CN103215375A - Loop-mediated isothermal amplification rapid detection method of chickpea ascochyta leaf blight - Google Patents
Loop-mediated isothermal amplification rapid detection method of chickpea ascochyta leaf blight Download PDFInfo
- Publication number
- CN103215375A CN103215375A CN201310186323XA CN201310186323A CN103215375A CN 103215375 A CN103215375 A CN 103215375A CN 201310186323X A CN201310186323X A CN 201310186323XA CN 201310186323 A CN201310186323 A CN 201310186323A CN 103215375 A CN103215375 A CN 103215375A
- Authority
- CN
- China
- Prior art keywords
- primer
- loop
- mediated isothermal
- isothermal amplification
- leaf blight
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention relates to a loop-mediated isothermal amplification rapid detection method of chickpea ascochyta leaf blight. The loop-mediated isolation amplification rapid detection method comprises the steps of extracting fungus DNA (deoxyribonucleic acid), carrying out loop-mediated isothermal amplification on the fungus, and displaying and detecting. Therefore, the defects of long required peroid, operation complexity and the like in the prior art are overcome. The loop-mediated isothermal amplification rapid detection method has the advantages of rapidness, strong specificity, high sensitivity and low cost and can be used for early diagnosis of chickpea ascochyta leaf blight in the field as well as monitoring and identifying of pathogenic bacteria.
Description
Technical field
The present invention establishes and relates to a kind of method of utilizing loop-mediated isothermal amplification technique to carry out the rapid detection of bacterium sample, specifically is the loop-mediated isothermal amplification fast detection method of a kind of garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei.
Background technology
Garbanzo shell two spore leaf blights are caused by garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei, are a kind of destructive diseases.1911, garbanzo shell two spore leaf blights were found first that in Pakistan the hazardness of this disease is very high, and in important growing area Pakistan of garbanzo, year injured area is up to 25-50%.The weather that cools is fit to the disease development very much, often causes 100% production loss.2007, the garbanzo master of this disease in the north, Xinjiang planted ground such as Mu Lei county, state, Changji, district, Qitai County and breaks out, and is 4000hm at Mu Lei county onset area only wherein
2, the strain rate 46% that on average causes harm, the piece strain rate that causes harm in serious field reaches 100%, and the production loss rate is 40%-50%.This disease main harm blade, petiole, cane also can infect the tender pod of children.The killed back of blade by leaf margin to internal diffusion, it is light brown to the Vandyke brown scab to form " U " shape or " V " shape, produce the tiny stain of dispersive when moist on the scab, petiole and the cane initial stage of being injured produces the water soaking mode scab, scab gradually becomes Vandyke brown subsequently, the scab place depression and the withered disconnected branch of fallen leaves that causes of wilting gradually, whole strain withered death when serious.The beanpod initial stage of being injured produces the water soaking mode scab, becomes the Vandyke brown scab then, and beanpod is withered when serious.In the rainwater time on the high side, morbidity is serious, and production loss is very big.Therefore, carry out garbanzo shell two spore leaf spoting bacterias and detect, prevent that it from propagating from the region of disease to region of disease not, and carry out diagnostic detection at its their early stage, significant to the propagation of garbanzo shell two spore leaf blights with control.
Since finding garbanzo shell two spore leaf blights, the various countries researchist just studies its detection technique.Traditional detection method is from invalid body or seed separating thallus in spite of illness, and it is seeded on the corresponding substratum, cultivates a couple of days in optimal temperature, the form of these thalline is observed again.Then continue to observe conidial morphological specificity if produce spore, choose the sheet microscopy, observe forms such as mycelia, conidium, conidiophore from bacterium colony.Thereby determine whether to exist garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei, perhaps with the naked eye and by microscopy disease symptom is judged the disease that whether causes by Ascochyta rabiei.Traditional detection method is complex operation, time-consuming not only, and requires to have the expertise of height, especially can not satisfy the pass in and out demand of rapid detection and evaluation of quick diagnosis and customs in the disease control.
Though biochip technology can be carried out the evaluation of multiple fungi simultaneously, the cost height has restricted its development; Hybridization mode inherent limitation has influenced its specificity; Mass-spectrometric technique is used to microorganism identification with its quick exact advantage, must be to cultivate the pure mono-clonal bacterium colony of back branch because mass spectrum is identified, and apparatus expensive, and therefore the operation easier height, has limited its application.
In recent years, along with developing rapidly of Protocols in Molecular Biology, multiple nucleic acid amplification method has appearred, substitute amplified reaction (Strand Displacement Amplification as chain, SDA), and rolling circle amplification (Rolling Circle Amplification, RCA), and the polymerase chain reaction that is widely used at present (Polymerase Chain Reaction, PCR) etc.These amplification methods all have it to start new round nucleic acid synthetic innovation part.
Wherein, sequential analysis based on length polymorphism and the sequence polymorphism of rDNA-ITS, be used for reacting biological sibship and classification situation owing to obtain enough relatively information in can never oversize nucleotide sequence, thereby become the focus of classification of fungi and identification research, be widely used at present between the genus kind of fungi and kind in the Phylogenetic Studies of cohort level.Therefore, the application round pcr is more and more to the successful example that pathogenic bacteria carries out special, sensitive rapid molecular detection.Have the scholar to utilize both at home and abroad and conduct a research, but PCR method needs expensive PCR instrument based on the Molecular Detection of ITS base sequence design primer to fungi, higher to equipment requirements, be not suitable for promoting in basic unit.
