CN103215374A

CN103215374A - Molecular detection kit and detection method of chickpea ascochyta leaf blight fungi

Info

Publication number: CN103215374A
Application number: CN2013101863070A
Authority: CN
Inventors: 马德英; 马丽娟; 羌松
Original assignee: Xinjiang Agricultural University
Current assignee: Xinjiang Agricultural University
Priority date: 2013-05-20
Filing date: 2013-05-20
Publication date: 2013-07-24

Abstract

The invention relates to a molecular detection kit and detection method of chickpea ascochyta leaf blight fungi. The kit comprises a solution A (a PCR (Polymerase Chain Reaction) solution) and a solution B (positive control), wherein the solution A contains dye-containing 2*Taq PCR masterMix, an upstream primer 7-5f (20mu m), a downstream primer 7-5r (20mu m) and ultrapure water; and the solution B is a standard stream DNA (deoxyribonucleic acid) of chickpea ascochyta leaf blight fungi; and a method for which specific amplification products with fragment length of 440bp can be specifically amplified respectively from ascochyta rabiei DNA, diseased plant debris of chickpea ascochyta leaf blight, diseased soil and diseased seeds by using the kit is used for detecting. The kit disclosed by the invention can be used for rapidly, sensitively and specifically detecting plant tissues, soil and seeds infected by ascochyta rabiei in the production practice and simultaneously used for early monitoring of diseases in the field as well as high-sensitivity rapid molecular detection and identification of ascochyta rabiei carried by chickpeas imported and exported in customs.

Description

Garbanzo shell two spore leaf blight fungal molecule detection kit and detection methods

Technical field

The invention belongs to the field of corps diseases detection, evaluation and Prevention Technique, more specifically relate to a kind of garbanzo shell two spore leaf blight fungal molecule detection kit and detection methods.

Background technology

Garbanzo shell two spore leaf blights are caused by garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei, are a kind of destructive diseases.1911, garbanzo shell two spore leaf blights were found first that in Pakistan the hazardness of this disease is very high, and in important growing area Pakistan of garbanzo, year injured area is up to 25-50%.The weather that cools is fit to the disease development very much, often causes 100% production loss.2007, the garbanzo master of this disease in the north, Xinjiang planted ground such as Mu Lei county, state, Changji, district, Qitai County and breaks out, and is 4000hm at Mu Lei county onset area only wherein ², the strain rate 46% that on average causes harm, the piece strain rate that causes harm in serious field reaches 100%, and the production loss rate is 40%-50%.This disease main harm blade, petiole, cane also can infect the tender pod of children.The killed back of blade by leaf margin to internal diffusion, it is light brown to the Vandyke brown scab to form " U " shape or " V " shape, produce the tiny stain of dispersive when moist on the scab, petiole and the cane initial stage of being injured produces the water soaking mode scab, scab gradually becomes Vandyke brown subsequently, the scab place depression and the withered disconnected branch of fallen leaves that causes of wilting gradually, whole strain withered death when serious.The beanpod initial stage of being injured produces the water soaking mode scab, becomes the Vandyke brown scab then, and beanpod is withered when serious.In the rainwater time on the high side, morbidity is serious, and production loss is very big.Therefore, carry out garbanzo shell two spore leaf spoting bacterias and detect, prevent that it from propagating from the region of disease to region of disease not, and carry out diagnostic detection at its their early stage, significant to the propagation of garbanzo shell two spore leaf blights with control.

Since finding garbanzo shell two spore leaf blights, the various countries researchist just studies its detection technique.Traditional detection method is from invalid body or seed separating thallus in spite of illness, and it is seeded on the corresponding substratum, cultivates a couple of days in optimal temperature, the form of these thalline is observed again.Then continue to observe conidial morphological specificity if produce spore, choose the sheet microscopy, observe forms such as mycelia, conidium, conidiophore from bacterium colony.Thereby determine whether to exist garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei, perhaps with the naked eye and by microscopy disease symptom is judged the disease that whether causes by garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei.Traditional detection method is complex operation, time-consuming not only, and requires to have the expertise of height, and more most important is that it can not satisfy and formulates the pass in and out demand of rapid detection and evaluation of best control period and customs in the disease control.

