 and the using method of test kit in this ELISA kit.
Background technology
Enterohemorrhagic Escherichia coli (Enterohemorrhagic E.coli, EHEC) infecting is a kind of important zoonosis, prosperity is comprised and developing country has popular all over the world, its infection has the feature such as fulminant, strong pathogenic and lethality, become global public health problem, grave danger has been formed to human health.EHEC infects and people can be made to suffer from diarrhoea (Diarrhea), hemorrhagic colitis (Hemorrhagic Colitis, HC), also can cause hemolytic uremic syndrome (Hemolytic Uremic Syndrome, HUS), thrombotic thrombocytopenic purpura (Thromboric Thromobocytopenic Porpura, the severe complication such as TTP), particularly HUS can cause the function damage of irrecoverability to kidneys of patients, and case fatality rate is higher.
The sick Accompanied by Acute Renal Failure of EHEC O157:H7 infectious diarrhea has repeatedly been broken out in 1999-2000 in China Jiangsu, Anhui and Henan San Sheng junction section area, successively having 230 routine patient evolution becomes HUS, dead 205 people, recuperator also result in the sequela such as kidney, neurological impairments.China western part, Central Plains, northeast, North China are also repeatedly dispersed in and EHEC epidemic situation occurred in addition, and often have popular report every year.The U.S. also there occurs and causes EHEC O157:H7 to infect event due to the spinach of edible pollution in summer in 2006, successively involves 26 states, and have 183 people's morbidities, 29 people cause HUS, and 3 people are dead, cause world's extensive concern.Infect EHEC at present and lack effective treatment and preventive measures clinically, clinical study shows: microbiotic can impel EHEC to discharge lethality shiga toxin, thus the danger of the concurrent HUS of patient is increased.
Research shows, the principal causative mechanism that EHEC infects can be divided into two aspects, one is the floating mechanism of adhesion (the Attaching and Effacing that the multiple virulence factor of being encoded by phage gene group pathogenicity island LEE (Locus of Enterocyte Effacement) mediates, A/E), by A/E mechanism, bacterium can destroy intestinal epithelial cells, adheres to and is colonizated in enteron aisle; Two is secretion shiga toxin (Shiga toxin, Stx), Stx can pass through damaged intestinal epithelial cells and enter blood circulation, be combined with its acceptor-triose acyl sphingosine Gb3 or tetrose acyl sphingosine Gb4, cause the damage of the organ such as enteron aisle, central nervous system, the kidney that particularly Gb3 content receptor is higher, impaired rear easy initiation HUS, threat to life; This toxin is divided into StxI and StxII two hypotypes, and the clinical HUS of causing is mostly StxII.Clinical EHEC is caused early stage diarrhoea and the diarrhoea caused by other pathogenic agent be not easily distinguishable in symptom, antibiotic arbitrary decision uses kills a large amount of thalline on the one hand, patient's symptom of diarrhea alleviates, cause the illusion of apparent " rehabilitation ", this just makes to carry out diagnosis by isolated pathogen and comes to an end mainly with result feminine gender greatly, affect the best moment for the treatment of adversely, on the other hand, because Stx is by being incorporated into lambda particles phage genes encoding in EHEC genome, antibiotic use easily makes remaining bacterium enter SOS stress situation, phage enters cracking state from static lysogeny, a large amount of Stx toxin is produced in enteron aisle, and enter blood circulation, make patient that HUS occur.Therefore, if detect toxin in the serum of patient or the bloody stool of diarrhoea, then immunologic intervention measure can be taked in time.So the diagnosis infected for EHEC, be the separation to pathogenic agent, not equal to the detecting of contratoxin.
Different from developed country, China's epidemic situation mainly concentrates on the poor Rural areas of health care condition, and patient is peasant mainly, idea of seeking medical advice weakness, and mostly have mass-sending property feature, when waiting health organ to get involved, epidemic situation is more serious; At present, comparatively general with the live close domestic animal of environmental concerns, poultry Carriage of people, and the virulence gene of flora changes obviously, save as that main progressively to develop into StxII be main from StxI, StxII, prompting EHEC epidemic situation can not disappear in a short time.And there is the phenomenon of abuse of antibiotics in various degree in village layer medical health organ of China, also in the urgent need to a kind of take lps molecule as quick, the easy-operating diagnostic method of target, what rely on pathogen isolation to carry out making a definite diagnosis as tradition supplements.
Summary of the invention
For solving the problem, the present invention has prepared the monoclonal antibody of many strains for StxII, and therefrom filters out noncompetitive two strain monoclonal antibodies, is respectively S2D8 and S2C6, prepares DAS-ELISA test kit, for the toxin diagnosis that EHEC infects.The invention also discloses the using method of above-mentioned ELISA kit, described test kit accurately can detect the content of StxII in sample.
The invention discloses the monoclonal antibody S2D8 of above-mentioned anti-StxII, described monoclonal antibody comprises light chain and heavy chain, its amino acid variable region sequences is respectively as shown in SEQ ID NO:1, SEQ ID NO:2 in sequence table, and its encoding gene is respectively as shown in SEQ ID NO:3, SEQ ID NO:4 in sequence table.
The aminoacid sequence of complementary determining region CDR1, CDR2, CDR3 of the light chain protein matter molecule variable region of monoclonal antibody S2D8 of the present invention, respectively as shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 in sequence table.The aminoacid sequence of complementary determining region CDR1, CDR2, CDR3 of the heavy chain protein matter molecule variable region of described monoclonal antibody S2D8 is respectively as shown in SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10 in sequence table.
