CN103224977A - Method for detecting live enterohemorrhagic escherichia coli O157: H7 - Google Patents
Method for detecting live enterohemorrhagic escherichia coli O157: H7 Download PDFInfo
- Publication number
- CN103224977A CN103224977A CN2012105857341A CN201210585734A CN103224977A CN 103224977 A CN103224977 A CN 103224977A CN 2012105857341 A CN2012105857341 A CN 2012105857341A CN 201210585734 A CN201210585734 A CN 201210585734A CN 103224977 A CN103224977 A CN 103224977A
- Authority
- CN
- China
- Prior art keywords
- sample
- bacteria
- detection
- pma
- viable bacteria
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for detecting live enterohemorrhagic escherichia coli O157: H7. The method solves the problem that the existing real-time fluorescence PCR technology cannot effectively distinguish live or dead enterohemorrhagic escherichia coli thereby leading to overestimation of a pathogenic bacterium risk. The method comprises the following steps of pre-treating a liquid sample needing to be detected, adding propidium monoazide (PMA) into the pre-treated liquid sample, controlling a PMA final concentration to 15-20 micrograms per milliliter, carrying out incubation in the dark at a normal temperature, carrying out halogen tungsten lamp radiation treatment, extracting a genome DNA of the treated sample, utilizing the extracted sample genome DNA as a template, carrying out real-time fluorescence PCR quantitative detection of object enterohemorrhagic escherichia coli in the sample, wherein primers and fluorescent label probes used by the real-time fluorescence PCR quantitative detection are shown in the formula of SEQ ID NO.1. The method has short operation time of about 1.5h and can be widely used in the field of food-borne pathogenic bacterium detection.
Description
Technical field
The present invention relates to a kind of colibacillary detection method, particularly relate to a kind of detection enterorrhagia Bacillus coil 0157: the method for H7 viable bacteria.
Background technology
Enterorrhagia Bacillus coil 0157: H7 (E.coli O157:H7) is the serum type of the most important Enterohemorrhagic E.coli relevant with public health, stronger to the environment resistibility, acidproof low temperature resistant, to thermo-responsive, in natural water, can survive several weeks even several months.Enterohemorrhagic Escherichia coli (EHEC) infection is a kind of zoonosis.There are patient, carrier and domestic animal, the poultry etc. of Enterohemorrhagic Escherichia coli (EHEC) infection all can propagate this disease in every body.Enterorrhagia Bacillus coil 0157: H7 pathogenecity and all stronger to the resistibility of hydrochloric acid in gastric juice, the destructiveness of pair cell is big.The general susceptible of crowd, but based on old man and children, and symptom is often heavier after old man and the childhood infection.The World Health Organization O157:H7 lists new food origin disease pathogenic bacteria in.
At present, the method that detects enterorrhagia Bacillus coil 0157: H7 both at home and abroad mainly contains plate isolation culture method and real-time fluorescence PCR technology.Plate isolation culture method complex operation, the detected result error is big, and sense cycle is long, can't grasp and control the situation occurred of enterorrhagia Bacillus coil 0157: H7 in the very first time.The real-time fluorescence PCR technology is according to FRET (fluorescence resonance energy transfer) (fluorescence resonance energy transfer, FRET) principle, design corresponding fluorescent mark nucleic acid probe, carry out technology qualitative, quantitative analysis by PCR reaction pair target gene.The real-time fluorescence PCR technology has high specificity, highly sensitive, can be quantitative, free of contamination advantage, be easy to stdn and apply, obtained using widely in fields such as medical science, military affairs, agricultural, scientific researches, but because DNA can exist for some time after necrocytosis, its detected result can not really reflect dead bacterium and amount of viable bacteria in the sample.
Summary of the invention
The present invention is directed to existing real-time fluorescence PCR and can not effectively distinguish dead bacterium and viable bacteria, cause pathogenic bacterium are crossed the problem of high detection, the method of a kind of qualitative detection enterohemorrhagic Escherichia coli viable bacteria O157:H7 is provided, can't identifies enterorrhagia Bacillus coil 0157 in the environment rapidly in order to overcome prior art: the problem of H7 viable bacteria.
