CN103224946A

CN103224946A - Tea tree beta-glucosaccharase gene bGlu and application thereof

Info

Publication number: CN103224946A
Application number: CN201310177923XA
Authority: CN
Inventors: 陆建良; 范方媛; 刘阳; 李娜娜; 郑新强; 梁月荣
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2013-05-14
Filing date: 2013-05-14
Publication date: 2013-07-31
Anticipated expiration: 2033-05-14
Also published as: CN103224946B

Abstract

The invention belongs to the field of gene engineering, relates to a novel tea tree beta-glucosaccharase gene bGlu and an application thereof and simultaneously relates to the application of the tea tree beta-glucosaccharase gene bGlu to promotion of release of volatile substances of plant leaves. Specifically, the tea tree beta-glucosaccharase gene bGlu is a nucleotide sequence shown in SEQ ID No: 1. Protein encoded by the tea tree beta-glucosaccharase gene bGlu is an amino acid sequence shown in SEQ ID No: 2. The tea tree beta-glucosaccharase gene bGlu is used for constructing transgenic plants, and the amount of the volatile substances of the transgenic plant leaves is increased. When the plants are tea trees, the volatile substances include cis-3-hexenol, linalool, methyl salicylate, geraniol, benzyl alcohol and trans, trans-2, 4-heptadienal.

Description

Tea tree beta-glucosidase enzyme gene bGlu and application thereof

Technical field

The invention belongs to the genetically engineered field, be specifically related to a kind of new tea tree beta-glucosidase enzyme gene bGlu and proteins encoded thereof, also relate to beta-glucosidase enzyme gene bGlu in the application that promotes that the plant leaf volatile matter discharges simultaneously.

Background technology

Beta-glucosidase enzyme (EC3.2.1.21) belongs to hydrolase, but the glycosidic link between catalytic hydrolysis aromatic base or alkyl and glycosyl atomic group generates glucose and aglycon thereof, and it is present in natural plant materials, yeast, fungi and bacterial body.

And widely different, relative molecular weight is generally between 40-300Kd because its structure and composition is different for the beta-glucosidase enzyme molecule of different sources, and its suitableeest catalytic temperature is distributed between 40-110 ℃.The iso-electric point (pI) that studies show that at present most of beta-glucosidase enzyme is general in the acid range of 3.5-5.5, and optimal acidity can be higher than pH7.0, and the soda acid tolerance is strong.Glucose is the typical inhibitor of beta-glucosidase enzyme; δ-gluconic acid lactone, p-chloromercuribenzoate, sec.-propyl-β-D-glucosinolate also can suppress this enzymic activity; Hg ²⁺, Cu ²⁺, Ag ⁺, SDS, EDTA and urea more obvious to the restraining effect of this enzyme of most of different sources; Mn ²⁺, Co ²⁺and K ⁺beta-glucosidase enzyme to multiple source has obvious activation.The catalyst mechanism of beta-glucosidase enzyme is the acid catalysis two-way replacement mechanism (Double Displacement Mechanism) of conservative, and catalyzed reaction needs protophobe (Proton Donor) and nucleophilic group (Nucleophile).It is generally acknowledged that beta-glucosidase enzyme has 2 active centre: a nucleophilic center and an acid-base catalysis center; Its catalytic process is: when the glycosylation substrate exists, the nucleophilic center of enzyme is attacked the substrate anomeric carbon atom, the glycosyl of formation α conformation-enzyme covalency intermediate, and then, by the hydrolysis of water mediation enzyme substrates intermediate, another active centre of enzyme provides H ⁺, hydrolysis of glycoside bond β glycosyl product simultaneously forms, and enzymatic reversion is to its initial proton state.

In plant tissue the measuring method of beta-glucosidase activity and condition according to different plants difference.In grape and Sucus Vitis viniferae, grape wine, the detection method of this enzymic activity has two kinds: the one, and the activity of the colorimetric method for determining beta-glucoside that the p-nitrophenyl-β-D-glucopyranoside of take is substrate; The 2nd, after adding geraniol ester, flores aurantii fat, citronellyl acrylate, 2-phenyl-ethyl-propionic acid fat, α-terebinth in zyme extract, with hexokinase and glucose-6-phosphate dehydrogenase, detect the glucose growing amount.Wherein, the colorimetry that p-nitrophenyl-β-the D-glucopyranoside is substrate is widely adopted.