Loop-mediated isothermal amplification technique (Loop-mediatd Isothermal Amplification is called for short LAMP) is a kind of new nucleic acid amplification method that was developed by the people such as Notomi T of the Rong Yan strain formula meeting of Japan in 2000.The LAMP method is 6 zone design, the 4 species specific primers at target gene, utilize a kind of strand displacement archaeal dna polymerase in constant temperature (about 65 ℃) insulation dozens of minutes, can finish nucleic acid amplification reaction, characteristics with high specific and isothermal rapid amplifying, can be within 1h, with target dna fragment amplification 10
9-10
10Doubly.After reaction is finished, directly behind the interpolation SYBR GREEN I dyestuff, can have or not the direct result of determination of fluorescence by visual inspection in amplified production, it is promptly positive that system is green, is orange promptly negative.Or prolong intercrescence when becoming at DNA, the pyrophosphate ion of separating out from picodna triphosphoric acid matrix (dNTPs) combines with magnesium ion in the reaction soln, can produce a kind of derivative of magnesium pyrophosphate, and the LAMP method of efficient amplification generates a large amount of such derivatives, and present white precipitate.Can as long as detect by an unaided eye the white opacity precipitation, just can identify and whether increase, and not need processes such as loaded down with trivial details electrophoresis and ultraviolet visualization opacity as identification of indicator.Have high specific, rapid sensitive, characteristics such as efficient, easy and simple to handle.Qualitative and the detection by quantitative that has been widely used in the diagnosis of clinical disease, popular bacterium or virus.Because the LAMP reaction does not need PCR instrument and expensive reagent, be beneficial to has very application prospects in the application of some mechanisms of basic unit.
Summary of the invention
The loop-mediated isothermal amplification fast detection method that the purpose of this invention is to provide a kind of garbanzo shell two spore leaf blight pathogenic bacterias, this method comprises that extraction, the ring mediated isothermal amplification of fungi, the demonstration of fungal DNA detect step and finish, to overcome the required cycle length of prior art, complicated operation or the like problem, this method advantage is quick, high specificity, highly sensitive, and cost is low, can be used for the early diagnosis of field garbanzo shell two spore leaf blights and monitoring and the evaluation of germ.
A kind of garbanzo shell two spore leaf blight loop-mediated isothermal amplification fast detection methods of the present invention follow these steps to carry out:
The DNA extraction of a, sample to be checked or fungi:
Adopt conventional fungal DNA extracting method to extract sample nucleic acid to be checked, wherein extract the OD of sample DNA
260/ OD
280Be 1.6-2.0, concentration is 10-100ng/ μ L;
B, carry out the loop-mediated isothermal amplifications of garbanzo shell two spore leaf blight fungies:
In the reaction tubes that 22 μ L loop-mediated isothermal amplification liquid are housed, add 2 μ L sample template DNA to be checked and 1 μ L Bst archaeal dna polymerase,, temperature is transferred to 80 ℃ of termination reactions, take out to be checked behind the 3-5min in 65 ℃ of amplified reaction 30-60min of constant temperature;
C, color developing detection: in each reaction tubes, add 1 μ L developer, the colour-change that directly detects by an unaided eye, the reaction solution color becomes green, is to contain in the sample to be checked or be garbanzo shell two spore leaf blight fungies.
Loop-mediated isothermal amplification liquid is made up of 10 * Thermopol reaction buffer, 1.0-1.4mmol/L picodna triphosphoric acid matrix, 4-8mmol/L sal epsom, 0.8-1.6 μ mol/L upstream inner primer FIP, 0.8-1.6 μ mol/L downstream inner primer BIP, 0.2-0.3 μ mol/L upstream outer primer F3,0.2-0.3 μ mol/L downstream outer primer B3,0.2-0.8 μ mol/L upstream ring primer LF and 0.2-0.8 μ mol/L downstream ring primer LB among the step b, wherein:
Upstream outer primer F3:5 '-CTTGGTATTCCATGGGGCAT-3 ';
Downstream outer primer B3:5 '-ACTTTTGGACGTCGTCGTTAT-3 ';
Upstream inner primer FIP:5 '-GAGGCGAGACAAACACCCAACA-GCCTGTTCGAGCGTCATT-3 ';
Downstream outer primer BIP:5 '-CGCCTTAAAACAATTGGCAGCCG-GAGTGCAAAGCGCGAGAT-3 ';
Upstream ring primer LF:5 '-CCAAGCAAAGCTTGAAGGTACA-3 ';
Downstream ring primer LB:5 '-GCGTATTGATTTCGGAGCGCAGT-3 '.
Trihydroxy methyl aminomethane-the hydrochloric acid, 100mmol/L Repone K, 100mmol/L ammonium sulfate, 20mmol/L sal epsom and 1% triton x-100 that contain 200mmol pH8.8 in the step b loop-mediated isothermal amplification liquid in 10 * Thermopol reaction buffer.
Picodna triphosphoric acid matrix in the step b loop-mediated isothermal amplification liquid is made up of dUTP, dATP, dGTP and four kinds of thymus nucleic acids of dCTP, and wherein the mass ratio of four kinds of thymus nucleic acids is dUTP: dATP: dGTP: dCTP=2: 1: 1: 1.
The Bst archaeal dna polymerase is 8U/ μ L among the step b.
Developer is 10% fluorescence dye SYBR GREEN I among the step c.