The invention provides the method for a kind of qualitative detection enterohemorrhagic Escherichia coli viable bacteria O157:H7 viable bacteria, this method is at first utilized nitrine bromination third ingot (propidium monoazide, PMA) DNA of dead bacterium in the covalent attachment sample to be checked, extract sample DNA again, by enterorrhagia Bacillus coil 0157 in the real-time fluorescence PCR test sample: the H7 viable bacteria.
The object of the invention is achieved through the following technical solutions:
A kind of detection enterorrhagia Bacillus coil 0157: the method for H7 viable bacteria may further comprise the steps:
(1) the centrifugal concentration of liquid sample; Pick glycerine with transfering loop and guarantee the sample bacterium liquid of depositing to be checked, on the LB solid medium, rule, cultivate 24h in 37 ℃ of constant incubators; Picking list colony inoculation is in 50mL liquid LB substratum, and 37 ℃, the 180rpm shaking table is cultured to logarithmic phase; Adjust OD600 value to 1.0 with aseptic LB substratum, wherein bacteria concentration is more than or equal to 10
9CFU/mL; The inoculum that absorption 1mL is in logarithmic phase places cooled on ice behind the processing 50s immediately in boiling water bath in the 1.5mL centrifuge tube, be the deadly bacterium of coli heat
(2) to the dead bacteria concentration of 1ml intestinal bacteria more than or equal to 10
9Add PMA in the liquid sample of CFU/mL, control PMA final concentration is 15-20 μ g/mL, hatches the halogen tungsten lamp radiation treatment under the normal temperature in the dark place;
(3) extraction step (2) is handled the genomic dna of back sample;
(4) sample genomic dna that extracts with step (3) is a template, carries out the object bacteria in the real-time fluorescence PCR detection by quantitative sample, and the primer final concentration is for being 5-15 μ mol/L in the reaction system, and the probe final concentration is 3-12 μ mol/L; The used primer of quantitative fluorescent PCR, fluorescence labeling probe are shown in SEQ ID NO.1.
Preferably, the response procedures of real-time fluorescence PCR is: 95 ℃ of pre-sex change 2min, each circulation: 95 ℃ of sex change 5s, 60 ℃ of annealing 40s also collect FAM fluorescence, 40 circulations.
The time that hatch the dark place is 5min, and halogen tungsten lamp radiation treatment method is: apart from 650W halogen tungsten lamp 15cm irradiation 5min.
The method that extraction step (2) is handled the genomic dna of back sample comprises phenol/chloroform method, water extraction or CTAB method.
Sample to be checked be not liquid sample the time, also need sample to be checked to be made liquid in that step (1) is preceding.
The present invention can be applicable to enterorrhagia Bacillus coil 0157 in the liquid environment: the fast qualitative of H7 viable bacteria detects.Sample to be checked be not liquid sample the time, also need sample to be checked to be made liquid in that step (1) is preceding.For example in aseptic homogeneous bag, aseptic technique shreds the 25g solid sample in 225mL sterilization LB liquid nutrient medium, utilizes efficient homogenizer homogeneous automatically.Draw each sample 10mL, the centrifugal 5min of 800rpm removes the solid sample fragment, and supernatant liquor is transferred to new centrifuge tube, and the centrifugal 5min of 8000rpm collects thalline and is resuspended in the 1mL stroke-physiological saline solution.
Step of the present invention (1) is sample is carried out concentration to sample centrifugal purpose, obtains higher bacteria concentration, so that follow-up operation.Step (3) extracts the courageous and upright Escherichia coli O 157 of intestines: the method for H7 DNA can be any means known in the art, includes but not limited to phenol/chloroform method, water extraction, CTAB method etc.The response procedures of the real-time fluorescence PCR that step (4) quantitative fluorescent PCR is used is: 95 ℃ of pre-sex change 2min, each circulation: 95 ℃ of sex change 5s, 60 ℃ of annealing 40s also collect fluorescent signal, 40 circulations.