Studies show that, the terpene volatile matter of the plants such as beta-glucosidase enzyme and tealeaves, fruit, vegetables be formed with substantial connection, this enzyme is also relevant with the resistance of plant simultaneously.There are some researches show, the volatile component in grape wine mainly comprises terpenes, lipid, aldoketones and alcohols etc., and the generation of the terpenoid substance that wherein content is higher mainly depends on the catalysis of beta-glucosidase enzyme.Separately studies show that, the aroma component of tealeaves is present in the bright leaf of tea mainly with glucosides combined form greatly, beta-glucosidase enzyme is fragrance precursor substance glucosides in fresh leaves of tea plant to be converted into to the key enzyme of free state volatile aroma, and green tea, black tea and Oolong tea are formed with to vital role.Someone carries out aroma of summer tea with the beta-glucosidase enzyme crude product and improves test, baked green tea phantol and Geraniol content that result makes significantly improve, in dragon well green tea making processes, add in addition the external source beta-glucosidase enzyme to process bright leaf, the components such as Geraniol in processing sample, phantol, nerolidol are discharged in a large number, visible, rationally utilize beta-glucosidase enzyme can effectively improve tea leaf quality.

Summary of the invention

The technical problem to be solved in the present invention is to provide a kind of encoding gene, proteins encoded and application thereof of the beta-glucosidase enzyme relevant with improving the tealeaves volatile matter newly.

In order to solve the problems of the technologies described above, the invention provides a kind of tea tree beta-glucosidase enzyme gene bGlu, be the nucleotide sequence shown in SEQ ID No:1.

The present invention also provides the protein of above-mentioned tea tree beta-glucosidase enzyme gene bGlu coding simultaneously, is the aminoacid sequence shown in SEQ ID No:2.

The present invention also provides the purposes of above-mentioned tea tree beta-glucosidase enzyme gene bGlu simultaneously, and for building transgenic plant, the volatile matter of transgenic plant blade is improved.

Improvement as the purposes of tea tree beta-glucosidase enzyme gene bGlu of the present invention: plant is tea tree, and volatile matter comprises cis-3-hexenol, phantol, and wintergreen oil, Geraniol, phenylcarbinol, anti-, trans-2，4-heptadienal.

Another kind as the purposes of tea tree beta-glucosidase enzyme gene bGlu of the present invention improves: plant is tobacco, volatile matter comprises 4-methyl-1-pentene alcohol, 6-methyl-5-thiazolinyl-2-amylalcohol, 2-Ethylhexyl Alcohol, phantol, vernol, 3-hydroxy-beta-jononeionone.

Beta-glucosidase enzyme gene bGlu of the present invention discharges relevant with promotion plant leaf volatile matter, this gene is the differential gene fragment of application Subtractive Hybridization Technique screening and separating from tea tree physical abuse leaf and normal leaf, then adopts 3 ' RACE and 5 ' RACE technology to obtain the bGlu full-length gene.This gene nucleotide series total length 2229bp, as shown in SEQ ID No:1, wherein open reading frame (ORF) is positioned at 5 ' and holds the 22nd to the 2037th, altogether long 2016bp, as shown in SEQ ID No:1 line part, the aminoacid sequence of coding SEQ ID No:2.Through confirming with U.S.'s biomolecule information database (http://www.ncbi.nlm.nih.gov/) comparison, the corresponding gene such as the nucleotide sequence shown in SEQ ID No:1 and grape (XM_002266434.2), cucumber (XM_002514407.1) have the homology of 80% left and right.Find by literature search studies show that, in cucumber, beta-glucosidase enzyme is relevant with plant strain growth speed; In grape, beta-glucosidase enzyme stress be relevant with fruit maturation and environmental stress (adverse circumstance such as dehydration).In addition, in paddy rice (Oryza sativa L.) and corn (Zea mays L.) beta-glucosidase enzyme with coerce (salt stress, osmotic stress, arid, low temperature stress etc.) and induce relevant; In cotton (Gossypium hirsutum), beta-glucosidase enzyme is relevant with sick worm infringement.Comparison simultaneously also shows, 2 known tea tree beta-glucosidase enzyme gene order (accession number is respectively AM285295.2 and HQ679938.2) homologys logining in sequence of the present invention and above-mentioned database are lower than 25%, proving that sequence of the present invention is different from known tea tree beta-glucosidase enzyme gene, is a kind of new tea tree beta-glucosidase enzyme gene.The Research Literature search finds no the report that closes the concrete purposes of above-mentioned 2 listed tea tree beta-glucosidase enzyme gene.

The invention provides the protein of said gene bGlu coding, it has the aminoacid sequence shown in SEQ ID No:2.Contain 671 amino acid in this albumen, molecular weight is about 73.2kD, and iso-electric point is 8.7.In sequence, strong basicity amino acid (Lys, Arg) accounts for 10.3%, strongly-acid amino acid (Asp, Glu) accounts for 8.7%, hydrophobic amino acid (Ala, Ile, Leu, Phe, Trp, Val) 34%, polare Aminosaeren (Asn, Cys, Gln, Ser, Thr, Tyr) 27.4%, other amino acid (Met, Gly, His, Pro) 19.5%.α spiral accounting 29.51% in protein structure, β-pleated sheet structure accounting 10.73%, and other structure accountings 59.76%.Research shows, this bGlu is positioned chloroplast(id), belongs to the 3rd class glycosyl hydrolase family.Through confirming with U.S.'s biomolecule information database (http://www.ncbi.nlm.nih.gov/) comparison, aminoacid sequence shown in SEQ ID No:2 and cucumber, peach and grape etc. have the homology more than 79%, simultaneously with known tea tree beta-glucosidase enzyme (what accession number CAK97604(was AM285295.2 by accession number is nucleotide sequence coded) and ADV40931.2(, by accession number, to be AM285295.2 nucleotide sequence coded) amino acid sequence homology is lower than 15%, proves that obtain is a kind of new tea tree beta-glucosidase enzyme bGlu.