The loop-mediated isothermal amplification fast detection method of a kind of garbanzo shell two spore leaf blight pathogenic bacterias of the present invention, the cardinal principle of this method is: (1) particular design can be discerned six not homotactic two inner primers of target DNA (upstream inner primer and downstream inner primer) and two outer primers (upstream outer primer and downstream outer primer) for one group, and inner primer comprises the positive-sense strand and the antisense strand of target DNA; (2) one of them inner primer is at first hybridized with target DNA, strand displacement DNA subsequently synthesizes under the participation with the active archaeal dna polymerase of height strand displacement by an outer primer startup, discharge single stranded DNA, and, produce a primary stem circular DNA as an inner primer and the synthetic template of DNA that outer primer starts by the other end that hybridizes to target; (3) inner primer is done template with original stem circular DNA, starts the synthetic of strand displacement DNA, produces a primary stem circular DNA and the new stem circular DNA by twice stem length; (4) under isothermal condition, inner primer is a template with the stem circular DNA, forms a plurality of stem circular DNAs that contain the target DNA tumor-necrosis factor glycoproteins by strand displacement, and this circulating reaction can make target DNA run up to 10 in one hour
9Copy can be observed amplification by fluorescence dye.
The garbanzo shell two spore leaf blight pathogenic bacteria loop-mediated isothermal amplification fast detection methods that the present invention relates to, in this method:
Separation, the purifying of garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei adopt conventional method of separating fungi that it is separated, and adopt monospore to separate and carry out purifying;
The cultivation of garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei: garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei are inoculated into garbanzo fry in shallow oil on the juice PDA flat board, put in 26 ℃ of incubators of temperature and cultivate 15d, standby;
DNA extraction and the detection of garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei: the mycelia after the 50mg lyophilize and spore powder are added liquid nitrogen to the mortar fully grind, pour in the centrifuge tube, add 200 μ L2% cetyl trimethylammonium bromide lysate (100mmol/L trihydroxy methyl aminomethane-hydrochloric acid, PH8.0; The 20mmol/L ethylenediamine tetraacetic acid (EDTA), pH8.0,1.4mol/L sodium-chlor and a small amount of quartz sand fully grind, add 300 μ L2% cetyl trimethylammonium bromide lysates again, with the abundant mixing of sample, 65 ℃ of temperature, water-bath 1h (the 5-10min mixing once) takes out and places room temperature, added isopyknic chloroform/primary isoamyl alcohol (v/v) 24: 1, fully put upside down mixing, 12000 rev/mins of centrifugal 10min, get supernatant liquor to new centrifuge tube, continue extracting once, get supernatant liquor to new centrifuge tube, add the pre-cold isopropanol of equal-volume and fully put upside down mixing, 4 ℃ of temperature, place 1-2h and promote the DNA precipitation, 12000 rev/mins, 4 ℃ of temperature, centrifugal 10min, abandon supernatant liquor, add 500 μ L70% ethanol mixings, 12000 rev/mins, 4 ℃ of temperature, centrifugal 5min, abandon supernatant liquor, on Bechtop, dry alcohol-free flavor back naturally and add an amount of 1 * TE (10mmol/L trihydroxy methyl aminomethane-hydrochloric acid, 0.1mmol/L ethylenediamine tetraacetic acid (EDTA), pH8.0) damping fluid dissolves (containing 5 μ g/ μ L rnases (RNase) among the TE), and it is stand-by to obtain dna solution;
Download many garbanzo shells two spore leaf blight pathogenic bacteria Ascochyta rabiei ITS sequences that GenBank announces, its sequence number is respectively AY152550, DQ822479, DQ822480, EU167600, FJ032643, HQ700312, JF714463, download sequence and this experiment sequencing sequence " ITS " by name are compared, find out conserved regions, i.e. the 1-440bp of ITS sequence, and utilize online software www.primerexplorer according to it, the special LAMP primer of jp design one cover, comprise two outer primers: upstream outer primer (F3)/downstream outer primer (B3), two inner primers: upstream inner primer (FIP)/downstream inner primer (BIP), two ring primers: upstream ring primer (LF)/downstream ring primer (LB); The target clip size that garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei fungi ring mediated isothermal amplification LAMP detect primer is 181bp;
Wherein primer sequence is:
Upstream outer primer F3:5 '-CTTGGTATTCCATGGGGCAT-3 ';
Downstream outer primer B3:5 '-ACTTTTGGACGTCGTCGTTAT-3 ';
Upstream inner primer FIP:5 '-GAGGCGAGACAAACACCCAACA-GCCTGTTCGAGCGTCATT-3 ';
Downstream outer primer BIP:5 '-CGCCTTAAAACAATTGGCAGCCG-GAGTGCAAAGCGCGAGAT-3 ';
Upstream ring primer LF:5 '-CCAAGCAAAGCTTGAAGGTACA-3 ';
Downstream ring primer LB:5 '-GCGTATTGATTTCGGAGCGCAGT-3 '.