With respect to prior art, the present invention has following advantage: the present invention is an object bacteria with enterorrhagia Bacillus coil 0157: H7, but set up the qualitative detection enterorrhagia Bacillus coil 0157: the method for H7 viable bacteria, carry out the real-time fluorescence PCR amplification by 1 pair of specific primer and 1 fluorescence labeling probe, can qualitative detection go out the enterorrhagia Bacillus coil 0157 in the sample: the H7 viable bacteria shows fast, the characteristics of sensitive, high specificity.The present invention can get rid of the interference of the dead bacterium background of high density, realizes enterorrhagia Bacillus coil 0157: the detection of H7 viable bacteria, avoided false-positive detected result.The present invention is semi-automatic operation, and sense cycle is short.Foundation of the inventive method and application, will shorten enterorrhagia Bacillus coil 0157: the sense cycle of H7 viable bacteria can be enterorrhagia Bacillus coil 0157 from now on: the H7 viable bacteria detects provides strong technical support.
Description of drawings
Fig. 1 is embodiment 1 a fluorescent PCR detected result curve.It is 0,5,10,15 that A, B, C, D, E are followed successively by the PMA final concentration, the amplification curve of 20 μ g/mL samples.Along with increase the present invention of PMA concentration is an object bacteria with enterorrhagia Bacillus coil 0157: H7, but set up the qualitative detection enterorrhagia Bacillus coil 0157: the method for H7 viable bacteria, carry out the real-time fluorescence PCR amplification by 1 pair of specific primer and 1 fluorescence labeling probe, can qualitative detection go out the enterorrhagia Bacillus coil 0157 in the sample: the H7 viable bacteria shows fast, the characteristics of sensitive, high specificity.The present invention can get rid of the interference of the dead bacterium background of high density, realizes enterorrhagia Bacillus coil 0157: the detection of H7 viable bacteria, avoided false-positive detected result.The present invention is semi-automatic operation, and sense cycle is short., PMA strengthens the restraining effect of dead bacterium DNA.
Fig. 2 is the detected result of embodiment 2.It is 0,1,2,3 that a, b, c, d, e are followed successively by light application time, the amplification curve of 5min sample.Along with the time shutter increases, PMA strengthens the restraining effect of dead bacterium DNA.Time shutter is 5min or can suppresses amplification from the DNA of dead bacterium when above fully.
Fig. 3 is the detected result of embodiment 3.Wherein the left side is the amplification curve of viable bacteria after PMA handles, and the right side is the amplification curve of hot inactivated bacteria after PMA handles.The dead bacterium of thermal treatment detects no typical amplification curve through fluorescent PCR after PMA handles, detected result is negative, and the amplification of viable bacteria is typical S type curve.PMA can linkage heat handling dead bacterium DNA, DNA does not have influence to viable bacteria.
Embodiment
For understanding the present invention better, the present invention is further illustrated below in conjunction with drawings and Examples, but the scope of protection of present invention is not limited to the scope of embodiment statement.
Embodiment 1
A kind of detection enterorrhagia Bacillus coil 0157: the method for H7 viable bacteria, carry out according to following steps:
(1) The pretreatment to be checked: pick glycerine with transfering loop and guarantee the sample bacterium liquid of depositing to be checked, on the LB solid medium, rule, cultivate 24h in 37 ℃ of constant incubators.Picking list colony inoculation is in 50mL liquid LB substratum, and 37 ℃, the 180rpm shaking table is cultured to logarithmic phase (OD600 ≈ 1.0).Adjust OD600 value to 1.0 with aseptic LB substratum, wherein bacteria concentration is 10
9CFU/mL.The inoculum that absorption 1mL is in logarithmic phase places cooled on ice behind the processing 50s immediately in boiling water bath in the 1.5mL centrifuge tube, be the deadly bacterium of coli heat.Handle by this, cell walls and cytolemma are had damage in various degree and reach the impaired purpose of germ.