The present invention also provides bGlu genetic expression and the volatile matter correlation analysis thereof in tea leaf physical abuse process.The bGlu gene expression results (Fig. 1) that rear different time (0h, 1h, 2h, 5h, 10h and 15h) treatment samples and control sample are processed in the blade mechanism damage shows, And Development of Tea Shoot bGlu gene is processed rear expression intensity with damage and is significantly higher than the contrast that damage is not processed, and present and first strengthen the trend weakened afterwards with the expression of processing time lengthening, reach peak expression when spreading 8h, express to reduce subsequently, illustrate that physical abuse can induce the high expression level of this bGlu gene.In young sprout physical abuse process, volatile matter correlation analysis result is as shown in Fig. 2 ~ Fig. 7: after physical abuse, young sprout volatile matter relative content is significantly higher than the contrast of processing without damage, extend in time volatile matter content and first increase rear reduction simultaneously, after processing 8h, content reaches the highlyest, reduces again subsequently.Illustrate that physical abuse contributes to improve the blade volatile matter content.Correlation analysis shows, bGlu genetic expression intensity and volatile matter content significant positive correlation.Visible, there are close association in young sprout volatile matter content and bGlu genetic expression.

The invention provides a kind of checking and application method that utilizes this gene to improve the plant leaf volatile component.The method relates to the recombinant vectors that contains described gene and is transformed the transgenic plant that obtain by described recombinant vectors.

The checking that improves plant leaf volatile constituent content adopts transgene tobacco to be identified.Specific practice comprises that pZP211-bGlu vector construction, agrobacterium mediation converted and tobacco regrowth obtain, turn the evaluation of tea tree bGlu genetic tobacco, positive plant excised leaf volatile matter is measured.Detect and find that transgene tobacco physical abuse blade volatile terpenods (as phantol, vernol etc.) content increases 24-44% than the wild-type tobacco blade.

Main points of the present invention have been to provide the aminoacid sequence shown in the nucleotide sequence shown in SEQ ID No:1 and SEQ ID No:2 and the application on raising plant leaf volatile matter thereof.

The accompanying drawing explanation

Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.

Fig. 1 is the affect comparison diagram of physical abuse on tea leaf bGlu genetic expression intensity;

BGlu genetic expression is usingd actin gene Actin as reference, and it is that the treatment group of different time and the adjustment of control sample concentration is consistent that physical abuse treatment group Actin and normal leaf control group A ctin express consistent expression, guarantees that expression of results has comparability.After the bGlu genetic expression contrast of physical abuse treatment group and normal leaf control group shows the damage processing, bGlu genetic expression significantly strengthens, and shows that physical abuse can strengthen the expression of tea tree bGlu gene; The bGlu genetic expression trend of physical abuse treatment group shows that bGlu genetic expression presents and first strengthens the trend weakened afterwards with the damage time lengthening, reaches peak expression during 8h, expresses and weakens subsequently.

Fig. 2 ~ Fig. 7 is the affect comparison diagram of physical abuse on the tea leaf volatile matter content;

Fig. 2 is cis-3-hexenol relative content variation diagram in physical abuse;

Fig. 3 is phantol relative content variation diagram in physical abuse;

Fig. 4 is wintergreen oil relative content variation diagram in physical abuse;

Fig. 5 is Geraniol relative content variation diagram in physical abuse;

Fig. 6 is phenylcarbinol relative content variation diagram in physical abuse;

Fig. 7 is anti-in physical abuse, trans-2，4-heptadienal relative content variation diagram;

Target substance content means with GC/MS target compound peak area and the ratio of interior mark ethyl decylate peak area, i.e. the relative content of volatile matter.6 kinds of volatile matter ratio analysis all show that the volatile matter content of physical abuse treatment group is higher than normal leaf control group, and first increase rear reduction with its content of prolongation of damage time, when processing 8h, reach the highlyest, reduce again subsequently.Illustrate that physical abuse contributes to improve the blade volatile matter content.Correlation analysis shows, bGlu genetic expression intensity and volatile matter content significant positive correlation.Visible, there are close ties in young sprout volatile matter content and bGlu genetic expression.

Fig. 8 is pZP211 plasmid map figure.