The invention discloses the monoclonal antibody S2C6 of above-mentioned anti-StxII, described monoclonal antibody S2C6 comprises light chain and heavy chain, its amino acid variable region sequences is respectively as shown in SEQ ID NO:11, SEQ ID NO:12 in sequence table, and its encoding gene is respectively as shown in SEQ ID NO:13, SEQ ID NO:14 in sequence table.
The aminoacid sequence of complementary determining region CDR1, CDR2, CDR3 of the light chain protein matter molecule variable region of monoclonal antibody S2C6 of the present invention, respectively as shown in SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 in sequence table.The aminoacid sequence of complementary determining region CDR1, CDR2, CDR3 of the heavy chain protein matter molecule variable region of described monoclonal antibody S2C6 is respectively as shown in SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20 in sequence table.
The invention also discloses the method that its gene is got in the preparation of said monoclonal antibody S2D8 and S2C6 and fishing, mainly comprise the steps:
1. the structure of anti-StxII monoclonal antibody hybridoma cell strain
First, prokaryotic expression StxII albumin A subunit, immune Balb/c mouse, first immunisation, StxII albumen mixes with isopyknic Freund's complete adjuvant, abdominal injection; With equivalent StxII albumen and the immunity of Freund's incomplete adjuvant mixing pneumoretroperitoneum after 3rd week; 3rd immunity in 5th week, does not add adjuvant.Get immunized mice splenocyte to mix with myeloma cell, merge above-mentioned cell with PEG, resuspended with HAT Selective agar medium, be placed in 37 DEG C, 5%CO
2cultivate in incubator.With indirect elisa method screening positive cell clone subclone repeatedly again, until all Hybridoma Cell Culture supernatants are detected as 100% positive.
2. hybridoma fishing that is light, heavy chain gene is got
Extract the RNA of secrete monoclonal antibody S2D8 and S2C6 cell, through RT-PCR, fish the weight chain gene getting antibody with Auele Specific Primer.Conventional method connects into carrier, transform competent bacteria, the single bacterium colony of picking after cultivating, and carries out DNA sequencing after extracting plasmid PCR qualification.
3. the analysis of monoclonal antibody S2D8 and S2C6 variable region amino acid sequence and complementary determining region aminoacid sequence
With the online software of www.expasy.org light, the weight chain variable region nucleotide sequence of monoclonal antibody S2D8 and S2C6 be translated as the aminoacid sequence of its coding, light, the heavy chain variable amino acid sequence of monoclonal antibody S2D8 is as shown in SEQ ID NO:1 in sequence table and SEQ ID NO:2; Light, the heavy chain variable amino acid sequence of monoclonal antibody S2C6 is as shown in SEQ ID NO:11 in sequence table and SEQ ID NO:12;
According to the aminoacid sequence of complementary determining region CDR1, CDR2 and the CDR3 in Kabat database determination monoclonal antibody S2D8 light-chain variable sequence respectively as shown in SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 in sequence table; The aminoacid sequence of complementary determining region CDR1, CDR2 and CDR3 in weight chain variabl area sequence is respectively as shown in SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:10 in sequence table;
According to the aminoacid sequence of complementary determining region CDR1, CDR2 and the CDR3 in Kabat database determination monoclonal antibody S2C6 light-chain variable sequence respectively as shown in SEQ ID NO:15, SEQ ID NO:16 and SEQ ID NO:17 in sequence table; The aminoacid sequence of complementary determining region CDR1, CDR2 and CDR3 in weight chain variabl area sequence is respectively as shown in SEQ ID NO:18, SEQ ID NO:19 and SEQID NO:20 in sequence table.
, heavy chain variable region gene light based on said monoclonal antibody S2D8 of the present invention and S2C6, can build and express multiple small molecules genetic engineering antibody, as single-chain antibody, single domain antibody, chimeric antibody, Fab antibody, antibody fusion protein etc.; Based on the polypeptide coded by said gene or protein, multiple bioactive molecules can be cross-linked, detect for the preparation of StxII expression level, Diagnosis and Treat StxII cause diagnosis or the medicine of disease.
The present invention obtains the monoclonal antibody of 5 strains for StxII A subunit altogether by hybridoma technology: S2D8, S2C6,4F5,1G7 and 11H5, application double antibody sandwich ELISA, makes above-mentioned 5 strain antibodies paired with each other, select best of breed to be beneficial to StxII toxin and to detect, as can be seen from Table 1, only have S2D8/S2C6 to combine, and only have when S2D8 is as coated antibody, and S2C6 is as when detecting antibody, its OD value detecting toxin is the highest, reaches 1.764, and the OD value of other combination is all lower.Epi-position due to 5 strain monoclonal antibodies of above-mentioned acquisition is all positioned at the A subunit of toxin, when two antibody simultaneously with this antigen in conjunction with time, also exist sterically hindered.And only have when S2D8 as catch the antibody of toxin and S2C6 as detection antibody time, because its obstruction is each other minimum, the OD value therefore shown is also the highest, and detection StxII effect is best.
The present invention also, light chain isotype (Isotype) heavy to monoclonal antibody S2D8 and S2C6 identifies, result shows: weight, the light chain isotype of monoclonal antibody S2D8 and S2C6 are respectively: the isotype of heavy chain is G
1, and the isotype of light chain is κ.
The present invention is based on monoclonal antibody S2D8 and S2C6 and prepare the ELISA kit detecting StxII, described ELISA kit comprises: the monoclonal antibody S2C6 of monoclonal antibody S2D8, HRP mark, horseradish peroxidase substrate buffer solution, protein standard substance StxII (100ug/ml, 0.1ml), negative control sample BSA, washing lotion (PBS+0.05%Tween20).