(2) be 10 to the dead bacteria concentration of 1ml intestinal bacteria
9Add nitrine bromination third ingot (PMA) in the liquid sample of CFU/mL, the final concentration of control PMA in Escherichia coli bacteria liquid is 0,5,10,15, and 20 μ g/mL are hatched 10min in the dark place under the normal temperature, then apart from 650W halogen tungsten lamp 15cm apart from irradiation 5min;
(3) extraction of sample DNA: the DNA that extracts sample with phenol/chloroform method;
(4) sample genomic dna that extracts with step (3) is a template, carries out the real-time fluorescence PCR detection by quantitative.At Escherichia coli O 157: H7 Stx gene, download all correlated serieses from ncbi database, by comparative analysis to sequence, select the section of no secondary structure and high conservative, utilize biosoftware Primer Express3.0 at this section design primer and Taqman probe.And carried out the comparison checking of Blast homology by ncbi database, guaranteeing that sequence does not have with other species intersects.Design the used primer sequence of quantitative fluorescent PCR shown in SEQ ID NO.1:
Upstream: 5 '-GACTGCAAAGACGTATGTAGATTCG-3 '
Downstream: 5 '-ATCTATCCCTCTGACATCAACTGC-3 ',
Probe: 5 '-FAM-TGAATGTCATTCGCTCTGCAATAGGTACTC-BHQ1
The response procedures of the real-time fluorescence PCR that quantitative fluorescent PCR is used is: 95 ℃ of pre-sex change 2min, each circulation: 95 ℃ of sex change 5s, 60 ℃ of annealing 40s also collect fluorescent signal, 40 circulations.The primer final concentration is for being 5 μ mol/L in the reaction system, and the probe final concentration is 10 μ mol/L.
Fig. 1 is a detected result.It is 0,5,10,15 that A, B, C, D, E are followed successively by the PMA final concentration, the amplification curve of 20 μ g/mL samples.Along with the increase of PMA concentration, PMA strengthens the restraining effect of dead bacterium DNA.From Fig. 1 as seen, the PMA final concentration is 15 μ g/mL or can suppresses amplification from the DNA of dead bacterium when above fully.Compare with the sample that does not add PMA, when PMA concentration was lower than 15 μ g/mL, along with PMA concentration increases, the Ct value had increase in various degree, but extremely the bacterium background is not removed fully, and still the detection to viable bacteria causes interference, may cause " false positive " detected result.
When the dead bacteria concentration of intestinal bacteria is 10
9Copy/mL, PMA concentration is during greater than 15 μ g/mL, and the no numerical value of Ct value or greater than 40 shows that the result is negative.And do not use the common fluorescent PCR of PMA, or when PMA concentration during less than 15 μ g/mL, the Ct value is less than 40, and showing has false positive results to exist.
A kind of detection enterorrhagia Bacillus coil 0157: the method for H7 viable bacteria, carry out according to following steps:
(1) The pretreatment to be checked: pick glycerine with transfering loop and guarantee the bacterium liquid of depositing, on the LB solid medium, rule, cultivate 24h in 37 ℃ of constant incubators.Picking list colony inoculation is in 50mL liquid LB substratum, and 37 ℃, the 180rpm shaking table is cultured to logarithmic phase (OD600 ≈ 1.0).Adjust OD600 value to 1.0 with aseptic LB substratum, wherein bacteria concentration is 10
9CFU/mL.The inoculum that absorption 1mL is in logarithmic phase places cooled on ice behind the processing 50s immediately in boiling water bath in the 1.5mL centrifuge tube, be the deadly bacterium of coli heat.Handle by this, cell walls and cytolemma are had damage in various degree and reach the impaired purpose of germ.
(2) be 10 to the dead bacteria concentration of 1ml intestinal bacteria
9The final concentration that adds PMA in the liquid sample of CFU/mL is 15 μ g/mL, hatches 5min in the dark place under the normal temperature, then apart from 650W halogen tungsten lamp 15cm irradiation 1～5min;
(3) extraction of sample DNA: the DNA that extracts sample with phenol/chloroform method;
(4) sample genomic dna that extracts with step (3) is that template is carried out the fluorescent PCR detection, wherein, designs the used primer sequence of quantitative fluorescent PCR shown in SEQ ID NO.1:
Upstream: 5 '-GACTGCAAAGACGTATGTAGATTCG-3 '
Downstream: 5 '-ATCTATCCCTCTGACATCAACTGC-3 ',
Probe: 5 '-FAM-TGAATGTCATTCGCTCTGCAATAGGTACTC-BHQ1
The response procedures of the real-time fluorescence PCR that quantitative fluorescent PCR is used is: 95 ℃ of pre-sex change 2min, each circulation: 95 ℃ of sex change 5s, 60 ℃ of annealing 40s also collect fluorescent signal, 40 circulations.The primer final concentration is for being 5 μ mol/L in the reaction system, and the probe final concentration is 12 μ mol/L.