Fig. 9 is the NPTII-PCR gel electrophoresis analysis figure that turns tea tree beta-glucosidase enzyme bGlu genetic tobacco;

M representation DNA Marker in figure, i.e. DNA molecular amount mark, arrow indication two bands are respectively 500bp and 400bp mark.S1, S2 represent the NPTII-PCR gel swimming lane of Nicotiana gossei adjoining tree, and this swimming lane means in Nicotiana gossei adjoining tree genome not proceed to restructuring tea tree beta-glucosidase enzyme bGlu gene without band, means S1 and S2 Nicotiana gossei adjoining tree; S3, S4 and S5 representative turn the NPTII-PCR gel swimming lane of tea tree beta-glucosidase enzyme bGlu genetic tobacco; Electrophoretic band is presented between 400-500bp, with the product size of estimating selection markers gene NPTII, conforms to, and means that this plant successfully transforms tea tree beta-glucosidase enzyme bGlu recombination, and S3, S4 and S5 are for turning tea tree beta-glucosidase enzyme bGlu genetic tobacco plant.

Figure 10 is wild-type and turns the volatile matter content comparison diagram after tea tree beta-glucosidase enzyme bGlu genetic tobacco blade mechanism damages;

Target substance content means with GC/MS target compound peak area and the ratio of interior mark ethyl decylate peak area, i.e. the relative content of volatile matter.Relatively find that transgene tobacco physical abuse blade volatile terpenods (as phantol, vernol etc.) content increases 24-44% than the wild-type tobacco blade.

Embodiment

Below in conjunction with specific embodiment, the present invention is described further, so that understand better, but do not limit the present invention.Test method in embodiment, be ordinary method if no special instructions.

Embodiment 1: separation and the clone of tea tree beta-glucosidase enzyme bGlu gene

1) utilize Using Suppression Subtractive Hybridization (SSH) to separate tea tree beta-glucosidase enzyme bGlu gene fragment

The Fuding white tea tea tree breed blade of take is material, and with No. 5 insect needles puncture 6 pins on the second leaf under the treatment group bud, control group be without the second leaf under the bud of puncture, after processing 6h, to treatment group and control group, is sampled frozen.By two groups of samples respectively with after liquid nitrogen grinding, extract the total RNA of tea leaf with TRIzol method (Invitrogen Life Technologies), and with OligotexTM-dT30<Super>mRNA Purification Kit (precious biological [Dalian] company limited) purified mRNA, utilize PCR-Slelect ^tMcDNA Subtraction Kit(Clontech Laboratories, Lnc., Mountain View, USA) carry out Using Suppression Subtractive Hybridization, specific practice is: get respectively 2 μ g treatment group and control group purified mRNA, carry out cDNA the first chain with the SMARTScribe reversed transcriptive enzyme and synthesize, and then, with synthetic cDNA the second chain of 20 * Second-Strand enzyme mixture, obtain double-stranded cDNA(ds cDNA); Every group of ds cDNA is divided into two pipes after Rsa 1 digestion, respectively with shown in joint Adaptor 1(SEQ ID No:3) and Adaptor 2R(SEQ ID No:4 shown in) be connected to become tester cDNA, that jointing is not driver cDNA; While hybridizing for the first time, add respectively two parts of tester cDNA in driver cDNA, the hybridization of sex change after annealing, make originally to have the tester cDNA equalization of abundance difference, merge two parts of hybridization products, separately add new sex change driver cDNA, hybridize for the second time annealing, the crossbred molecule of further enrichment differential expression, and fill end with the DNA enzyme; Adopt nest-type PRC to carry out two-wheeled PCR reaction to improve the differential gene fragment concentrations, the double-stranded cDNA fragment that the PCR two ends are connected with different joints for the first time is able to the index amplification, and PCR utilizes the gene fragment of nested primer enrichment differential expression for the second time.Concrete operations are referring to the test kit operation instruction.The differential express gene obtained is inserted to pMD 18-T carrier (precious biological [Dalian] company limited), and carrying out the PCR checking with M13-F/M13-R combination of primers (respectively as shown in SEQ ID No:13 and SEQ ID No:14), positive colony entrusts Invitrogen company to be checked order.

Sequential analysis:

To record sequence and utilize Vecscreen(http: //www.ncbi.nlm.nih.gov/VecScreen/VecScreen.html) remove the EST fragment that carrier and joint sequence obtain differential expression, through Blast(http: //blast.ncbi.nlm.nih.gov/) the sequence homology comparison, obtained a new tea est sequence higher with the beta-glucosidase enzyme similarity of upland cotton, cucumber etc.