Though biochip technology can be carried out the evaluation of multiple fungi simultaneously, the cost height has restricted its development; Hybridization mode inherent limitation has influenced its specificity; Mass-spectrometric technique with its fast and accurately advantage be used to microorganism identification must be to cultivate the back to divide pure mono-clonal bacterium colony because mass spectrum is identified, and apparatus expensive, therefore the operation easier height, has limited its application.

Development along with biology techniques, sequential analysis based on length polymorphism and the sequence polymorphism of rDNA-ITS, be used for reacting biological sibship and classification situation owing to obtain enough relatively information in can never oversize nucleotide sequence, thereby become the focus of classification of fungi and identification research, be widely used at present between the genus kind of fungi and kind in the Phylogenetic Studies of cohort level.Conserved sequence on the fungi rDNA (rDNA) is extensive, and the regional sequence of different evolution levels is arranged, and the classification of fungi that can be used for different grades is identified.Internal transcribed spacer district ITS on the rDNA is present in 18S rDNA, 5.8S the zone between rDNA and the 28S rDNA, this zone is subjected to the influence of external environment factor little, compare with the coding region and to have the fast characteristics of rate of evolution, high conservative between the different strains in planting, change greatly and between the fungi kind, exist, show great sequence polymorphism, can provide prolific hereditary information for mycologic research.Therefore, the application round pcr is more and more to the successful example that pathogenic bacteria carries out special, sensitive rapid molecular detection.There is the scholar to utilize both at home and abroad and conducts a research based on the Molecular Detection of ITS base sequence design primer to fungi, but still few at the research of Ascochyta rabiei.Therefore will carry out high specific to garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei and detect, the system and the test kit that design high special primer and set up a kind of rapid detection from pathogenic bacteria ITS base sequence are very important.

Summary of the invention

The objective of the invention is problems such as long at the required cycle of biological detection method of garbanzo shell two spore leaf spoting bacterias in the prior art, that accuracy is low, a kind of garbanzo shell two spore leaf blight fungal molecule detection kit and detection methods are provided, and this test kit comprises A liquid (PCR reaction solution): 2 * Taq PCR MasterMix, the upstream primer 7-5f (20 μ M), downstream primer 7-5r (20 μ M), the ultrapure water that contain dyestuff; B liquid (positive control) is garbanzo shell two spore leaf blight fungi type strain DNA.Employing utilizes this test kit at garbanzo shell two spore leaf blight pathogenic fungi DNA, garbanzo shell two spore leaf blight invalid bodies, soil and all can amplify fragment length in spite of illness in the seed specifically and detect for the method for the specific amplified product of 440bp in spite of illness.Test kit of the present invention is used for production practice by quick, sensitive, the special detection of plant tissue, soil and the seed of garbanzo shell two spore leaf blight pathogenic bacterial infections, the early monitoring that is used for the field disease simultaneously also can be customs and imports and exports highly sensitive rapid molecular detection of the entrained garbanzo shell two spore leaf spoting bacterias of garbanzo and evaluation.Utilize garbanzo shell two spore leaf blight fungal molecule detection kit to detect its reliable results, easy handling, high specificity, highly sensitive.This test kit also can be used for germ-carrying plant tissue, the highly sensitive rapid molecular of carry disease germs soil and infected seed detects, and determines that the disease control best period has crucial meaning.

The detection kit of a kind of garbanzo shell two spore leaf blight pathogenic bacterias of the present invention, this test kit is: A liquid PCR reaction solution and B liquid positive control are formed; Wherein

A liquid is by the 2 * Taq PCR MasterMix that contains dyestuff for the PCR reaction solution, upstream primer 7-5f20 μ M), downstream primer 7-5r20 μ M, ultrapure water weight concentration 〉=99% is formed;

The positive contrast of B liquid: garbanzo shell two spore leaf blight pathogenic bacteria type strain DNA, DNA concentration is 100ng/ μ L.