Fig. 2 is a detected result.It is 0,1,2,3 that a, b, c, d, e are followed successively by light application time, the amplification curve of 5min sample.Along with the time shutter increases, PMA strengthens the restraining effect of dead bacterium DNA.Time shutter is 5min or can suppresses amplification from the DNA of dead bacterium when above fully.When the time shutter＜during 5min, along with the time shutter increases, Ct value increases, but the dead bacterium DNA in the sample fails to be removed fully, easy detection to viable bacteria causes interference, causes " false positive " detected result.
Embodiment 3
(1) The pretreatment to be checked: pick glycerine with transfering loop and guarantee the bacterium liquid of depositing, on the LB solid medium, rule, cultivate 24h in 37 ℃ of constant incubators.Picking list colony inoculation is in 50mL liquid LB substratum, and 37 ℃, the 180rpm shaking table is cultured to logarithmic phase (OD600 ≈ 1.0).Adjust OD600 value to 1.0 with aseptic LB substratum, wherein bacteria concentration is 10
9CFU/mL.The inoculum that absorption 1mL is in logarithmic phase places cooled on ice behind the processing 50s immediately in boiling water bath in the 1.5mL centrifuge tube, be the deadly bacterium of coli heat.Handle by this, cell walls and cytolemma are had damage in various degree and reach the impaired purpose of germ.
(2) be 10 to concentration
9The dead bacterium sample of the viable bacteria of CFU/mL or thermal treatment carries out centrifugal treating respectively, in sample to be checked, add PMA to final concentration be 15 μ g/mL, hatch 5min in the dark place, then apart from 650W halogen tungsten lamp 15cm irradiation 5min;
(3) adopt phenol-chloroform method to extract the genomic dna of handling the back sample;
(4) be that template is carried out real-time fluorescence PCR with the sample genomic dna that extracts, the object bacteria in the qualitative detection sample.Design the used primer sequence of quantitative fluorescent PCR shown in SEQ ID NO.1:
Upstream: 5 '-GACTGCAAAGACGTATGTAGATTCG-3 '
Downstream: 5 '-ATCTATCCCTCTGACATCAACTGC-3 ',
Probe: 5 '-FAM-TGAATGTCATTCGCTCTGCAATAGGTACTC-BHQ1
The response procedures of the real-time fluorescence PCR that quantitative fluorescent PCR is used is: 95 ℃ of pre-sex change 2min, each circulation: 95 ℃ of sex change 5s, 60 ℃ of annealing 40s also collect fluorescent signal, 40 circulations.The primer final concentration is for being 15 μ mol/L in the reaction system, and the probe final concentration is 3 μ mol/L.
As shown in Figure 3, wherein the left side is the amplification curve of viable bacteria after PMA handles, and the right side is the amplification curve of hot inactivated bacteria after PMA handles.The dead bacterium of thermal treatment is after PMA handles, and fluorescent PCR detects no typical amplification curve, and detected result is negative, and the amplification of viable bacteria is typical S type curve.PMA can linkage heat handling dead bacterium DNA, make the DNA of dead bacterium not to be amplified, and viable bacteria DNA do not had influence.