2) tea tree beta-glucosidase enzyme bGlu gene clone

According to this est sequence, design special primer (shown in SEQ ID No:5-12) carries out the full-length gene clone.Get Fuding tea tree breed young sprout (1 bud 2 leaves), extract the total RNA of tea leaf with TRIzol method (Invitrogen Life Technologies) after liquid nitrogen grinding, and with OligotexTM-dT30<Super > mRNA Purification Kit (precious biological [Dalian] company limited) purified mRNA, get 1 μ g purified mRNA, with TaKaRa 3 ' RACE Core Set Ver.2.0 test kit (precious biological [Dalian] company limited), carry out 3 ' end group because of sequence clone.MRNA is through synthetic the first chain cDNA of reversed transcriptive enzyme M-MLV, the first chain cDNA of take is template, shown in Auele Specific Primer (shown in SEQ ID No:5) and 3 ' Outer Primer(SEQ ID No:6) carry out the Outer-PCR reaction, get 1 μ l Outer-PCR product, shown in Auele Specific Primer (shown in SEQ ID No:7) and 3 ' Inner Primer(SEQ ID No:8) carry out the Inner-PCR reaction, estimate that 3 ' END product length is between 750bp-850bp, concrete operations are referring to the test kit operation instruction.Separately get 1 μ g purified mRNA, carry out 5 ' end group because of sequence clone with TaKaRa 5 '-Full RACE Kit test kit (precious biological [Dalian] company limited), 5 ' the end of mRNA is through Alkaline Phosphatase(CIAP, alkaline phosphatase) dephosphorylation and Tobacco Acid Pyrophosphatase(TAP) " removing cap " reaction after, be connected to become Ligated RNA with 5 ' the RACE joint provided in test kit.Ligated RNA is through synthetic the first chain cDNA of reversed transcriptive enzyme M-MLV, the first chain cDNA of take is template, shown in Auele Specific Primer (shown in SEQ ID No:9) and 3 ' Outer Primer(SEQ ID No:10) carry out the Outer-PCR reaction, get 1 μ l Outer-PCR product, shown in Auele Specific Primer (shown in SEQ ID No:11) and 3 ' Inner Primer(SEQ ID No:12) carry out the Inner-PCR reaction, estimate that 5 ' END product length is between 1100bp-1250bp, concrete operations are referring to the test kit operation instruction.By above-mentioned RACE product electrophoresis on 1.8% sepharose, and extract target stripe, with precious biological [Dalian] company limited of TaKaRa Agarose Gel DNA Purification Kit Ver.2.0() carry out the band recovery, and insertion pMD 18-T carrier (precious biological [Dalian] company limited), and carrying out the PCR checking with M13-F/M13-R combination of primers (respectively as shown in SEQ ID No:13 and SEQ ID No:14), positive colony entrusts Invitrogen company to carry out sequential analysis.

The fragment sequence obtained is carried out to fragment assembly by SeqMan software (DNAStar company) according to overlapping region, obtain the bGlu full length sequence, this mrna length is for being 2229bp, specifically as shown in SEQ ID No:1.Through confirming with U.S.'s biomolecule information database (http://www.ncbi.nlm.nih.gov/) comparison, this sequence and cucumber, grape etc. have the homology of 80% left and right.Through EditSeq software (DNAStar company), this sequence is carried out to the ORF search, find that open reading frame is positioned at the 22nd to the 2037th of SEQ ID No:1 sequence, overall length is 2016bp, deduction has obtained comprising 671 amino acid whose protein sequences, and (last 3 bases of open reading frame are terminator codon, coded amino acid not), specifically as shown in SEQ ID No:2, this sequence and cucumber, peach and grape etc. have the homology more than 79%, prove that what obtain is the full-length gene order of coding tea beta-glucosidase enzyme bGlu.

Further, carry out multiple sequence sequence analysis and calculating through MegAlign software (DNAStar company), result shows, this bGlu nucleotide sequence (SEQ ID No:1, i.e. No1 in sequence table) with known tea tree beta-glucosidase enzyme gene order (accession number is respectively AM285295.2 and HQ679938.2) homology lower than 25%; Deduce by open reading frame ORF aminoacid sequence (the SEQ ID No:2 obtained simultaneously, be the No2 in sequence table), with known tea tree beta-glucosidase enzyme (what accession number CAK97604(was AM285295.2 by accession number is nucleotide sequence coded) and ADV40931.2(, by accession number, to be AM285295.2 nucleotide sequence coded) amino acid sequence homology is lower than 15%, proves that obtain is a kind of new tea beta-glucosidase enzyme bGlu.

Embodiment 2: the bGlu genetic expression in tea leaf physical abuse process and volatile matter correlation analysis thereof

1) the bGlu genetic expression in tea leaf physical abuse process

The Fuding tea tree breed blade of take is material, respectively sting 6 pins with No. 5 insect needles on treatment group two leaves and a bud young sprout, control group is for normally with tender degree young sprout, after physical abuse is processed, respectively at getting respectively after 0h, 1h, 2h, 5h, 10h and 15h, processing and control sample are frozen, simultaneously remaining processing and contrast bright leaf through steam beating 1min, make dry tea sample after drying 4h for 90 ℃.After getting the bright leaf liquid nitrogen grinding of physical abuse processing different time, extract the total RNA of tea leaf with TRIzol method (Invitrogen Life Technologies), carry out RT-PCR with Auele Specific Primer SEQ ID No:15 and SEQ ID No:16 and express checking, the product size is 224bp.RT-PCR adopts full formula gold 2 * Easy Taq ^tMthe full formula gold of PCR SuperMix([Beijing] company limited) carry out, take tea tree Actin muscle (Actin) gene (http://www.ncbi.nlm.nih.gov/nuccore/FJ355923) as reference (Auele Specific Primer used is SEQ ID No:17 and SEQ ID No:18) simultaneously.