The invention also discloses the using method of the ELISA kit of above-mentioned detection StxII, concrete steps are as follows:
1) diluting antibody S2D8 to concentration with the NaHCO3/Na2CO3 damping fluid (pH9.6) of 0.1M is 10 μ g/ml, be added to 96 hole enzyme plates, 100 μ l/ holes, 4 DEG C of bags are spent the night, wash 1 time with PBST (adding the Tween-20 of 0.05% in PBS), add 5% 4 DEG C, milk close spend the night;
2) by suitable extent of dilution (1: 2 ~ 1: 10) dilution testing sample, join and be coated with in the 96 hole enzyme plates of antibody S2D8, hatch 1 hour for 37 DEG C, with the PBS buffer solution 5 times containing 0.2% tween; The preparation of standard substance for typical curve is set simultaneously, the StxII (1000 of purifying with the PBS doubling dilution containing 1% bovine serum albumin (bovine serum albumin, BSA), 500,250,125,62.5,31.3,15.6,7.8,3.9,2.0,1.0) ng/ml, every hole adds 100 μ l, establishes blank simultaneously, and each extent of dilution establishes multiple hole;
3) dilute HRP enzyme labelled antibody S2C6 with the PBS containing 1%BSA according to 1: 1000, in respective aperture, add 100 μ l enzyme labelled antibodies, hatch 1 hour in 37 DEG C of water-baths, after washing 5 times with PBST;
4) add 100 μ l TMB+H2O2 substrates, incubated at room 20 minutes in every hole, every hole adds the sulfuric acid termination reaction of 100 μ l2M, measures OD value in 450nm place;
5) result judges: what be greater than 2 times of blank well OD value when the OD value of testing sample is considered as the positive, and the typical curve that in testing sample, the concrete concentration of StxII makes according to standard substance is determined.
The present invention also detects the susceptibility of ELISA kit detecting StxII, and result shows the content of StxII in the detection sample that test kit of the present invention can be sensitive, and its sensitivity can reach 4ng/ml.
The present invention have detected the susceptibility of mentioned reagent box to StxII hypotype, and result shows test kit of the present invention and also can effectively identify StxIIc and StxIIvha hypotype.
The beneficial effect of test kit of the present invention:
1, ELISA kit of the present invention, effectively can detect the content of StxII in sample, its sensitivity reaches 4ng/ml.
2, ELISA kit of the present invention, can not only identify StxII toxin, effectively can also identify hypotype StxIIc and the StxIIvha of StxII toxin.
3, test kit of the present invention is easy to use, steady quality, and accuracy is high, is particularly conducive to Basic medical and health institutions fast to the diagnosis of EHEC, takes measures in time to contain spreading of epidemic situation.
Accompanying drawing explanation
The total serum IgE of Fig. 1 extracting from hybridoma;
The electrophorogram of Fig. 2 S2D8 heavy chain and light chain gene pcr amplification;
The electrophorogram of Fig. 3 S2C6 heavy chain and light chain gene pcr amplification;
Fig. 4 detects the susceptibility detected result of the ELISA kit of StxII.
Embodiment
Can more easily understand content of the present invention by consulting following embodiment, these embodiments just for further illustrating the present invention, and do not mean that restriction scope of the present invention.
The structure of embodiment primary antibodie StxII monoclonal antibody hybridoma cell strain
1. material
Fusion protein S txIIA-GST, protein G affinity column, foetal calf serum: Beijing unit Heng Shengma biotechnology research institute product; Serum-free RPMI 1640:Gibco Products; OPTI-MEM substratum, Freund's complete adjuvant and freund 's incomplete adjuvant, colouring reagents TMB:Sigma Products; SP2/0 cell: ATCC introduces; Balb/c and C57BL/6 mouse: Military Medical Science Institute's Experimental Animal Center provides; All the other reagent are commercial.
2. method and result
(1) fusion protein S txIIA-GST 5 weeks age of immunity female Balb/c mouse, 100 μ g/, first immunisation, 100 μ g antigens mix with isopyknic Freund's complete adjuvant, abdominal injection; With equivalent amount of antigen and the immunity of Freund's incomplete adjuvant mixing pneumoretroperitoneum after 3rd week; 3rd immunity in 5th week, does not add adjuvant.
(2) fusion of splenocyte and myeloma cell: merge the last week, recovery murine myeloma cell Sp2/0 to OPTI-MEM substratum (foetal calf serum containing 10%), is placed in 37 DEG C, 5%CO
2cultivate in incubator, merge first 3 days, by passage once.Merge the same day, results myeloma cell, and count, 5.0 × 10
7myeloma cell with serum free medium wash 2 times for subsequent use.Mouse is 3-5 days after the 3rd immunity, extracts eyeball bloodletting, execution.Mouse spleen is taken out in aseptic technique, puts in sterilizing plate, separating Morr. cell, counting, for subsequent use.
The splenocyte being equal to mouse 1/2 spleen is mixed with myeloma cell, and the centrifugal 5min of 1300rpm, removes supernatant liquor as far as possible.In 1.5 minutes, add the PEG of 50% of 1.5md, limit edged shakes up; Then in 8.5 minutes, add the serum free medium of 20ml, limit edged shakes up.
Centrifugal for the cell 1000rpm merged through PEG 5 minutes, removing supernatant liquor, the HAT Selective agar medium adding 150ml was resuspended, fused cell is seeded to aseptic 96 orifice plate 150 μ l/ holes, is placed in 37 DEG C, 5%CO
2cultivate 4 days in incubator, 100 μ l Selective agar medium are added in every hole.