SEQUENCE LISTING
＜110〉South China Science ﹠ Engineering University
＜120〉a kind of detection enterorrhagia Bacillus coil 0157: the method for H7 viable bacteria
<130>1
<160>3
<170>PatentIn version 3.5
<210>1
<211>25
<212>DNA
<213>Artificial Sequence
<220>
＜223〉upstream
<400>1
gactgcaaag acgtatgtag attcg 25
<210>2
<211>24
<212>DNA
<213>Artificial Sequence
<220>
＜223〉downstream
<400>2
atctatccct ctgacatcaa ctgc 24
<210>3
<211>30
<212>DNA
<213>Artificial Sequence
<220>
<223>TGAATGTCATTCGCTCTGCAATAGGTACTC
<400>3
tgaatgtcat tcgctctgca ataggtactc 30
Claims (5)
1. one kind is detected enterorrhagia Bacillus coil 0157: the method for H7 viable bacteria, it is characterized in that, and may further comprise the steps:
(1) the centrifugal concentration of liquid sample; Pick glycerine with transfering loop and guarantee the sample bacterium liquid of depositing to be checked, on the LB solid medium, rule, cultivate 24h in 37 ℃ of constant incubators; Picking list colony inoculation is in 50mL liquid LB substratum, and 37 ℃, the 180rpm shaking table is cultured to logarithmic phase; Adjust OD600 value to 1.0 with aseptic LB substratum, wherein bacteria concentration is more than or equal to 10
9CFU/mL; The inoculum that absorption 1mL is in logarithmic phase places cooled on ice behind the processing 50s immediately in boiling water bath in the 1.5mL centrifuge tube, be the deadly bacterium of coli heat;
(2) to the dead bacteria concentration of 1ml intestinal bacteria more than or equal to 10
9Add PMA in the liquid sample of CFU/mL, control PMA final concentration is 15-20 μ g/mL, hatches the halogen tungsten lamp radiation treatment under the normal temperature in the dark place;
(3) extraction step (2) is handled the genomic dna of back sample;
(4) sample genomic dna that extracts with step (3) is a template, carries out the object bacteria in the real-time fluorescence PCR detection by quantitative sample, and the primer final concentration is for being 5-15 μ mol/L in the reaction system, and the probe final concentration is 3-12 μ mol/L; The used primer of quantitative fluorescent PCR, fluorescence labeling probe are shown in SEQ ID NO.1.
2. detection enterorrhagia Bacillus coil 0157 according to claim 1: the method for H7 viable bacteria, it is characterized in that: the response procedures of real-time fluorescence PCR is: 95 ℃ of pre-sex change 2min, each circulation: 95 ℃ of sex change 5s, 60 ℃ of annealing 40s also collect FAM fluorescence, 40 circulations.
3. detection enterorrhagia Bacillus coil 0157 according to claim 1: the method for H7 viable bacteria is characterized in that: the time that hatch the dark place is 5min, and halogen tungsten lamp radiation treatment method is: apart from 650W halogen tungsten lamp 15cm irradiation 5min.
4. detection enterorrhagia Bacillus coil 0157 according to claim 1: the method for H7 viable bacteria is characterized in that: the method that extraction step (2) is handled the genomic dna of back sample comprises phenol/chloroform method, water extraction or CTAB method.
5. detection enterorrhagia Bacillus coil 0157 according to claim 1: the method for H7 viable bacteria is characterized in that: sample to be checked be not liquid sample the time, also need sample to be checked to be made liquid in that step (1) is preceding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012105857341A CN103224977A (en) | 2012-12-28 | 2012-12-28 | Method for detecting live enterohemorrhagic escherichia coli O157: H7 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012105857341A CN103224977A (en) | 2012-12-28 | 2012-12-28 | Method for detecting live enterohemorrhagic escherichia coli O157: H7 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103224977A true CN103224977A (en) | 2013-07-31 |
Family
ID=48835616
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012105857341A Pending CN103224977A (en) | 2012-12-28 | 2012-12-28 | Method for detecting live enterohemorrhagic escherichia coli O157: H7 |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103224977A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106399489A (en) * | 2016-08-31 | 2017-02-15 | 北京卓诚惠生生物科技股份有限公司 | Fluorescent PCR primer and probe group and kit for detecting living bacteria in clinical sample |
| CN111235236A (en) * | 2020-02-15 | 2020-06-05 | 新疆农业大学 | Method for rapidly detecting viable bacteria of erwinia amylovora and application |
| CN111662963A (en) * | 2020-07-06 | 2020-09-15 | 浙江大学 | Method for detecting viable bacteria of Escherichia coli O157: H7 in soil |