15 μ l reaction PCR systems are: ddH ₂o 4.9 μ l; 2 * Easy Taq ^tMpCR SuperMix 7.5 μ l; Primer (bGlu primer SEQ ID No:15 & SEQ ID No:16 or Actin primer SEQ ID No:17 and SEQ ID No:18; 10mM each) 0.6 μ l; CDNA 2 μ l.The pcr amplification condition is: 94 ℃ of denaturation 3min, 94 ℃ of sex change 45s, 50 ℃ of annealing 30s, 72 ℃ extend 30s, 30 circulations, extend 10min after 72 ℃.Product carries out electrophoresis detection with 2.5% sepharose, result is as shown in Figure 1: And Development of Tea Shoot bGlu gene with damage, process after expression intensity be significantly higher than the contrast that damage is not processed, and present the rear reducing tendency of first enhancing with processing the time lengthening expression, reach peak expression when spreading 8h, express and reduce subsequently.Illustrate that physical abuse can induce the high expression level of this bGlu gene.

2) volatile matter content analysis in And Development of Tea Shoot physical abuse process

Above-mentioned dry tea sample is crossed the 0.45mm sieve after crushed, and fragrance extracts and adopts continuous still battery extraction plant (SDE method).Add tealeaves 15g in the 500ml round-bottomed flask, boiling water 350ml adds internal standard substance ethyl decylate 100 μ l(0.2 μ g/ μ l simultaneously); Add in the 250ml flask and heavily steam ether 30ml.Above-mentioned two flasks are mounted to SDE device 50 ℃ of heating ether of water-bath, shell type heater heats millet paste.Extract 1h under the millet paste boiling state, transfer contains the ether extraction liquid of volatile matter to glass test tube, and spends the night with anhydrous sodium sulfate dehydration, after nitrogen blowing is concentrated, obtains the volatile matter concentrated solution.Concentrated solution utilizes GC/MS(HP6890/5973, Agilent company) to analyze, analysis condition is: HP-INNOWax 30m * 0.32mm * 0.5 μ m capillary column; Carrier gas is high-purity He(99.999%), flow velocity is 1.0ml/min; Temperature programming is 50 ℃ and keeps 5min, rises to 210 ℃ and keep 10min with 3 ℃/min temperature rise rate, then rises to 230 ℃ with 3 ℃/min; Injector temperature is 250 ℃, and ion source temperature is 230 ℃, and the ionization mode is EI, and scan mode is scan, and sweep limit is 10-400; Input mode is Splitless injecting samples; Sampling delay 3.5min; Sample size 2 μ l.Each component mass-spectrometric data is carried out the NIST library searching, and contrast fit indices in conjunction with standard specimen with carry out qualitatively with reference to related documents is simultaneously carried out quantitative according to each component peaks area and the ratio of interior mark ethyl decylate peak area.In young sprout physical abuse process, volatile matter correlation analysis result is as shown in Fig. 2 ~ Fig. 7: after physical abuse, young sprout volatile matter relative content is significantly higher than the contrast of processing without damage, extend in time volatile matter content and first increase rear reduction simultaneously, after processing 8h, content reaches the highlyest, reduces again subsequently.Illustrate that physical abuse contributes to improve the blade volatile matter content.Correlation analysis shows, bGlu genetic expression intensity and volatile matter content significant positive correlation.Visible, there are close ties in young sprout volatile matter content and bGlu genetic expression.

Embodiment 3: turn the acquisition of tea tree beta-glucosidase enzyme bGlu genetic tobacco and evaluation thereof

1) RT-PCR amplification bGlu and amplified fragments are connected into the T-carrier

Primer according to gene order design packet shown in SEQ ID No:1 containing Sac 1 and Bam H1 restriction enzyme site and 5 ' AA protection base; for line part in SEQ ID No:19 and SEQ ID No:20(SEQ ID No:19 is Sac 1 restriction enzyme site, in SEQ ID No:20, the line part is Bam H1 restriction enzyme site) shown in.Extract the total RNA of tea tree (Fuding white tea) young sprout with TRIzol reagent (Invitrogen Life Technologies), the synthetic TaKaRa PrimeScript II 1 that adopts of cDNA the first chain ^stprecious biological [Dalian] company limited of Strand cDNA Synthesis Kit() carry out.The PCR reaction is with precious biological [Dalian] company limited of TaKaRa Ex Taq Hot Start Version() carry out.