The sequence alignment result:
AY152550 .....ATCATTACCTAGAGTTTGTGGGCTTTGCCCGCTAC 35
DQ822479 ....g----------------------------------- 36
DQ822480 ....g----------------------------------- 36
EU167600 gaagg----------------------------------- 1720
FJ032643 gaagg----------------------------------- 58
HQ700312 gaagg-------------------------------t--- 59
JF714463 .......ggggct----c-g-a------------------ 33
ITS ................................-------- 8
AY152550 CTCTTACCCATGTCTTTTGAGTACTTACGTTTCCTCGGCG 75
DQ822479 ---------------------------------------- 76
DQ822480 ---------------------------------------- 76
EU167600 ---------------------------------------- 1760
FJ032643 ---------------------------------------- 98
HQ700312 ---------------------------------------- 99
JF714463 ---------------------------------------- 73
ITS ---------------------------------------- 48
AY152550 GGTCCGCCCGCCGATTGGACAAAATCAAACCCTTTGCAGT 115
DQ822479 ---------------------------------------- 116
DQ822480 ---------------------------------------- 116
EU167600 ---------------------------------------- 1800
FJ032643 ---------------------------------------- 138
HQ700312 ---------------------------------------- 139
JF714463 ---------------------------------------- 113
ITS ---------------------------------------- 88
AY152550 TGCAATCAGCGTCTGAAAAACATAATAGTTACAACTTTCA 155
DQ822479 ---------------------------------------- 156
DQ822480 ---------------------------------------- 156
EU167600 ---------------------------------------- 1840
FJ032643 ---------------------------------------- 178
HQ700312 ----g----------------------------------- 179
JF714463 ---------------------------------------- 153
ITS ---------------------------------------- 128
AY152550 ACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG 195
DQ822479 ---------------------------------------- 196
DQ822480 ---------------------------------------- 196
EU167600 ---------------------------------------- 1880
FJ032643 ---------------------------------------- 218
HQ700312 ---------------------------------------- 219
JF714463 ---------------------------------------- 193
ITS ---------------------------------------- 168
AY152550 CGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAA 235
DQ822479 ---------------------------------------- 236
DQ822480 ---------------------------------------- 236
EU167600 ---------------------------------------- 1920
FJ032643 ---------------------------------------- 258
HQ700312 ---------------------------------------- 259
JF714463 ---------------------------------------- 233
ITS ---------------------------------------- 208
AY152550 TCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTC 275
DQ822479 ---------------------------------------- 276
DQ822480 ---------------------------------------- 276
EU167600 ---------------------------------------- 1960
FJ032643 ---------------------------------------- 298
HQ700312 ---------------------------------------- 299
JF714463 ---------------------------------------- 273
ITS ---------------------------------------- 248
AY152550 CATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAG 315
DQ822479 ---------------------------------------- 316
DQ822480 ---------------------------------------- 316
EU167600 ---------------------------------------- 2000
FJ032643 ---------------------------------------- 338
HQ700312 ---------------------------------------- 339
JF714463 ---------------------------------------- 313
ITS ---------------------------------------- 288
AY152550 CTTTGCTTGGTGTTGGGTGTTTGTCTCGCCTCTGCGTGTA 355
DQ822479 ---------------------------------------- 356
DQ822480 ---------------------------------------- 356
EU167600 ---------------------------------------- 2040
FJ032643 ---------------------------------------- 378
HQ700312 ---------------------------------------- 379
JF714463 ---------------------------------------- 353
ITS ---------------------------------------- 328
AY152550 GACTCCCCCTTAAAACAATTGGCAGCCGGCGTATTGATTT 395
DQ822479 -----g--.------------------------------- 395
DQ822480 -----g--.------------------------------- 395
EU167600 -----g--.------------------------------- 2079
FJ032643 -----g--.------------------------------- 417
HQ700312 -----g--.------------------------------- 418
JF714463 -----g--.------------------------------- 392
ITS -----g--.------------------------------- 367
AY152550 CGGAGCGCAGTACATCTCGCGCTTTGCACTCATAACGACG 435
DQ822479 ---------------------------------------- 435
DQ822480 ---------------------------------------- 435
EU167600 ---------------------------------------- 2119
FJ032643 ---------------------------------------- 457
HQ700312 ---------------------------------------- 458
JF714463 ---------------------------------------- 432
ITS ---------------------------------------- 407
AY152550 ACGTCCAAAAGTACATTTTTACACTCTTGACC........ 467
DQ822479 --------------------------------........ 467
DQ822480 --------------------------------........ 467
EU167600 --------------------------------tcggatca 2159
FJ032643 --------------------------------tcggatca 497
HQ700312 --------------------------------tcggatca 498
JF714463 --------------------------------tcggatca 472
ITS --------------------------------t....... 440
The LAMP design of primers:
The LAMP primer sequence:
Carry out the loop-mediated isothermal amplification of garbanzo shell two spore leaf blight pathogenic bacterias:
Ring mediated isothermal amplification (LAMP) reaction system (25 μ L): upstream inner primer: each 1.6 μ M of upstream inner primer (FIP)/downstream inner primer (BIP), outer primer: each 0.2 μ M of upstream outer primer (F3)/downstream outer primer (B3), ring primer: upstream ring primer (LF)/each 0.8 μ M of downstream ring primer (LB), picodna triphosphoric acid matrix (dNTPs) (10mM each) 1.4 μ M, 10 * LAMP Buffer (KCl, MgSO
4, (NH
4)
2SO
4, trihydroxy methyl aminomethane-hydrochloric acid, TritonX-1002.5 μ L, sal epsom 2 μ L, Bst archaeal dna polymerase 8U, template DNA 2 μ L, with ultrapure water polishing to 25 μ L, that sample mix is even, hatch 45min for 65 ℃ in temperature, 80 ℃ of temperature, 10min finishes reaction;
The result detects:
(1) centrifugal product sees whether produce white precipitate, if the adularescent precipitation produces, the result is positive, if no white precipitate produces, then the result is negative;
(2) with the agarose gel electrophoresis analysis of product in 2%-3%, if picture shows LAMP characteristic scalariform band, the result is positive, as then the result is negative not have any band;
(3) add 1 μ L SYBR GREEN I and observe colour-change, positive if product becomes green, if nondiscoloration still is orange, then the result is negative.