(3) screening of hybridoma and clone: merge latter 10 days, inhale 50 μ l supernatants from every hole, is added to the 96 hole elisa plates (BSA with 1% closes) being coated with StxIIA-GST, incubated at room 1.5 hours; Wash 2 times.The goat anti-mouse 1: 2000 that dilution horseradish peroxidase (Horseradish Peroxidase, HRP) marks, every hole adds 50 μ l, incubated at room 1.5 hours; Wash 4 times.Every hole adds 100 μ lHRP substrate (H
2o
2+ TMB), incubated at room 0.5 hour, every hole adds 100 μ l2M H
2sO
4, survey A450nm value.For positive colony, detect its reactivity to GST label protein as stated above, only have and be combined with StxIIA-GST fusion rotein and be just retained with the uncombined antibody cloning of GST, continue experiment below.
Collecting positive porocyte, be resuspended in HT Selective agar medium, adopt limiting dilution assay diluting cells, and plant in 96 porocyte culture plates, observe after 5 days, to determining the hole only having a cell clone growth, identifying as ELISA.Limiting dilution is carried out to positive porocyte, through 3-4 unicellular separation and Culture, until obtain stable hybridoma cell clone.Mass propgation hybridoma, collects the culture supernatant containing antibody, carries out purifying, and carry out dialysis in PBS with protein G affinity column, and survey concentration ,-20 DEG C frozen for subsequent use.
Obtain the monoclonal antibody of 5 strains for StxII A subunit altogether by above-mentioned hybridoma technology, be respectively S2D8, S2C6,4F5,1G7 and 11H5.
Embodiment two is applied double-antibody sandwich elisa and is selected optimum antibody pairing
The monoclonal antibody of 5 strains for StxII A subunit is obtained altogether: S2D8, S2C6,4F5 by hybridoma technology embodiment 1,1G7 and 11H5, application double antibody sandwich ELISA, makes above-mentioned 5 strain antibodies paired with each other, selects best of breed and is beneficial to StxII toxin and detects.
1. material
NaHCO
3/ Na
2cO
3damping fluid (pH9.6), Tween-20, bovine serum albumin, 96 hole enzyme plates, activation horseradish peroxidase: safe sky, Beijing and bio tech ltd; All the other reagent are commercial.
2. methods and results
The bag quilt of monoclonal antibody.With the NaHCO of 0.1M
3/ Na
2cO
3damping fluid (pH9.6) dilutes antibody concentration to 10 μ g/ml, be added to 96 hole enzyme plates, 100 μ l/ holes, 4 DEG C of bags are spent the night, 1 time is washed with PBST (adding the Tween-20 of 0.05% in PBS), add 5% 4 DEG C, milk close spend the night, wash 1 time with PBST ,-20 DEG C are frozen for subsequent use.
The coupling of monoclonal antibody and horseradish peroxidase (Horseradish Peroxidase, HRP).Monoclonal antibody dialysis in PBS, regulate concentration to 1mg/ml.The product activation horseradish peroxidase of safe sky, application Beijing and bio tech ltd carries out coupling, and concrete operations are with reference to its company's specification sheets.In HRP traget antibody, add the glycerine of 50% ,-20 DEG C frozen for subsequent use.
Different antibodies combine detection StxII step is as follows:
Diluting the StxII of purifying to concentration with the PBS containing 1% bovine serum albumin (bovine serum albumin, BSA) is 10 μ g/ml, and every hole adds 100 μ l, hatches 1 hour, wash 5 times with PBST in 37 DEG C of water-baths.With the PBS containing 1%BSA according to 1: 1000 dilution HRP enzyme labelled antibody, according to the principle that 5 strain antibodies are paired with each other, in respective aperture, add 100 μ l enzyme labelled antibodies, hatch 1 hour in 37 DEG C of water-baths, after washing 5 times with PBST, in every hole, add 100 μ l TMB+H
2o
2substrate, incubated at room 20 minutes, every hole adds the sulfuric acid termination reaction of 100 μ l2M, measures OD value in 450nm place.Concrete outcome is as table 1:
The effect of table 1 different antibodies combine detection StxII
As can be seen from Table 1, only have S2D8/S2C6 to combine, and only have when S2D8 is as coated antibody, and S2C6 is as when detecting antibody, its OD value detecting toxin is the highest, reaches 1.764, and OD value of other combination is all lower.Epi-position due to 5 strain monoclonal antibodies of above-mentioned acquisition is all positioned at the A subunit of toxin, when two antibody simultaneously with this antigen in conjunction with time, also exist sterically hindered.And only have when S2D8 as catch the antibody of toxin and S2C6 as detection antibody time, its obstruction each other possible is minimum, and the OD value therefore shown is also the highest, and detection StxII effect is best.
The weight of embodiment three monoclonal antibody S2D8 and S2C6, the qualification of light chain isotype
Use SBA Cloning System/HRP isotype identification kit (5300-05) of SouthernBiotech company, with PBS (pH7.4), dilution goat anti-mouse (H+L) antibody to 10 μ g/ml, add to ELISA enzyme plate, every hole 100 μ l, 4 DEG C of overnight incubation.Abandon coating buffer, wash 3 times with the PBS (PBST) containing 0.05%Tween20, every hole adds the BSA of 1% of 200 μ l, closes for 4 DEG C and spends the night.Wash 3 times with PBST, add 100 μ l Hybridoma culture supernatants in Zhong Mei hole, 12 holes, be placed in 37 DEG C of water-baths and hatch 1 hour, wash 3 times with PBST.Resist by the goat anti-mouse two that respectively dilute HRP mark at 1: 500 with the PBS containing 1%BSA, its specificity is as follows: heavy chain is IgG
1, IgG
2a, IgG
2b, IgG
3, light chain is κ, λ, and each specificity two is anti-adds 2 holes, every hole 100 μ l, is placed in 37 DEG C of water-baths and hatches 1 hour, wash 5 times with PBST.Every hole adds 100 μ l substrate (TMB+H
2o
2), room temperature places 20 minutes, and every hole adds 2M H
2sO
4100 μ l termination reactions, measure absorbancy under being placed in 450nm, the results are shown in Table 2:
The weight of table 2 monoclonal antibody S2D8 and S2C6, the qualification of light chain isotype
| ELIAS secondary antibody | IgG 1 | IgG 2a | IgG 2b | IgG 3 | k | λ |
| OD 450nm(S2D8) | 1.453 | 0.105 | 0.056 | 0.091 | 1.975 | 0.085 |
| OD 450nm(S2C4) | 1.391 | 0.092 | 0.083 | 0.101 | 1.867 | 0.076 |
From the results shown in Table 2, the weight of monoclonal antibody S2D8 and S2C6, light chain isotype are respectively: the isotype of heavy chain is G
1, and the isotype of light chain is κ.
Embodiment four monoclonal antibody S2D8 and S2C6 is heavy, the clone of chain variable region gene
The hybridoma of taking the logarithm vegetative period, adopts the Trizol extracted total RNA of Invitrogen company, with oligo (dT)
20for primer, reverse transcription generates cDNA.Then Auele Specific Primer PCR is utilized to increase respectively its heavy, chain variable region gene.PCR primer is after Purified in electrophoresis, and insert pMD-18T carrier by TA clone, check order, carry out sequential analysis, relevant operational step is as follows:
(1) total serum IgE extracting: the Trizol extracted total RNA specification sheets with reference to Invitrogen company operates, electrophorogram as shown in Figure 1, result show the present invention extract total serum IgE do not degrade may be used for next step experiment.
(2) cDNA synthesis: with the total serum IgE of extracting for template, oligo (dT) 20 is primer, reverse transcription synthesis cDNA.
oligo(dT)
20(500μg/ml) 1μl
RNA 10μl
dNTPs mix(10mM each) 1μl
Hatch 5 minutes for 65 DEG C, be then placed in 3 minutes fast on ice, add following composition:
Hatch 50 minutes for 42 DEG C, then hatch 15 minutes deactivation reversed transcriptive enzymes for 70 DEG C.
Pcr amplification monoclonal antibody is heavy, chain variable region gene VH and VL
Amplification condition: 94 DEG C of denaturation 5min, then 94 DEG C of sex change 30sec; 56 DEG C of annealing 30sec; 72 DEG C extend 1min, totally 30 circulations.
Wherein, the primer of amplification VH is:
MHV1：5’ATGAAATGCAGCTGGGGCATSTTCTTC3’
MHV2：5’ATGGGATGGAGCTRTATCATSYTCTT3’
MHV3：5’ATGAAGWTGTGGTTAAACTGGGTTTTT3’
MHV4：5’ATGRACTTTGGGYTCAGCTTGRTTT3’
MHV5：5’ATGGACTCCAGGCTCAATTTAGTTTTCCTT3’
MHV6：5’ATGGCTTGTCYTRGSGCTRCTCTTCTGC3’
MHV7：5’ATGGRATGGAGCKGGRTCTTTMTCTT3’
MHV8：5’ATGAGAGTGCTGATTCTTTTGTG3’
MHV9：5’ATGGMTTGGGTGTGGAMCTTGCTATTCCTG3’
MHV10：5’ATGGGCAGACTTACATTCTCATTCCTG3’
MHV11：5’ATGGATTTTGGGCTGATTTTTTTTATTG3’
MHV12：5’ATGATGGTGTTAAGTCTTCTGTACCTG3’
MHCGl：5’CAGTGGATAGACAGATGGGGG3’
The primer of amplification VL is:
MKV1：5’ATGAAGTTGCCTGTTAGGCTGTTGGTGCTG3’
MKV2：5’ATGGAGWCAGACACACTCCTGYTATGGGTG3’
MKV3：5’ATGAGTGTGCTCACTCAGGTCCTGGSGTTG3’
MKV4：5’ATGAGGRCCCCTGCTCAGWTTYTTGGMWTCTTG3’
MKV5：5’ATGGATTTWCAGGTGCAGATTWTCAGCTTC3’
MKV6：5’ATGAGGTKCYYTGYTSAGYTYCTGRGG3’
MKV7：5’ATGGGCWTCAAGATGGAGTCACAKWYYCWGG3’
MKV8：5’ATGTGGGGAYCTKTTTYCMMTTTTTCAATTG3’
MKV9：5’ATGGTRTCCWCASCTCAGTTCCTTG3’
MKV10：5’ATGTATATATGTTTGTTGTCTATTTCT3’
MKV11：5’ATGGAAGCCCCAGCTCAGCTTCTCTTCC3’
MKC：5’ACTGGATGGTGGGAAGATGG3’
Degenerate code: R=A or G Y=C or C M=A or C K=G or T S=C or G W=A or T H=A or C or T B=C or G or T V=A or C or G D=A or G or T N=A or C or G or T.
For monoclonal antibody S2D8, variable region of heavy chain, only has MHV4/MHCG1 combination of primers to amplify positive band, for variable region of light chain MKV5 MKC combination of primers can amplify positive band, stripe size is about 450bp (as Fig. 2).For monoclonal antibody S2C6, variable region of heavy chain, only has MHV11/MHCG1 combination of primers to amplify positive band, is about 450bp, for variable region of light chain MKV2 MKC combination of primers can amplify positive band, stripe size is about 430bp (as Fig. 3).
(3) clone of PCR primer: according to Dalian TAKARA company's T A Cloning Kit specification sheets, by monoclonal antibody S2D8 heavy, the light variable region gene PCR primer of S2C6 insert pMD-18T carrier, send company to check order.Sequencing result is as follows:
The nucleotide sequence of monoclonal antibody S2D8 light chain and heavy chain is respectively as shown in SEQ ID NO:3, SEQ ID NO:4 in sequence table; The nucleotide sequence of monoclonal antibody S2C6 light chain and heavy chain is respectively as shown in SEQ ID NO:13, SEQ ID NO:14 in sequence table.
(4) analysis of monoclonal antibody S2D8 and S2C6 variable region amino acid sequence and complementary determining region aminoacid sequence: the aminoacid sequence with the online software of www.expasy.org light, the weight chain variable region nucleotide sequence of monoclonal antibody S2D8 and S2C6 being translated as its coding, light, the heavy chain variable amino acid sequence of monoclonal antibody S2D8 is as shown in SEQ ID NO:1 in sequence table and SEQ ID NO:2; Light, the heavy chain variable amino acid sequence of monoclonal antibody S2C6 is as shown in SEQ ID NO:11 in sequence table and SEQ ID NO:12;
According to the aminoacid sequence of complementary determining region CDR1, CDR2 and the CDR3 in Kabat database determination monoclonal antibody S2D8 light-chain variable sequence respectively as shown in SEQ ID NO:5, SEQ ID NO:6 and SEQ ID NO:7 in sequence table; The aminoacid sequence of complementary determining region CDR1, CDR2 and CDR3 in weight chain variabl area sequence is respectively as shown in SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:10 in sequence table;
According to the aminoacid sequence of complementary determining region CDR1, CDR2 and the CDR3 in Kabat database determination monoclonal antibody S2C6 light-chain variable sequence respectively as shown in SEQ ID NO:15, SEQ ID NO:16 and SEQ ID NO:17 in sequence table; The aminoacid sequence of complementary determining region CDR1, CDR2 and CDR3 in weight chain variabl area sequence is respectively as shown in SEQ ID NO:18, SEQ ID NO:19 and SEQ ID NO:20 in sequence table.
Embodiment five detects the assembling of the ELISA kit of StxII
The ELISA kit detecting StxII comprises: the monoclonal antibody S2C6 of monoclonal antibody S2D8, HRP mark, horseradish peroxidase substrate buffer solution, protein standard substance StxII (100ug/ml, 0.1ml), negative control sample BSA, washing lotion liquid (PBS+0.05%Tween20).
Wherein the monoclonal antibody S2C6 of HRP mark is prepared by the following method: monoclonal antibody S2C6 dialysis in PBS, regulate concentration to 1mg/ml, the product activation horseradish peroxidase of safe sky, application Beijing and bio tech ltd carries out coupling, and concrete operations are with reference to its company's specification sheets; In HRP traget antibody, add the glycerine of 50% ,-20 DEG C frozen for subsequent use.
Wherein horseradish peroxidase substrate buffer solution is prepared by the following method: take 100mg3,3 ', and 5,5 '-tetramethyl benzidine (TMB) is dissolved in 50ml dehydrated alcohol and is prepared into TMB stock solution.Get 0.5ml TMB stock solution time to be used and be added to 10ml phosphate citrate acid substrate buffer solution (0.2MNa
2hPO
4, 0.1M citric acid) in, then add 32 μ l0.75%H
2o
2mixing, is configured to horseradish peroxidase substrate buffer solution.The using method detecting the ELISA kit of StxII is as follows:
6) with the NaHCO of 0.1M
3/ Na
2cO
3it is 10 μ g/ml that damping fluid (pH9.6) dilutes antibody S2D8 to concentration, be added to 96 hole enzyme plates, 100 μ l/ holes, 4 DEG C of bags are spent the night, wash 1 time with PBST (adding the Tween-20 of 0.05% in PBS), add 5% 4 DEG C, milk close spend the night;
7) by suitable extent of dilution (1: 2 ~ 1: 10) dilution testing sample, join and be coated with in the 96 hole enzyme plates of antibody S2D8, hatch 1 hour for 37 DEG C, with the PBS buffer solution 5 times containing 0.2% tween; The preparation of standard substance for typical curve is set simultaneously, the StxII (1000 of purifying with the PBS doubling dilution containing 1% bovine serum albumin (bovine serum albumin, BSA), 500,250,125,62.5,31.3,15.6,7.8,3.9,2.0,1.0) ng/ml, every hole adds 100 μ l, establishes blank simultaneously, and each extent of dilution establishes multiple hole;
8) dilute HRP enzyme labelled antibody S2C6 with the PBS containing 1%BSA according to 1: 1000, in respective aperture, add 100 μ l enzyme labelled antibodies, hatch 1 hour in 37 DEG C of water-baths, after washing 5 times with PBST;
9) 100 μ l TMB+H are added in every hole
2o
2substrate, incubated at room 20 minutes, every hole adds the sulfuric acid termination reaction of 100 μ l2M, measures OD value in 450nm place;
10) result judges: what be greater than 2 times of blank well OD value when the OD value of testing sample is considered as the positive, and the typical curve that in testing sample, the concrete concentration of StxII makes according to standard substance is determined.
Embodiment six detects the sensitivity determination of the ELISA kit of StxII
With the PBS doubling dilution StxII (1000,500,250 containing 1%BSA, 125,62.5,31.3,15.6,7.8,3.9,2.0,1.0) ng/ml, ELISA detection method is as described in embodiment five, and what the OD value of setting sample was greater than 2 times of blank well OD value is considered as the positive, and detected result is as table 3:
The light absorption value of table 3 different concns StxII
Above-mentioned experimental result display: when the concentration of toxin is greater than 4ng/ml, can be measured by this detection system.
Embodiment seven detects the ELISA kit of StxII to the detection of StxII different subtype
For II type shiga toxin, except its toxin prototype StxII, StxIIc and StxIIvha hypotype also has very strong toxicity, and common clinically.On LB flat board, picking is numbered 99A008 (StxIIc) and the mono-bacterium colony of 00A086 (StxIIvha) EHEC respectively, puts 250rpm in LB liquid nutrient medium, 37 DEG C of overnight incubation.Next day, overnight culture was diluted to 2L at 1: 100, and be cultured to 4 hours, adding final concentration is 0.4mg/L ametycin (mitomycin C), then continued cultivation 20 hours.Centrifugal 30 minutes of culture 16,000g4 DEG C, supernatant liquor 0.45 μm of filtering with microporous membrane, adjust ph to 7.5, packing ,-20 DEG C frozen for subsequent use.
Concrete ELISA working method is as described in embodiment five, and detected result is as table 4 (using StxII and LB substratum respectively as positive, negative reference):
Table 4 ELISA kit of the present invention is to the detected result of different StxII hypotype
| Toxin hypotype | StxII | StxIIc | StxIIvha | LB substratum |
| OD value (mean value) | 1.205 | 0.417 | 0.527 | 0.117 |
Above-mentioned experimental result display, the content detecting StxII in sample that the detection StxII ELISA kit decapacitation that the present invention develops is sensitive, also effectively can identify StxII hypotype.
Embodiment eight detects the ELISA kit of StxII to the detection of StxII in serum
Get normal human serum, add the different concns (500 of purifying, 250,125,62.5,31.3,15.6ng/ml) StxII, after abundant mixing, carry out ELISA detection (respectively with the toxin of unmixed serum and normal serum as positive and negative control) by aforesaid operations, result is as table 5:
The detected result of the StxII of different concns in table 5 serum
Above-mentioned experimental result illustrates that body series effectively can detect serum intoxication element molecule.
Claims (8)
1. the monoclonal antibody of anti-StxII or its fragment, comprise light chain CDR1-3 and heavy chain CDR1-3, it is characterized in that, the aminoacid sequence of described light chain CDR1-3 is:
CDR1: as shown in SEQ ID NO:15 in sequence table;
CDR2: as shown in SEQ ID NO:16 in sequence table;
CDR3: as shown in SEQ ID NO:17 in sequence table;
The aminoacid sequence of described heavy chain CDR1-3 is:
CDR1: as shown in SEQ ID NO:18 in sequence table;
CDR2: as shown in SEQ ID NO:19 in sequence table;
CDR3: as shown in SEQ ID NO:20 in sequence table.
2. monoclonal antibody as claimed in claim 1 or its fragment, it is characterized in that, the aminoacid sequence of described variable region of light chain is as shown in SEQ ID NO:11 in sequence table, and the aminoacid sequence of described variable region of heavy chain is as shown in SEQ ID NO:12 in sequence table.
3. the monoclonal antibody as described in claim 1-2 any one or its fragment, it is characterized in that, the encoding sequence of described variable region of light chain is as shown in the nucleotide sequence of SEQ ID NO:13 in sequence table, and the encoding sequence of described variable region of heavy chain is as shown in the nucleotide sequence of SEQ ID NO:14 in sequence table.
4. the monoclonal antibody in claim 1-3 described in any one or its fragment detect the application in StxII or its hypotype StxIIc and StxIIvha reagent in preparation.
5. the application in the medicine of disease caused by preparation treatment StxII or its hypotype StxIIc and StxIIvha of the monoclonal antibody in claim 1-3 described in any one or its fragment.
6. detect an ELISA kit of StxII, described test kit comprises monoclonal antibody as described in claim 1-3 any one or its fragment.
7. a kind of ELISA kit detecting StxII as claimed in claim 6, it is characterized in that, described test kit also comprises monoclonal antibody S2D8, and wherein light, the heavy chain variable amino acid sequence of monoclonal antibody S2D8 is as shown in SEQ ID NO:1 in sequence table and SEQ ID NO:2.
8. a kind of ELISA kit detecting StxII as described in claim 6 or 7 any one, also comprises: horseradish peroxidase substrate buffer solution, protein standard substance StxII, negative control sample BSA, washing lotion PBS+0.05%Tween 20.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310137001.6A CN103235140B (en) | 2013-04-19 | 2013-04-19 | Enzyme-linked immune sorbent assay (ELISA) kit for detecting Shiga toxin II (StxII) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310137001.6A CN103235140B (en) | 2013-04-19 | 2013-04-19 | Enzyme-linked immune sorbent assay (ELISA) kit for detecting Shiga toxin II (StxII) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103235140A CN103235140A (en) | 2013-08-07 |
| CN103235140B true CN103235140B (en) | 2015-05-27 |
Family
ID=48883191
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310137001.6A Active CN103235140B (en) | 2013-04-19 | 2013-04-19 | Enzyme-linked immune sorbent assay (ELISA) kit for detecting Shiga toxin II (StxII) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103235140B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5955293A (en) * | 1989-10-17 | 1999-09-21 | New England Medical Center Hospitals, Inc. | Assays for shiga toxin and shiga-like toxins |
| JP2002275200A (en) * | 2001-03-21 | 2002-09-25 | Kansai Research Institute | MONOCLONAL ANTIBODY HAVING NEUTRALIZING ACTIVITY AGAINST VERO TOXIN (Stx) 1 PRODUCED BY ESCHERICHIA COLI O157:H7, HYBRIDOMA CELL LINE PRODUCING THE SAME AND IMMUNOASSAY |
| CN102584992A (en) * | 2011-01-06 | 2012-07-18 | 北京大北农科技集团股份有限公司 | Colon bacillus outer membrane protein monoclonal antibody and preparation method and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9023352B2 (en) * | 2007-02-20 | 2015-05-05 | Tufts University | Methods, compositions and kits for treating a subject using a recombinant heteromultimeric neutralizing binding protein |
-
2013
- 2013-04-19 CN CN201310137001.6A patent/CN103235140B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5955293A (en) * | 1989-10-17 | 1999-09-21 | New England Medical Center Hospitals, Inc. | Assays for shiga toxin and shiga-like toxins |
| JP2002275200A (en) * | 2001-03-21 | 2002-09-25 | Kansai Research Institute | MONOCLONAL ANTIBODY HAVING NEUTRALIZING ACTIVITY AGAINST VERO TOXIN (Stx) 1 PRODUCED BY ESCHERICHIA COLI O157:H7, HYBRIDOMA CELL LINE PRODUCING THE SAME AND IMMUNOASSAY |
| CN102584992A (en) * | 2011-01-06 | 2012-07-18 | 北京大北农科技集团股份有限公司 | Colon bacillus outer membrane protein monoclonal antibody and preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| Pathogenesis and Diagnosis of Shiga Toxin-Producing Escherichia coli Infections;James C. Paton et al;《clinical microbiology reviews》;19980731;第11卷(第3期);第462-463页 * |
| 肠出血性大肠杆菌0157: H7 志贺毒素IIA1 亚单位单克隆抗体的制备和生物学特性鉴定;罗萍等;《第三军医大学学报》;20080430;第30 卷(第8期);第698-701 页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103235140A (en) | 2013-08-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103073644B (en) | Specific anti-mouse TIGIT monoclonal antibody and preparation method, identification and application thereof | |
| Su et al. | Escherichia coli O157: H7 infection in humans | |
| US20110200614A1 (en) | Anthrax specific antibodies | |
| CN104316690B (en) | Vibrio parahemolyticus immune colloid gold Rapid detection test strip | |
| CN102323416A (en) | Kit for rapid detection of staphylococcus aureus in sample and detection method thereof | |
| CN104745534B (en) | A kind of Procalcitonin monoclonal antibody hybridoma 2H4 and monoclonal antibody | |
| CN104862283A (en) | Pair of high-specificity high-affinity monoclonal antibodies capable of binding to human myoglobin and application thereof | |
| CN104710529B (en) | A kind of single-chain antibody of anti-fishes virus haemorrhagic septicaemia virus | |
| CN103319593B (en) | Anti StxII monoclonal antibody | |
| CN103235140B (en) | Enzyme-linked immune sorbent assay (ELISA) kit for detecting Shiga toxin II (StxII) | |
| CN102676459A (en) | Monoclonal antibody resistant to thermostable direct hemolysin of vibrio parahaemolyticus and preparation method of monoclonal antibody | |
| CN102533664A (en) | Hybridoma cell strain excreting monoclonal antibody (MAb) resisting rice blackstreaked dwarf virus (RBSDV) and application of MAb | |
| JP5467228B2 (en) | Rapid detection method of Campylobacter in stool | |
| CN105198992B (en) | A kind of preparation method of anti-Vibrio vulnificus haemolysis fibroin (VVH) antibody in people source and application | |
| CN108048408A (en) | Ox monocyte chemoattractant protein-1 hybridoma cell strain, the monoclonal antibody of its secretion and application | |
| CN104558167A (en) | Enzyme-linked immunosorbent assay (ELISA) kit for detecting Shiga toxin I by double-antibody sandwich method and application of kit | |
| KR101402279B1 (en) | Rapid isolation method of enterohaemorrhagic Escherichia coli | |
| CN101993492A (en) | ScFv antibody for resisting H5N1 type highly-pathogenic avian influenza and application thereof | |
| CN104231076A (en) | Therapeutic monoclonal antibody for resisting escherichia coli infection, hybridoma cell strain generating monoclonal antibody and use of therapeutic monoclonal antibody | |
| CN105315367A (en) | Enzyme-linked immunoassay kit for detecting methicillin-resistant staphylococcus aureus | |
| CN101775372B (en) | Anti-testicle-protein hT279 antibody or antibody fragment and application thereof | |
| CN114591427B (en) | Mouse anti-MPT 32 protein hybridoma cell line 13B12, monoclonal antibody based on same and application thereof | |
| CN104531731B (en) | Clostridium perfringens alpha toxin Humanized single chain antibody 7D | |
| CN117169500B (en) | ELISA detection method for salmonella | |
| CN108251379A (en) | A kind of hybridoma cell strain, Vibrio vulnificus memebrane protein monoclonal antibody and Vibrio vulnificus detection kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information |
Inventor after: Jiao Yongjun Inventor after: Xu Chuanguang Inventor after: Wu Zhansheng Inventor after: Liu Yongfu Inventor before: Jiao Yongjun Inventor before: Zeng Xiaoyan Inventor before: Guo Xiling Inventor before: Shi Zhiyang Inventor before: Wang Hua Inventor before: Zhou Minghao |
|
| CB03 | Change of inventor or designer information | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20180327 Address after: Room 2301, room C, Wanda Square, Jianye District, Nanjing, Jiangsu Patentee after: Jiangsu Beidou star environmental protection Limited by Share Ltd Address before: No. 172 Jiangsu Road, Nanjing, Jiangsu Patentee before: Jiangsu Disease Prevention Control Central |
|
| TR01 | Transfer of patent right |