50 μ l reaction systems are: ddH ₂o 30.5 μ l; TaKaRa Ex Taq Hot Start(5 U/ μ l) 0.5 μ l; Primer (SEQ ID No:15 & SEQ ID No:16; 10mM each) 4 μ l; 10 * Ex Taq Buffer(Mg ²⁺plus) 5 μ l; DNTP Mixture(2.5mM each) 8 μ l; CDNA 2 μ l.

Response procedures is: 94 ℃ of denaturation 3min; 94 ℃ of sex change 30s, 60 ℃ of annealing 30s, 72 ℃ are extended 3min, 35 circulations; Extend 10min after 72 ℃.

Product carries out electrophoresis detection with 1.5% sepharose.

2) pZP211-bGlu vector construction

After above-mentioned electrophoresis tea tree beta-glucosidase enzyme bGlu target stripe extracts, with precious biological [Dalian] company limited of TaKaRa Agarose Gel DNA Purification Kit Ver.2.0() carry out the band recovery, and inserting pMD 18-T carrier (precious biological [Dalian] company limited), positive colony entrusts Invitrogen company to carry out sequential analysis.Order-checking confirms that sequence obtains the pMD18-Glu plasmid after correct.PMD18-bGlu plasmid and pZP211 carrier (as Fig. 8) are simultaneously through precious biological [Dalian] company limited of Restriction Enzyme Sac 1() and precious biological [Dalian] company limited of Bam H1() double digestion and 1.0% agarose gel electrophoresis, concrete operations are referring to the restriction enzyme operation instruction.Extract the purpose band and with precious biological [Dalian] company limited of TaKaRa Agarose Gel DNA Purification Kit Ver.2.0() reclaimed, both are through precious biological [Dalian] company limited of DNA Ligation Kit Ver.2.1() connect after acquisition recombinant plasmid pZP211-bGlu, concrete operations illustrate referring to test kit.Positive recombinant plasmid utilizes the alternate freezing and thawing method to import and issues Agrobacterium LBA4404, obtains to infect and uses bacterial strain.

3) acquisition of agrobacterium-mediated transformation transformation of tobacco and regrowth

By above-mentioned 28 ℃ of dark culturing activation twice on the YMB solid medium that adds the 100mg/L Rifampin with Agrobacterium rhizogenes LBA4404, the each 12h of infecting.Select single colony inoculation in 20ml containing in the liquid YMB substratum of 100mmol/L Syringylethanone (AS), 28 ℃, 250r/min shaking culture are to OD ₆₀₀for 0.5-0.8 is used for infecting.By tobacco W38 aseptic seedling blade preculture 3 days on the MS solid medium, after being placed in Agrobacterium rhizogenes bacterium liquid and infecting 10-30min, aseptic filter paper blots unnecessary bacterium liquid, shift and contain in the YMB substratum (culture medium altogether) of 100mmol/L AS, dark is cultivated 2 days altogether, by aseptic water washing 3-4 time of the blade after infecting, the 1000mg/L cefotaxime sodium soaks 20min with the deactivation Agrobacterium, aseptic filter paper blots material surface moisture, shifts and contains 25 ℃ of dark culturing in the MS substratum (micro-organisms base) of 500mg/L cefotaxime sodium.

4) turning tea tree beta-glucosidase enzyme bGlu genetic tobacco identifies

After transformation of tobacco obtains whole plant, get fresh young leaflet tablet and extract tobacco gene group DNA by the CTAB method, with special primer SEQ ID No:21 and the SEQ ID No:22 of selection markers gene NPTII, carry out the PCR detection.

15 μ l reaction systems are: ddH ₂o 4.9 μ l; 2 * Easy Taq ^tMthe full formula gold of PCR SuperMix([Beijing] company limited) 7.5 μ l; Primer pair (SEQ ID No:21 & SEQ ID No:22; 10mM each) 0.6 μ l; CDNA 2 μ l.The pcr amplification condition is: 94 ℃ of denaturation 3min, 94 ℃ of sex change 45s, 68 ℃ of annealing 30s, 72 ℃ extend 60s, 35 circulations, extend 10min after 72 ℃.Product carries out electrophoresis detection with 1.5% sepharose, and the purpose band is approximately 476bp(Fig. 9).The positive plant that detection obtains is expanded numerous.

Embodiment 4: after the damage of transgene tobacco blade mechanism, volatile matter is measured