Garbanzo shell two spore leaf blight pathogenic bacteria loop-mediated isothermal amplification fast detection methods of the present invention, be that ITS conserved sequence according to garbanzo shell two spore leaf blight fungies utilizes online software www.primerexplorer, the special LAMP primer of online design one cover of jp, comprise two outer primers: upstream outer primer (F3)/downstream outer primer (B3), article two, inner primer: upstream inner primer (FIP)/downstream inner primer (BIP), two ring primers: upstream ring primer (LF)/downstream ring primer (LB); The target clip size that garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei fungi LAMP detect primer is 181bp; This conserved sequence is peculiar by garbanzo shell two spore leaf blight pathogenic bacterias, to guarantee to detect the reliability that does not belong to fungi together.The present invention adopts loop-mediated isothermal amplification technique, this technology high specificity, with the regular-PCR detection method identical highly sensitive is arranged, but do not need expensive PCR instrument, only need common water-bath get final product, and the result needn't observe with agarose gel electrophoresis method for detecting, the use fluorescence dye with the naked eye can be observed, simple and quick, be specially adapted to inspection and quarantine mechanism of basic unit.
Description of drawings:
The specificity electrophoresis detection figure of the garbanzo shell two spore leaf blight pathogenic bacterias that Fig. 1 will detect for the present invention, wherein: swimming lane M is that molecular weight is the marker of 2000bp, swimming lane 1-9 is followed successively by garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabeie, dry thread Pyrenomycetes (Rhizoctonia solani), chain lattice spore (Alternaria alternata), mould (Penicillium sp.), aspergillus (Aspergillus sp.), gibberella belongs to (Nectria sp.), Chaetomium (Chaetomium sp.), give birth to neocosmospora (Bionectria sp.), Fusarium (Fusarium sp.), negative control;
The specificity color reaction figure of the garbanzo shell two spore leaf blight pathogenic bacterias that Fig. 2 will detect for the present invention, wherein: 1-9 is followed successively by garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabeie, dry thread Pyrenomycetes (Rhizoctonia solani), chain lattice spore (Alternaria alternata), mould (Penicillium sp.), aspergillus (Aspergillus sp.), gibberella belongs to (Nectria sp.), Chaetomium (Chaetomium sp.), give birth to neocosmospora (Bionectria sp.), Fusarium (Fusarium sp.), negative control;
Fig. 3 is the susceptibility electrophoresis detection figure of the garbanzo shell two spore leaf blight pathogenic bacterias of the present invention's detection, and wherein: swimming lane M is that molecular weight is the marker of 2000bp, and swimming lane 1-10 is the DNA concentration gradient, is followed successively by 6.01 * 10ng/ μ L, 6.01 * 10
0Ng/ μ L, 6.01 * 10
-1Ng/ μ L, 6.01 * 10
-2Ng/ μ L, 6.01 * 10
-3Ng/ μ L, 6.01 * 10
-4Ng/ μ L, 6.01 * 10
-5Ng/ μ L, 6.01 * 10
-6Ng/ μ L, 6.01 * 10
-7Ng/ μ L, 6.01 * 10
-8Ng/ μ L;
Fig. 4 is the electrophoresis detection figure of the present invention to garbanzo shell two spore invalid bodies, infected seed and the soil that carries disease germs, wherein: swimming lane M is that molecular weight is the marker of 2000bp, swimming lane 1-6 is respectively invalid body DNA, seed DNA in spite of illness, seed DNA in spite of illness not, native in spite of illness DNA, not native in spite of illness DNA, negative control;
Fig. 5 for the present invention to the color reaction figure of garbanzo shell two spore invalid bodies, infected seed and the soil that carries disease germs, wherein: 1-6 is respectively invalid body DNA, seed DNA in spite of illness, seed DNA in spite of illness not, native in spite of illness DNA, not native in spite of illness DNA, negative control.
Embodiment
The following example further specifies the present invention, but the restriction of the present invention of should not opposing;
Ring mediated isothermal amplification (LAMP) reaction solution:
Ring mediated isothermal amplification (LAMP) reaction system (25 μ L): inner primer FIP/BIP is upstream inner primer (FIP): 5 '-GAGGCGAGACAAACACCCAACA-GCCTGTTCGAGCGTCATT-3 ' and each 1.6 μ M of downstream inner primer (BIP): 5 '-CGCCTTAAAACAATTGGCAGCCG-GAGTGCAAAGCGCGAGAT-3 ', outer primer F3/B3 is upstream outer primer (F3): 5 '-CTTGGTATTCCATGGGGCAT-3 ', each 0.2 μ M of downstream outer primer (B3): 5 '-ACTTTTGGACGTCGTCGTTAT-3 ', ring primer LF/LB is upstream ring primer (LF): 5 '-CCAAGCAAAGCTTGAAGGTACA-3 ', downstream each 0.8 μ M of ring primer (LB): 5 '-GCGTATTGATTTCGGAGCGCAGT-3 ', picodna triphosphoric acid matrix (dNTPs) (10mM each) 1.4 μ M, wherein the mass ratio of four kinds of thymus nucleic acids in the mixture picodna triphosphoric acid matrix (dNTPs) is dUTP: dATP: dGTP: dCTP=2: 1: 1: 1, and 10 * LAMP Buffer (KCl, MgSO