| CN113046451A (en) * | 2021-03-19 | 2021-06-29 | 厦门承葛医学检验实验室有限公司 | Live bacterium quantification method of flora and application thereof |
-
2012
- 2012-12-28 CN CN2012105857341A patent/CN103224977A/en active Pending
Non-Patent Citations (2)
| Title |
|---|
| 李聪聪等: "PMA-qPCR方法快速检测活性E.coli O157:H7", 《食品科学》 * |
| 李聪聪等: "PMA-qPCR方法用于监测超声波灭菌效率的适用性及其应用", 《现代食品科技》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106399489A (en) * | 2016-08-31 | 2017-02-15 | 北京卓诚惠生生物科技股份有限公司 | Fluorescent PCR primer and probe group and kit for detecting living bacteria in clinical sample |
| CN111235236A (en) * | 2020-02-15 | 2020-06-05 | 新疆农业大学 | Method for rapidly detecting viable bacteria of erwinia amylovora and application |
| CN111662963A (en) * | 2020-07-06 | 2020-09-15 | 浙江大学 | Method for detecting viable bacteria of Escherichia coli O157: H7 in soil |
| CN111662963B (en) * | 2020-07-06 | 2022-03-11 | 浙江大学 | Method for detecting viable bacteria of Escherichia coli O157: H7 in soil |
| CN113046451A (en) * | 2021-03-19 | 2021-06-29 | 厦门承葛医学检验实验室有限公司 | Live bacterium quantification method of flora and application thereof |
| CN113046451B (en) * | 2021-03-19 | 2022-08-23 | 厦门承葛医学检验实验室有限公司 | Live bacterium quantification method of flora and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Taskin et al. | Selective quantification of viable Escherichia coli bacteria in biosolids by quantitative PCR with propidium monoazide modification | |
| Liang et al. | Prevalence of Yersinia enterocolitica in pigs slaughtered in Chinese abattoirs | |
| Viau et al. | Survey of wastewater indicators and human pathogen genomes in biosolids produced by class A and class B stabilization treatments | |
| Wagner et al. | Removal of free extracellular DNA from environmental samples by ethidium monoazide and propidium monoazide | |
| Verhaelen et al. | Persistence of human norovirus GII. 4 and GI. 4, murine norovirus, and human adenovirus on soft berries as compared with PBS at commonly applied storage conditions | |
| CN104946762B (en) | Detect the kit of Friedlander's bacillus | |
| CN103224977A (en) | Method for detecting live enterohemorrhagic escherichia coli O157: H7 | |
| CN110894556A (en) | PCR primer, probe, kit and detection method for detecting African swine fever virus infectivity | |
| Adams et al. | Comparison of PCR versus culture for detection of Mycobacterium bovis after experimental inoculation of various matrices held under environmental conditions for extended periods | |
| CN102102124B (en) | Multiplex fluorescence PCR (Polymerase Chain Reaction) detection kit for typhoid/paratyphoid saimonella | |
| Begum et al. | Molecular identification of Campylobacter jejuni and coli from chicken, calves and dogs to determine its potential threat on human being | |
| CN103667493B (en) | Preprocessing method for detecting salmonella live bacteria DNA detection in meat and meat products | |
| Noll et al. | A Four-Plex Real-Time PCR Assay, Based on rfb E, stx 1, stx 2, and eae Genes, for the Detection and Quantification of Shiga Toxin–Producing Escherichia coli O157 in Cattle Feces | |
| CN103468797A (en) | Kit for rapid and accurate detection of Escherichia coli O157:H7 live bacterium and its detection method | |
| Weigel et al. | Molecular viability testing of UV-inactivated bacteria | |
| CN101319250B (en) | Method for quick quantitative determination of active bifidobacteria | |
| Pires et al. | Enumeration of Salmonella in feces of naturally infected pigs | |
| Mobarez et al. | Identification of Coxiella burnetii in raw milk of livestock animal in Iran | |
| Yang et al. | Contamination, bioaccumulation mechanism, detection, and control of human norovirus in bivalve shellfish: A review | |
| CN102719535A (en) | Method for rapidly detecting listeria monocytogenes in food | |
| CN102643919A (en) | Detection kit and detection method for viable bacteria in vibrio parahaemolyticus in food | |
| CN103509860A (en) | Quantitative detection method for escherichia coli O157:H7 live bacteria in food | |
| CN106834500B (en) | Specific primer for detecting salmonella pullorum, kit containing primer and application of kit | |
| CN103436623A (en) | Rapid detection kit for viable salmonella in food and use method thereof | |
| Adedeji et al. | Application of loop-mediated isothermal amplification assay in the detection of herpesvirus of turkey (FC 126 strain) from chicken samples in Nigeria |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130731 |