That takes to grow fine turns tea tree beta-glucosidase enzyme bGlu genetic tobacco plant leaf, respectively sting 3-5 pin (slightly different according to the blade size) with No. 5 insect needles on blade, after 6h, adopt headspace solid-phase microextraction to collect the tobacco leaf volatile matter, and with GC/MS(HP6890/5973, Agilent company) analyze, the wild-type strain W38 blade that the identical damage of take is processed is contrast, adopts same procedure to carry out the volatile matter Collection and analysis.Analysis condition is: HP-INNOWax 30m * 0.32mm * 0.5 μ m capillary column; Carrier gas is high-purity He(99.999%), flow velocity is 1.0ml/min; Temperature programming is 50 ℃ and keeps 5min, rises to 210 ℃ and keep 10min with 3 ℃/min temperature rise rate, then rises to 230 ℃ with 3 ℃/min; Injector temperature is 250 ℃, and ion source temperature is 230 ℃, and the ionization mode is EI, and scan mode is scan, and sweep limit is 10-400; Input mode is Splitless injecting samples; Sampling delay 3.5min; Sample size 2 μ l.Each component mass-spectrometric data is carried out the NIST library searching, contrast fit indices in conjunction with standard specimen with carry out qualitative with reference to related documents, according to each component peaks area and the ratio of interior mark ethyl decylate peak area, carry out quantitative simultaneously, result is as shown in figure 10: turn tea tree beta-glucosidase enzyme bGlu genetic tobacco plant leaf after damage is processed, volatile matter content contrasts and has improved respectively 24-44%.

Embodiment 5: with other beta-glucosidase enzyme transgene tobacco volatile matter facilitation effect, compare

According to the method for embodiment 3, by published accession number, be that AM285295.2 and HQ679938.2 tea tree beta-glucosidase enzyme gene and accession number are that XM_002266434.2 grape beta-glucosidase enzyme gene and accession number are XM_002514407.1 cucumber beta-glucosidase enzyme gene, by conversion carrier build, agrobacterium-mediated transformation transforms and the step such as regrowth evaluation obtains these beta-glucosidase enzyme transgene tobaccos.And according to the described method of embodiment 4, the beta-glucosidase enzyme genetic tobacco that turns to multiple source carries out volatile matter mensuration, result shows, turn the tobacco of above-mentioned source beta-glucosidase enzyme gene (accession number is respectively AM285295.2, HQ679938.2, XM_002266434.2, XM_002514407.1) after damage is processed, volatile matter content all turns the low 20-60% of bGlu genetic tobacco of the present invention.

Above primer used etc. is specific as follows:

SEQ ID No：3 5’- CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT

SEQ ID No：4 5’- CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGT

SEQ ID No：5 5’- GAAGCCACGCTGACAATC

SEQ ID No：6 5’- TACCGTCGTTCCACTAGTGATTT

SEQ ID No：7 5’- TACGTGGCAGGGACTTAGTG

SEQ ID No：8 5’- CGCGGATCCTCCACTAGTGATTTCACTATAGG

SEQ ID No：9 5’- CCCATTGTGAACTTCACTCG

SEQ ID No：10 5’- CATGGCTACATGCTGACAGCCTA

SEQ ID No：11 5’- GGCTCATGGGAATGAAGTTG

SEQ ID No：12 5’- CGCGGATCCACAGCCTACTGATGATCAGTCGATG

SEQ ID No：13 5’- GTTTTCCCAGTCACGAC

SEQ ID No：14 5’- CAGGAAACAGCTATGAC

SEQ ID No：15 5’- ATGAGCCGAATTGATGATG

SEQ ID No：16 5’- AGTATTTTCGATGCCTTCTTAG

SEQ ID No：17 5’- AAAGCAAACAGAGAAAAGATGACC

SEQ ID No：18 5’- AGCACCAATAGTAATGACCTGACC

SEQ ID No：19 5’- AA GAGCTCATGATCAGTCGAT

SEQ ID No：20 5’- AA GGATCCGGTGGCCTTGGCA

SEQ ID No：21 5’- TGTTCCGGCTGTCAGCG

SEQ ID No：22 5’- TCGGCAAGCAGGCATCG 。

Finally, it is also to be noted that, what more than enumerate is only several specific embodiments of the present invention.Obviously, the invention is not restricted to above embodiment, many distortion can also be arranged.All distortion that those of ordinary skill in the art can directly derive or associate from content disclosed by the invention, all should think protection scope of the present invention.

Claims

1. tea tree beta-glucosidase enzyme gene bGlu, is characterized in that: be the nucleotide sequence shown in SEQ ID No:1.

2. the protein of tea tree beta-glucosidase enzyme gene bGlu coding as claimed in claim 1, is characterized in that: be the aminoacid sequence shown in SEQ ID No:2.

3. the purposes of tea tree beta-glucosidase enzyme gene bGlu as claimed in claim 1, it is characterized in that: for building transgenic plant, the volatile matter of described transgenic plant blade is improved.

4. the purposes of tea tree beta-glucosidase enzyme gene bGlu according to claim 3 is characterized in that:

Described plant is tea tree, and described volatile matter comprises cis-3-hexenol, phantol, and wintergreen oil, Geraniol, phenylcarbinol, anti-, trans-2，4-heptadienal.

5. the purposes of tea tree beta-glucosidase enzyme gene bGlu according to claim 3 is characterized in that:

Described plant is tobacco, and described volatile matter comprises 4-methyl-1-pentene alcohol, 6-methyl-5-thiazolinyl-2-amylalcohol, 2-Ethylhexyl Alcohol, phantol, vernol, 3-hydroxy-beta-jononeionone.