4, (NH
4)
2SO
4, trihydroxy methyl aminomethane-hydrochloric acid, triton x-100) 2.5 μ L, MgSO42 μ L, BstDNA polysaccharase 8U is with distilled water polishing to 23 μ L; Trihydroxy methyl aminomethane-the hydrochloric acid, 100mmol/L Repone K, 100mmol/L ammonium sulfate, 20mmol/L sal epsom and 1% triton x-100 that contain 200mmol pH8.8 in wherein said 10 * Thermopol reaction buffer;
Bst archaeal dna polymerase: 8U/ μ L (New England Biolabs);
Developer: be 10% fluorescence dye SYBR GREEN I;
Follow procedure detects:
Sample DNA extracts:
Use test kit to extract and comprise garbanzo shell two spore leaf blight pathogenic bacterias, other are the DNA of common bacterial strain;
Carry out loop-mediated isothermal amplification:
In the reaction tubes that 23 μ L LAMP reaction solutions are housed, add 2 μ L template DNA to be checked,, hatch 45min in 65 ℃ of temperature, 80 ℃ of temperature, 10min finishes reaction;
Electrophoresis detection and color developing detection:
With the agarose gel electrophoresis analysis of product in 2%-3%, if picture shows ring mediated isothermal amplification LAMP characteristic scalariform band, the result is positive, as then the result is negative not have any band;
The developer that adds 1 μ L is 10% fluorescence dye SYBR GREEN I observation colour-change, and positive if product becomes green, if nondiscoloration still is orange, then the result is negative;
After garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei genomic dnas and other 8 bacterial strains are carried out ring mediated isothermal (LAMP) amplification, the result shows, the result has only garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei amplification to obtain stepped band, other strains testeds all do not have this amplified production, in the PCR product, add 1 μ L developer respectively and be 10% fluorescence dye SYBR GREEN I, find that the positive reaction pipe presents green, and the negative control pipe does not occur.
The LAMP reaction solution:
Ring mediated isothermal amplification (LAMP) reaction system (25 μ L): inner primer FIP/BIP is upstream inner primer (FIP): 5 '-GAGGCGAGACAAACACCCAACA-GCCTGTTCGAGCGTCATT-3 ' and each 1.6 μ M of downstream inner primer (BIP): 5 '-CGCCTTAAAACAATTGGCAGCCG-GAGTGCAAAGCGCGAGAT-3 ', outer primer F3/B3 is upstream outer primer (F3): 5 '-CTTGGTATTCCATGGGGCAT-3 ', each 0.2 μ M of downstream outer primer (B3): 5 '-ACTTTTGGACGTCGTCGTTAT-3 ', ring primer LF/LB is upstream ring primer (LF): 5 '-CCAAGCAAAGCTTGAAGGTACA-3 ', downstream each 0.8 μ M of ring primer (LB): 5 '-GCGTATTGATTTCGGAGCGCAGT-3 ', picodna triphosphoric acid matrix (dNTPs) (10mM each) 1.4 μ M, wherein the mass ratio of four kinds of thymus nucleic acids in the mixture picodna triphosphoric acid matrix (dNTPs) is dUTP: dATP: dGTP: dCTP=2: 1: 1: 1, and 10 * LAMP Buffer (KCl, MgSO
4, (NH
4)
2SO
4, trihydroxy methyl aminomethane-hydrochloric acid, triton x-100) 2.5 μ L, sal epsom 2 μ L, Bst archaeal dna polymerase 8U is with distilled water polishing to 23 μ L; Trihydroxy methyl aminomethane-the hydrochloric acid, 100mmol/L Repone K, 100mmol/L ammonium sulfate, 20mmol/L sal epsom and 1% triton x-100 that contain 200mmol pH8.8 in wherein said 10 * Thermopol reaction buffer;
Developer: be 10% fluorescence dye SYBR GREEN I;
Follow procedure detects:
Sample DNA extracts:
Use test kit to extract and comprise garbanzo shell two spore leaf blight pathogenic bacteria DNA, and stoste is diluted by 10 multiple proportions example, carry out LAMP amplification, detection sensitivity as template;
Carry out loop-mediated isothermal amplification:
In the reaction tubes that 23 μ LLAMP reaction solutions are housed, add the template DNA of 2 μ L different concns,, hatch 45min in 65 ℃ of temperature, 80 ℃ of temperature, 10min finishes reaction;
Electrophoresis detection and color developing detection:
With the agarose gel electrophoresis analysis of product, according to showing being quick on the draw property of ring mediated isothermal amplification LAMP characteristic scalariform band evaluation LAMP in 2%-3%;
Get the DNA that concentration is 60.1ng/ μ L, it is carried out the dilution of 10 multiple proportions example, ring mediated isothermal amplification LAMP minimum detectability is 6.01 * 10
-6Ng/ μ L.