Upstream primer in the described test kit in the A liquid is 7-5f25bp:5 '-CCCGCTACCTCTTACCCATGTCTTT-3 ', and downstream primer is 7-5r23bp:5 '-GTCGTTATGAGTGCAAAGCGCGA-3 '.

Contain in the A liquid in the described test kit among 2 * Taq PCR MasterMix of dyestuff and comprise Taq archaeal dna polymerase 0.05units/ μ L, magnesium chloride 4mM, picodna triphosphoric acid matrix 0.4mM, wherein picodna triphosphoric acid matrix is by dATP, dCTP, dGTP, four kinds of thymus nucleic acids of dTTP are formed, available from Beijing Zhuan Meng biological gene Science and Technology Ltd., article No. is ZT201-02, LOT#1BH09N.

The detection method of the detection kit of described garbanzo shell two spore leaf blight pathogenic bacterias follows these steps to carry out:

The DNA extraction of a, sample to be checked or fungi adopts conventional fungal DNA extracting method;

B, get step a gained dna profiling 1 μ L, A liquid 24 μ L carry out the PCR reaction, PCR reaction conditions: 94 ℃ of pre-sex change 5min of temperature, 94 ℃ of temperature, sex change 50s, 57.5 ℃ of temperature, annealing 50s, 72 extend 2min, totally 30 each circulation, 72 ℃ of final temps, 10min, 4 ℃ of preservations of temperature;

C, amplified production is detected in 1% agarose gel electrophoresis.

At the PCR primer of special detection garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei, i.e. the sequence of special molecular detection primer is among the present invention:

Upstream primer 7-5f (25bp): 5 '-CCCGCTACCTCTTACCCATGTCTTT-3 '

Downstream primer 7-5r (23bp): 5 '-GTCGTTATGAGTGCAAAGCGCGA-3 ';

This primer is by downloading other ITS sequence that belongs to together that GenBank openly reports Ascochyta rabiei, accession number is respectively AY152550, DQ822479, DQ822480, EU167600, FJ032643, HQ700312, JF714463, utilize DNAMAN software to compare (Fig. 1) its ITS sequence, selected distinctive one section conserved sequence, the i.e. 1-440bp of ITS sequence with the garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei that record, and to utilize a pair of special primer at garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei of primer5.0 software design according to it be that special molecular detects primer 7-5f/7-5r, and primer sequence is:

Upstream primer 7-5f (25bp): 5 '-CCCGCTACCTCTTACCCATGTCTTT-3 '

Downstream primer 7-5r (23bp): 5 '-GTCGTTATGAGTGCAAAGCGCGA-3 '

The sequence alignment result:

AY152550 .....ATCATTACCTAGAGTTTGTGGGCTTTGCCCGCTAC 35

DQ822479 ....g----------------------------------- 36

DQ822480 ....g----------------------------------- 36

EU167600 gaagg----------------------------------- 1720

FJ032643 gaagg----------------------------------- 58

HQ700312 gaagg-------------------------------t--- 59

JF714463 .......ggggct----c-g-a------------------ 33

ITS ................................-------- 8

AY152550 CTCTTACCCATGTCTTTTGAGTACTTACGTTTCCTCGGCG 75

DQ822479 ---------------------------------------- 76

DQ822480 ---------------------------------------- 76

EU167600 ---------------------------------------- 1760

FJ032643 ---------------------------------------- 98

HQ700312 ---------------------------------------- 99

JF714463 ---------------------------------------- 73

ITS ---------------------------------------- 48

AY152550 GGTCCGCCCGCCGATTGGACAAAATCAAACCCTTTGCAGT 115

DQ822479 ---------------------------------------- 116

DQ822480 ---------------------------------------- 116

EU167600 ---------------------------------------- 1800

FJ032643 ---------------------------------------- 138

HQ700312 ---------------------------------------- 139

JF714463 ---------------------------------------- 113

ITS ---------------------------------------- 88

AY152550 TGCAATCAGCGTCTGAAAAACATAATAGTTACAACTTTCA 155

DQ822479 ---------------------------------------- 156

DQ822480 ---------------------------------------- 156

EU167600 ---------------------------------------- 1840

FJ032643 ---------------------------------------- 178

HQ700312 ----g----------------------------------- 179

JF714463 ---------------------------------------- 153

ITS ---------------------------------------- 128

AY152550 ACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAG 195

DQ822479 ---------------------------------------- 196

DQ822480 ---------------------------------------- 196

EU167600 ---------------------------------------- 1880

FJ032643 ---------------------------------------- 218

HQ700312 ---------------------------------------- 219

JF714463 ---------------------------------------- 193

ITS ---------------------------------------- 168

AY152550 CGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAA 235

DQ822479 ---------------------------------------- 236

DQ822480 ---------------------------------------- 236

EU167600 ---------------------------------------- 1920

FJ032643 ---------------------------------------- 258

HQ700312 ---------------------------------------- 259

JF714463 ---------------------------------------- 233

ITS ---------------------------------------- 208

AY152550 TCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTC 275

DQ822479 ---------------------------------------- 276

DQ822480 ---------------------------------------- 276

EU167600 ---------------------------------------- 1960

FJ032643 ---------------------------------------- 298

HQ700312 ---------------------------------------- 299

JF714463 ---------------------------------------- 273

ITS ---------------------------------------- 248

AY152550 CATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAG 315

DQ822479 ---------------------------------------- 316

DQ822480 ---------------------------------------- 316

EU167600 ---------------------------------------- 2000

FJ032643 ---------------------------------------- 338

HQ700312 ---------------------------------------- 339

JF714463 ---------------------------------------- 313

ITS ---------------------------------------- 288

AY152550 CTTTGCTTGGTGTTGGGTGTTTGTCTCGCCTCTGCGTGTA 355

DQ822479 ---------------------------------------- 356

DQ822480 ---------------------------------------- 356

EU167600 ---------------------------------------- 2040

FJ032643 ---------------------------------------- 378

HQ700312 ---------------------------------------- 379

JF714463 ---------------------------------------- 353

ITS ---------------------------------------- 328

AY152550 GACTCCCCCTTAAAACAATTGGCAGCCGGCGTATTGATTT 395

DQ822479 -----g--.------------------------------- 395

DQ822480 -----g--.------------------------------- 395

EU167600 -----g--.------------------------------- 2079

FJ032643 -----g--.------------------------------- 417

HQ700312 -----g--.------------------------------- 418

JF714463 -----g--.------------------------------- 392

ITS -----g--.------------------------------- 367

AY152550 CGGAGCGCAGTACATCTCGCGCTTTGCACTCATAACGACG 435

DQ822479 ---------------------------------------- 435

DQ822480 ---------------------------------------- 435

EU167600 ---------------------------------------- 2119

FJ032643 ---------------------------------------- 457

HQ700312 ---------------------------------------- 458

JF714463 ---------------------------------------- 432

ITS ---------------------------------------- 407

AY152550 ACGTCCAAAAGTACATTTTTACACTCTTGACC........ 467

DQ822479 --------------------------------........ 467

DQ822480 --------------------------------........ 467

EU167600 --------------------------------tcggatca 2159

FJ032643 --------------------------------tcggatca 497

HQ700312 --------------------------------tcggatca 498

JF714463 --------------------------------tcggatca 472

ITS --------------------------------t....... 440

The rapid molecular detection kit of these garbanzo shell two spore leaf spoting bacteria molecular detection primers comprises:

The pipe number	Component	Concentration
			A liquid (PCR reaction solution)	Ultrapure water (ddH ₂O)	〉=99% (weight concentration)
	Taq PCR MasterMix (containing dyestuff)	2×
				Upstream primer 7-5f	20μM
	Downstream primer 7-5r	20μM
			B liquid (positive control)	Ascochyta rabeie type strain DNA	100ng/μL

Garbanzo shell two spore leaf blight fungal molecule detection kit and detection methods of the present invention, this method comprises the following steps:

Optimize each parameter of PCR reaction system:

Auele Specific Primer according to the detection garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei that design carries out the regular-PCR detection, the PCR reaction system is 15 μ L, comprise the 2 * Taq PCR MasterMix7.5 μ L that contains dyestuff, each 0.5 μ L of primer 7-5f/7-5r (20 μ M), dna profiling 2 μ L, ultrapure water (ddH ₂O) complement to 15 μ L; The PCR reaction conditions: 94 ℃ of pre-sex change 5min of temperature, 94 ℃ of sex change 50s of temperature, 57.5 ℃ of annealing of temperature 50s, 72 extend 2min, totally 31 each circulation, 72 ℃ of 10min of final temp, 4 ℃ of preservations of temperature; Respectively parameters such as annealing temperature, primer concentration, reaction cycle number of times and system in the PCR reaction are optimized; Annealing temperature is provided with 12 gradients, is respectively 48 ℃, and 48.4 ℃, 49.4 ℃, 50.8 ℃, 52.5 ℃, 54.1 ℃, 55.9 ℃, 57.5 ℃, 59.2 ℃, 60.6 ℃, 61.6 ℃, 62 ℃; Primer concentration is provided with 10 gradients, is respectively 0.04 μ M, 0.08 μ M, 0.12 μ M, 0.16 μ M, 0.20 μ M, 0.40 μ M, 0.60 μ M, 0.80 μ M, 1.00 μ M, 1.20 μ M; The reaction cycle number of times is provided with 5 gradients, is respectively: 30 times, and 35 times, 40 times, 45 times, 50 times; System optimization is provided with 3 gradients, is respectively: 15 μ L, and 25 μ L, 50 μ L finally select the PCR reaction system of a kind of timing-saving and economic aborning, output height and high specificity;

The test kit specific detection:

Get miliary damping-off (Rhizoctonia solani), chain lattice spore (Alternaria alternata), mould (Penicillium), aspergillus (Aspergillus), Nectria (Nectria), Chaetomium (Chaetomium), give birth to neocosmospora (Bionectria), Fusarium (Fusarium), 8 kinds of each 1 μ L of check sample effective dna are template, utilize special primer 7-5f/7-5r that it is carried out the pcr amplification of test kit; The PCR reaction system comprises the A liquid of 14 μ L, 1 μ L template DNA; Amplification condition: 94 ℃ of pre-sex change 4min of temperature, 94 ℃ of sex change 1min of temperature, 57.5 ℃ of annealing of temperature 30s, temperature is extended 30s, totally 30 circulations for 72 ℃; 72 ℃ of 10min of temperature, 4 ℃ of preservations of temperature, product is in 1% agarose gel analysis;

Test kit sensitivity detects:

Garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei DNA concentration successively with the dilution of 10 multiple proportions example, are taken out 1 μ L and detected with the PCR test kit as template from each gradient, product carries out electrophoretic analysis in 1.0% sepharose;

The test kit Detection of Stability:

With test kit by temperature-20 ℃ taking-up, melting to room temperature is liquid, cooling temperature is to-20 ℃ again, so behind the multigelation 10 times, 20 times, 30 times, 40 times, 50 times garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei templates are carried out pcr amplification, product carries out electrophoretic analysis in 1.0% sepharose;

The test kit preservation period detects:

To every 1 month known positive be detected at the test kit of temperature-20 ℃ preservation, choose optimal concentration assembling test kit, and selected optimal reaction system and program.

Garbanzo shell two spore leaf blight fungal molecule detection kit and detection methods of the present invention, gordian technique are the optimization of determining of best PCR reaction system and every reaction parameter; Detection method of the present invention is applicable to the fast and reliable detection and the evaluation of garbanzo shell two spore leaf spoting bacterias in plant tissue, soil or the seed sample, detects and identifies and have important use value for the disease control that is caused by garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei in the agriculture production and the customs entrained garbanzo shell two spore leaf spoting bacteria highly sensitive rapid moleculars of garbanzo of passing in and out.

Garbanzo shell two spore leaf blight fungal molecule detection kit of the present invention and detection method compared with prior art have following technical superiority and positively effect:

(1) high specificity: detection method of the present invention is to utilize the regular-PCR method, optimize every reaction parameter, the assembling test kit carries out special detection to garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei, the result shows: the purpose band that it is 440bp that a size can appear in the sample that only contains garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei, other all do not have band to control strain or the sample that do not have garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei and occur, and illustrate that test kit can carry out special to garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei;

(2) highly sensitive: different concns template amount all can obtain the 440bp specific amplification products, and the amplified production amount increases with the increase of template amount, and the low energy of test kit detects 5.86 * 10 ^-3The DNA of ng/ μ L;

(3) practicality is good: the present invention can be used for detecting with the highly sensitive rapid molecular of plant tissue, soil or the seed of garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei, therefore practical, can satisfy the needs that exist garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei to carry out rapid and reliable detection and evaluation to the plant tissue of carrying disease germs, soil and seed kind;

(4) easy and simple to handle fast: use this test kit and can directly add testing sample DNA and carry out regular-PCR and detect, need not complicated application of sample process, do not need the specific molecule technology, saved the application of sample time greatly, reduce contamination of heavy, improved result's accuracy.

Description of drawings:

Fig. 1 is the annealing temperature optimization figure of test kit of the present invention, and wherein: swimming lane M is that molecular weight is the marker of 2000bp, and swimming lane 1-12 is a thermograde, be followed successively by: 48 ℃ of temperature, 48.4 ℃, 49.4 ℃, 50.8 ℃, 52.5 ℃, 54.1 ℃, 55.9 ℃, 57.5 ℃, 59.2 ℃, 60.6 ℃, 61.6 ℃, 62 ℃;

Fig. 2 is the primer concentration optimization figure of test kit of the present invention, and wherein: swimming lane M is that molecular weight is the marker of 2000bp, and swimming lane 1-10 is the primer concentration gradient, is followed successively by: 0.04 μ M, 0.08 μ M, 0.12 μ M, 0.16 μ M, 0.2 μ M, 0.4 μ M, 0.6 μ M, 0.8 μ M, 1.0 μ M, 1.2 μ M;

Fig. 3 is test kit cycle index optimization figure of the present invention, and wherein: swimming lane M is that molecular weight is the marker of 2000bp, and swimming lane 1-5 is the cycle index gradient, is followed successively by: 30 times, and 35 times, 40 times, 45 times, 50 times;

Fig. 4 is the best system optimization figure of test kit of the present invention, and wherein: swimming lane M is that molecular weight is the marker of 2000bp, and swimming lane 1-5 is the reaction system gradient, is followed successively by: 15 μ L, 25 μ L, 50 μ L;

The specific PCR amplification figure of the garbanzo shell two spore leaf blight pathogenic bacterias that Fig. 5 will detect for the present invention, wherein: swimming lane M is that molecular weight is the marker of 2000bp, swimming lane 1-9 is followed successively by garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabeie, dry thread Pyrenomycetes (Rhizoctonia solani), chain lattice spore (Alternaria alternata), mould (Penicillium sp.), aspergillus (Aspergillus sp.), gibberella belongs to (Nectria sp.), Chaetomium (Chaetomium sp.), give birth to neocosmospora (Bionectria sp.), Fusarium (Fusarium sp.);

Fig. 6 detects amplification figure for the susceptibility of the garbanzo shell two spore leaf blight pathogenic bacterias that the present invention detects, and wherein: swimming lane M is that molecular weight is the marker of 2000bp, and swimming lane 1-9 is the DNA concentration gradient, is followed successively by 1.31 * 10ng/ μ L, 1.31 * 10 ⁰Ng/ μ L, 1.31 * 10 ^-1Ng/ μ L, 1.31 * 10 ^-2Ng/ μ L, 1.31 * 10 ^-3Ng/ μ L, 1.31 * 10 ^-4Ng/ μ L, 1.31 * 10 ^-5Ng/ μ L, 1.31 * 10 ^-6Ng/ μ L, negative control;

Fig. 7 is the detected result figure of the present invention to garbanzo shell two spore invalid bodies, infected seed and the soil that carries disease germs, wherein: swimming lane M is that molecular weight is the marker of 2000bp, swimming lane 1-6 is respectively invalid body DNA, seed DNA in spite of illness, seed DNA in spite of illness not, native in spite of illness DNA, not native in spite of illness DNA, negative control;

Fig. 8 is the Detection of Stability of test kit of the present invention figure as a result, and wherein: swimming lane M is that molecular weight is the marker of 2000bp, and swimming lane 1-5 is a test kit multigelation number of times, is respectively 10 times, 20 times, 30 times, 40 times, 50 times;

Fig. 9 is test kit quality guaranteed period detected result figure of the present invention, wherein be depicted as this test kit and the garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei dna profilings of different concns carried out the PCR detected result after preserving 6 months in-20 ℃, among the figure: swimming lane M is that molecular weight is the marker of 2000bp, swimming lane 1-4 is the DNA concentration gradient, be followed successively by: 5.86 * 10ng/ μ l, 5.86 * 10 ⁰Ng/ μ l, 5.86 * 10 ^-1Ng/ μ l, 5.86 * 10 ^-2Ng/ μ l.

Embodiment

According to embodiment, the present invention may be better understood;

The specific detection of embodiment 1 test kit

Make test kit: this test kit is: A liquid PCR reaction solution and B liquid positive control are formed;

A liquid is by the 2 * Taq PCR MasterMix that contains dyestuff for the PCR reaction solution, upstream primer 7-5f20 (μ M), downstream primer 7-5r20 (μ M), ultrapure water (weight concentration 〉=99%) is formed, wherein, contain among 2 * Taq PCR MasterMix of dyestuff and comprise Taq archaeal dna polymerase (recombinant) 0.05units/ μ L, magnesium chloride (MgCl2) 4mM, picodna triphosphoric acid matrix (dNTPs) (dATP, dCTP, dGTP, dTTP) 0.4mM, available from Beijing Zhuan Meng biological gene Science and Technology Ltd., article No. is ZT201-02, LOT#1BH09N; Wherein

Upstream primer 7-5f (25bp): 5 '-CCCGCTACCTCTTACCCATGTCTTT-3 ',

Downstream primer 7-5r (23bp): 5 '-GTCGTTATGAGTGCAAAGCGCGA-3 ';

B liquid (positive control): garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabeie type strain DNA, wherein DN concentration is 100ng/ μ L;

PCR detects:

Pcr amplification reaction system 15 μ L comprise the A liquid of 14 μ L, 1 μ L template DNA, PCR reaction conditions: 94 ℃ of pre-sex change 5min of temperature, 94 ℃ of sex change 50s of temperature, 57.5 ℃ of annealing of temperature 50s, 72 extend 2min, totally 30 circulations, 72 ℃ of 10min of final temp, 4 ℃ of preservations of temperature;

Detected result:

The specificity that detects: except the DNA of garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabeie can amplify the product of 440bp specifically, 8 bacterial strain DNA such as other dry thread Pyrenomycetes, chain lattice spore, mould, aspergillus have been detected, all fail to amplify spawn, have very strong specificity.

Embodiment 2: test kit increases to the susceptibility of garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabeie:

The susceptibility of garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabeie detects:

Detected result:

With test kit the template DNA template of 8 different concns of garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei being carried out PCR detects, the result shows, the different templates amount all can obtain the 440bp specific amplification products, and the amplified production amount increases with the increase of template amount, can detect 5.86 * 10 ^-3The DNA of ng/ μ L.

Embodiment 3: the specific detection of garbanzo shell two spore leaf blight invalid bodies, the soil that carries disease germs, infected seed:

Regular-PCR detects:

Garbanzo shell two spore leaf blight invalid bodies, the soil that carries disease germs, infected seed all adopt the CTAB method to extract DNA, utilize test kit to carry out pcr amplification, pcr amplification reaction system 15 μ L, the A liquid that comprises 14 μ L, 1 μ L template DNA, PCR reaction conditions: 94 ℃ of pre-sex change 5min of temperature, 94 ℃ of sex change 50s of temperature, 57.5 ℃ of annealing of temperature 50s, 72 extend 2min, totally 30 circulations, 72 ℃ of 10min of final temp, 4 ℃ of preservations of temperature, the electrophoresis detection amplified production;

Detected result:

The result has only sample amplification in spite of illness to obtain the PCR product of a segment length 440bp, control sample does not then have this amplified production, the BLAST comparison of PCR product order-checking back, determine it is garbanzo shell two spore leaf blight pathogenic bacteria Ascochyta rabiei, show that this test kit can plant and soil carry out specific detection in spite of illness to garbanzo shell two spore leaf blights.

Embodiment 4: the optimization of test kit reaction conditions:

Each parameter optimization:

Respectively parameters such as annealing temperature, primer concentration, reaction cycle number of times and system in the PCR reaction are optimized, annealing temperature is provided with 12 gradients, and temperature is respectively: 48 ℃, 48.4 ℃, 49.4 ℃, 50.8 ℃, 52.5 ℃, 54.1 ℃, 55.9 ℃, 57.5 ℃, 59.2 ℃, 60.6 ℃, 61.6 ℃, 62 ℃; Primer concentration is provided with 10 gradients, is respectively: 0.04 μ M, 0.08 μ M, 0.12 μ M, 0.16 μ M, 0.20 μ M, 0.40 μ M, 0.60 μ M, 0.80 μ M, 1.00 μ M, 1.20 μ M; The reaction cycle number of times is provided with 5 gradients, is respectively: 30 times, and 35 times, 40 times, 45 times, 50 times; System optimization is provided with 3 gradients, is respectively: 15 μ L, 25 μ L, 50 μ L; The final PCR reaction system of selecting a kind of timing-saving and economic aborning, output height and high specificity;

Optimum result:

Annealing temperature is established 12 gradients altogether, and the result all can amplify band limpid in sight, and difference is not obvious, 57.5 ℃ of the final selected temperature close with the primer parameter;

Primer concentration is established 10 gradients altogether, and along with the increase of primer concentration, primer dimer also produces thereupon, and the finally selected best primer concentration of effect is 0.08 μ M;

Cycle index is set 5 gradients, found that cycle index there is no too big influence to PCR result, so select 30 times minimum circulations of cycle index;

System optimization is divided into 15 μ L, 25 μ L, and 50 μ L are totally 3 gradients, and the system variation there is no influence too greatly to PCR result, the therefore final minimum volume 15 μ L that select.

Claims

1. the detection kit of garbanzo shell two spore leaf blight pathogenic bacterias is characterized in that this test kit is: A liquid PCR reaction solution and B liquid positive control composition; Wherein

A liquid is the PCR reaction solution, by the 2 * Taq PCR MasterMix that contains dyestuff, and upstream primer 7-5f20 μ M, downstream primer 7-5r20 μ M, ultrapure water weight concentration 〉=99% is formed;

2. test kit according to claim 1 is characterized in that the upstream primer in the A liquid is 7-5f25bp:5 '-CCCGCTACCTCTTACCCATGTCTTT-3 ', and downstream primer is 7-5r23bp:5 '-GTCGTTATGAGTGCAAAGCGCGA-3 '.

3. test kit according to claim 1, it is characterized in that containing in the A liquid among 2 * Taq PCR MasterMix of dyestuff and comprise Taq archaeal dna polymerase 0.05units/ μ L, magnesium chloride 4mM, picodna triphosphoric acid matrix 0.4mM, wherein picodna triphosphoric acid matrix is by dATP, dCTP, dGTP, four kinds of thymus nucleic acids of dTTP are formed, available from Beijing Zhuan Meng biological gene Science and Technology Ltd., article No. is ZT201-02, LOT#1BH09N.

4. the detection method of the detection kit of garbanzo shell two spore leaf blight pathogenic bacterias according to claim 1 is characterized in that following these steps to carrying out:

C, amplified production is detected in 1% agarose gel electrophoresis.