The specific detection of embodiment 3 garbanzo shells two spore leaf blight invalid bodies, the soil that carries disease germs, infected seed:
Ring mediated isothermal amplification LAMP reaction solution:
Ring mediated isothermal amplification LAMP reaction system (25 μ L): inner primer FIP/BIP is upstream inner primer (FIP): 5 '-GAGGCGAGACAAACACCCAACA-GCCTGTTCGAGCGTCATT-3 ' and downstream inner primer (BIP): 5 '-CGCCTTAAAACAATTGGCAGCCG-GAGTGCAAAGCGCGAGAT-3, each 1.6 μ M, outer primer F3/B3 is upstream outer primer (F3): 5 '-CTTGGTATTCCATGGGGCAT-3 ', each 0.2 μ M of downstream outer primer (B3): 5 '-ACTTTTGGACGTCGTCGTTAT-3 ', ring primer LF/LB is upstream ring primer (LF): 5 '-CCAAGCAAAGCTTGAAGGTACA-3 ', downstream each 0.8 μ M of ring primer (LB): 5 '-GCGTATTGATTTCGGAGCGCAGT-3 ', picodna triphosphoric acid matrix (dNTPs) (10mM each) 1.4 μ M, wherein the mass ratio of four kinds of thymus nucleic acids in the mixture picodna triphosphoric acid matrix (dNTPs) is dUTP: dATP: dGTP: dCTP=2: 1: 1: 1, and 10 * LAMP Buffer (KCl, MgSO
4, (NH
4)
2SO
4, trihydroxy methyl aminomethane-hydrochloric acid, triton x-100) 2.5 μ L, sal epsom 2 μ L, Bst archaeal dna polymerase 8U purchase in (New England Biolabs), with distilled water polishing to 23 μ L; Trihydroxy methyl aminomethane-the hydrochloric acid, 100mmol/L Repone K, 100mmol/L ammonium sulfate, 20mmol/L sal epsom and 1% triton x-100 that contain 200mmol pH8.8 in wherein said 10 * Thermopol reaction buffer;
Developer: be 10% fluorescence dye SYBR GREEN I;
Follow procedure detects:
Sample DNA extracts:
Use test kit to extract the DNA that comprises garbanzo shell two spore leaf blight invalid bodies, the soil that carries disease germs, infected seed;
Carry out loop-mediated isothermal amplification:
In the reaction tubes that 23 μ LLAMP reaction solutions are housed, add the different template DNA of 2 μ L,, hatch 45min in 65 ℃ of temperature, 80 ℃ of temperature, 10min finishes reaction;
Electrophoresis detection and color developing detection:
With the agarose gel electrophoresis analysis of product in 2%-3%, if picture shows ring mediated isothermal amplification LAMP characteristic scalariform band, the result is positive, as then the result is negative not have any band;
The fluorescence dye SYBR Green I that adds 1 μ L10% observes colour-change, and is positive if product becomes green, if nondiscoloration still is orange, then the result is negative;
Adopt ring mediated isothermal amplification LAMP method to garbanzo plant invalid body, in spite of illness seed and in spite of illness soil DNA carry out constant-temperature amplification, the result has only in spite of illness that sample obtains stepped band, control sample does not then have any band; Drip developer SYBR GREEN I and carry out color reaction in ring mediated isothermal amplification LAMP product, find that color sample is by the orange green that becomes in spite of illness, any variation does not then take place in the control sample color, still is orange.
Claims (6)
1. garbanzo shell two spore leaf blight loop-mediated isothermal amplification fast detection methods is characterized in that following these steps to carrying out:
The DNA extraction of a, sample to be checked or fungi:
Adopt conventional fungal DNA extracting method to extract sample nucleic acid to be checked, wherein extract the OD of sample DNA
260/ OD
280Be 1.6-2.0, concentration is 10-100ng/ μ L;
B, carry out the loop-mediated isothermal amplifications of garbanzo shell two spore leaf blight fungies:
In the reaction tubes that 22 μ L loop-mediated isothermal amplification liquid are housed, add 2 μ L sample template DNA to be checked and 1 μ L Bst archaeal dna polymerase,, temperature is transferred to 80 ℃ of termination reactions, take out to be checked behind the 3-5min in 65 ℃ of amplified reaction 30-60min of constant temperature;
C, color developing detection: in each reaction tubes, add 1 μ L developer, the colour-change that directly detects by an unaided eye, the reaction solution color becomes green, is to contain in the sample to be checked or be garbanzo shell two spore leaf blight fungies.
2. method according to claim 1, it is characterized in that loop-mediated isothermal amplification liquid is made up of 10 * Thermopol reaction buffer, 1.0-1.4mmol/L picodna triphosphoric acid matrix, 4-8mmol/L sal epsom, 0.8-1.6 μ mol/L upstream inner primer FIP, 0.8-1.6 μ mol/L downstream inner primer BIP, 0.2-0.3 μ mol/L upstream outer primer F3,0.2-0.3 μ mol/L downstream outer primer B3,0.2-0.8 μ mol/L upstream ring primer LF and 0.2-0.8 μ mol/L downstream ring primer LB among the step b, wherein:
Upstream outer primer F3:5 '-CTTGGTATTCCATGGGGCAT-3 ';
Downstream outer primer B3:5 '-ACTTTTGGACGTCGTCGTTAT-3 ';
Upstream inner primer FIP:5 '-GAGGCGAGACAAACACCCAACA-GCCTGTTCGAGCGTCATT-3 ';
Downstream outer primer BIP:5 '-CGCCTTAAAACAATTGGCAGCCG-GAGTGCAAAGCGCGAGAT-3 ';
Upstream ring primer LF:5 '-CCAAGCAAAGCTTGAAGGTACA-3 ';
Downstream ring primer LB:5 '-GCGTATTGATTTCGGAGCGCAGT-3 '.
3. method according to claim 1 is characterized in that containing in 10 * Thermopol reaction buffer in the step b loop-mediated isothermal amplification liquid trihydroxy methyl aminomethane-hydrochloric acid, 100mmol/L Repone K, 100mmol/L ammonium sulfate, 20mmol/L sal epsom and 1% triton x-100 of 200mmol pH8.8.
4. method according to claim 1, it is characterized in that the picodna triphosphoric acid matrix in the step b loop-mediated isothermal amplification liquid is made up of dUTP, dATP, dGTP and four kinds of thymus nucleic acids of dCTP, wherein the mass ratio of four kinds of thymus nucleic acids is dUTP: dATP: dGTP: dCTP=2: 1: 1: 1.
5. method according to claim 1 is characterized in that the Bst archaeal dna polymerase is 8U/ μ L among the step b.
6. method according to claim 1 is characterized in that developer among the step c is 10% fluorescence dye SYBR GREEN I.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310186323.XA CN103215375B (en) | 2013-05-20 | 2013-05-20 | Loop-mediated isothermal amplification rapid detection method of chickpea ascochyta leaf blight |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310186323.XA CN103215375B (en) | 2013-05-20 | 2013-05-20 | Loop-mediated isothermal amplification rapid detection method of chickpea ascochyta leaf blight |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103215375A true CN103215375A (en) | 2013-07-24 |
| CN103215375B CN103215375B (en) | 2015-04-08 |
Family
ID=48813523
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310186323.XA Expired - Fee Related CN103215375B (en) | 2013-05-20 | 2013-05-20 | Loop-mediated isothermal amplification rapid detection method of chickpea ascochyta leaf blight |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103215375B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154526A (en) * | 2011-05-10 | 2011-08-17 | 江苏省农业科学院 | Method for quickly detecting Chinese papaya leaf curl virus by LAMP (loop mediated isothermal amplification) |
| CN102925589A (en) * | 2012-11-13 | 2013-02-13 | 新疆农业大学 | Establishment of reverse transcription loop-mediated isothermal amplification (RT-LAMP) detection method for Prunus necrotic ringspot virus (PNRSV) |
| WO2013028544A2 (en) * | 2011-08-19 | 2013-02-28 | Roka Bioscience | Compositions and methods for detecting and discriminating between yeast or mold |
-
2013
- 2013-05-20 CN CN201310186323.XA patent/CN103215375B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102154526A (en) * | 2011-05-10 | 2011-08-17 | 江苏省农业科学院 | Method for quickly detecting Chinese papaya leaf curl virus by LAMP (loop mediated isothermal amplification) |
| WO2013028544A2 (en) * | 2011-08-19 | 2013-02-28 | Roka Bioscience | Compositions and methods for detecting and discriminating between yeast or mold |
| CN102925589A (en) * | 2012-11-13 | 2013-02-13 | 新疆农业大学 | Establishment of reverse transcription loop-mediated isothermal amplification (RT-LAMP) detection method for Prunus necrotic ringspot virus (PNRSV) |
Non-Patent Citations (1)
| Title |
|---|
| H.T.T. PHAN ET AL: "A rapid and sensitive polymerase chain reaction (PCR) assay for detection of Ascochyta rabiei, the cause of ascochyta blight of chickpea", 《AUSTRALASIAN PLANT PATHOLOGY》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103215375B (en) | 2015-04-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lu et al. | Identification of Pseudallescheria and Scedosporium species by three molecular methods | |
| Dhib et al. | Multiplex PCR assay for the detection of common dermatophyte nail infections | |
| CN101153326B (en) | Primer, detection method and detection reagent kit for detecting shigella | |
| CN102827929A (en) | Method for detecting nucleic acid | |
| CN101153329A (en) | Primer, detection method and detection reagent kit for detecting staphylococcus aureus | |
| CN102816847A (en) | LAMP primer for detecting Brucella and kit containing the same | |
| CN106987626A (en) | For a variety of fungies of quick detection and identify primer and probe and its application of strain | |
| CN102888458A (en) | Method for quickly detecting (Streptococcus agalactiae)sip with high sensitivity | |
| CN104372099B (en) | A kind of LAMP detection primer compositionss of Phytophthora cactorum bacterium and its LAMP detection kit and LAMP detection method | |
| CN101381771B (en) | Loop-mediated isothermal amplification fast detection method of producing ariatoxin fungi | |
| Niessen et al. | Development and application of loop-mediated Isothermal amplification (LAMP) assays for rapid diagnosis of the bat white-nose disease fungus Pseudogymnoascus destructans | |
| CN106086211A (en) | LAMP primer group, test kit and the detection method of detection Flos Nelumbinis corruption pathogenic bacteria | |
| CN103276061A (en) | Kit having LAMP nucleic acid test strips and used for detecting brucella spp., and application thereof | |
| CN101348835B (en) | Reagent kit for detecting vibrio vulnificus by loop-mediated isothermal amplification technology | |
| CN104946760A (en) | Method for detecting pythium inflatum and dedicated kit | |
| CN103409499A (en) | LAMP (Loop-Mediated Isothermal Amplification) detection method for calcein fluorescence visualization salmonella | |
| CN101875980A (en) | Kit and method for detecting Macrobrachium rosenbergii Nodavirus | |
| CA2803401C (en) | Methods and kits used in the detection of fungus | |
| CN106434879B (en) | Rapidly and efficiently detect the method for Cordyceps militaris different strain mating type | |
| CN102417931B (en) | Polymerase chain reaction (PCR) fluorescence detection kit and detection method for candida albicans | |
| CN105039331B (en) | A kind of peronophythora litchi LAMP primer and its quick determination method and application | |
| CN103215375B (en) | Loop-mediated isothermal amplification rapid detection method of chickpea ascochyta leaf blight | |
| CN105039560B (en) | A kind of lichee anthrax-bacilus LAMP primer and its quick determination method and application | |
| CN103725761A (en) | Group B streptococcus (GBS) nucleic acid detection kit and detection method | |
| CN102312010A (en) | Rapid detection primers, kit and detection method for C.parapsilosis with loop-mediated isothermal amplification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150408 Termination date: 20170520 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |