CN103215193A - Tannase high-producing strain and preparation method thereof - Google Patents

Tannase high-producing strain and preparation method thereof Download PDF

Info

Publication number
CN103215193A
CN103215193A CN2013101538572A CN201310153857A CN103215193A CN 103215193 A CN103215193 A CN 103215193A CN 2013101538572 A CN2013101538572 A CN 2013101538572A CN 201310153857 A CN201310153857 A CN 201310153857A CN 103215193 A CN103215193 A CN 103215193A
Authority
CN
China
Prior art keywords
tannase
strain
preparation
solution
liquid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN2013101538572A
Other languages
Chinese (zh)
Inventor
曹庸
张帅
林健辉
农嘉仪
朱华伟
Original Assignee
曹庸
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 曹庸 filed Critical 曹庸
Priority to CN2013101538572A priority Critical patent/CN103215193A/en
Publication of CN103215193A publication Critical patent/CN103215193A/en
Priority to CN201410121620.0A priority patent/CN104263650A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/145—Fungal isolates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/66—Aspergillus
    • C12R2001/685—Aspergillus niger
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/18—Carboxylic ester hydrolases (3.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/01—Carboxylic ester hydrolases (3.1.1)
    • C12Y301/0102—Tannase (3.1.1.20)

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention provides a tannase high-producing strain and a preparation method thereof. The preparation method comprises the following steps of: taking decayed gallnuts in nature as raw material, screening microorganisms in the decayed gallnuts in a culture medium with gallotannic acid as the only carbon source to obtain a strain T3 which is high in tannase production activity, performing 60 Co gamma ray irradiation induced mutation on the strain, and finally obtaining a strain having a number of T3-5-1 through flat-plate primary screening and shake flask fermentation re-screening, wherein the tannase production activity of the strain is increased by 122.12% in contrast with that of the strain T3. Through strain identification, the strain T3-5-1 is aspergilluseniger and the conservation number of the strain T3-5-1 is CGMCC No. 7423. The strain provided by the invention is capable of producing tanase under optimal cultivation condition; the specific activity of the strain reaches up to 5304.53 U/mg after the strain is separated and purified, which is far higher than the specific activity of 1788.15 U/mg of the tannase produced by American Sigma.

Description

A kind of tannase superior strain and preparation method thereof
 
Technical field
The present invention relates to microbial technology field, be specifically related to microbe to screen, mutagenic and breeding, strain identification and enzymatic production association area, a kind of tannase superior strain and preparation method thereof particularly is provided.
Background technology
Tannase (Tannase; E.C. 3.1.1.20); full name tannin Acyl-hydrolase (Tannin Acyl Hydrolase); it is a kind of inducible enzyme that extensively is present in microorganism and the plant; especially in filamentous fungus; can produce in a large number during with Weibull, Turkey-galls etc., belong to the cytolemma desmoenzyme, can be secreted into outside the born of the same parents as inductor.But the ester bond in the tannase specificity hydrolysis-type tannin and the phenol carboxylic key that contracts generate materials such as gallic acid, glucose and corresponding alcohols.
Tannase has been applied to a plurality of fields such as beverage, wine brewing, food, medicine, chemical industry, process hides and makeup at present, especially is widely used at preparation gallic acid, Tenox PG and aspects such as processing tea juice " cream down " and beer precipitation.But tannase production efficiency is not high at present, and market value is very expensive, and this has hindered the further application of tannase.
Learn that through document Investigation the main method of producing tannase at present is still by the microbial fermentation preparation, it is more especially fermentation using bacterias such as the fungi of Aspergillus, Penicillium, Rhizopus and Bacterium lacticum to be produced the report of tannase.But it is not high to exist the big voluminous enzyme of these microorganisms at present, especially domestic to problems such as tannase superior strain shortage independent intellectual property rights.
Summary of the invention
The present invention seeks to problem, a kind of tannase superior strain and production method thereof are provided, thereby improve the tannase fermentation yield, solve the not high problem of current tannase production efficiency at above existence.
The strain tannase superior strain called after T3-5-1 that the present invention filters out, through strain identification be aspergillus niger ( Aspergilluse niger), preserving number is CGMCC No.7423, the preservation time: on April 7th, 2013, depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC).
The preparation method of bacterial strain of the present invention may further comprise the steps:
(1) the septic Turkey-galls of picking is mixed with 10 -1Solution, gradient dilution to 10 -10, each gradient is coated with dull and stereotyped 3 on screening culture medium, cultivate 48 h for 30 ℃, bacterium colony single bacterium colony big and that the hydrolysis circle is bigger is preserved in test tube PDA inclined-plane on the picking flat board, and described screening culture medium is formulated by following component: potassium primary phosphate 4.38g, ammonium sulfate 8.76g, sal epsom 0.88g, calcium chloride 0.088g, Manganous chloride tetrahydrate 0.018g, Sodium orthomolybdate 0.0088g, ferric sulfate 0.12g, agar 30g, Weibull 10g is with being settled to 1 L after the distilled water water dissolution;
(2) (1) w obtained strains is activated preparation 10 on the czapek's solution inclined-plane 6The spore suspension of individual/mL is inoculated l mL in 30 mL fermention mediums, 30 ℃, 120 r/min shaking culture, 72 h, extract tannase and survey its vigor, described fermention medium is formulated by following component: Weibull 20g, sucrose 10g, SODIUMNITRATE 3g, dipotassium hydrogen phosphate 1g, Repone K 0.5g, ferric sulfate 0.01g, sal epsom 0.5g is with being settled to 1 L behind the dissolved in distilled water;
(3) inoculation that primary dcreening operation is obtained is in the czapek's solution inclined-plane, cultivated 3-4 days for 30 ℃, after treating the spore maturation, spore is washed till in the triangular flask that granulated glass sphere is housed with 10mL physiological saline, 30 ℃ of shaking culture 1-2 h fully disperse spore, filter with absorbent cotton, get monospore suspension, get l mL monospore suspension and carry out gradient dilution and microscopy counting, adjust spore concentration to 10 6Individual/mL;
(4) in test tube, pack 10 into 6Individual/mL monospore suspension 3 mL, carry out 60The mutagenesis of Co gamma-ray irradiation, radiation dose are 400～600Gy;
(5) behind the irradiation, get 1 mL monospore suspension, with 10 times of dilution method dilutions, get 100 μ L and coat on the screening culture medium, be inverted for 30 ℃ and cultivate, after treating to grow bacterium colony in the culture dish, the inclined-plane is preserved, and described screening culture medium is identical with step (1) screening culture medium;
(6), on the czapek's solution inclined-plane, activate preparation 10 with the bacterial strain that filters out 6The spore suspension of individual/mL, inoculation l mL are in 50 mL fermention mediums, and 30 ℃, 120 r/min shaking culture, 72 h carry out tannase then and extract and enzyme activity determination.
In step (1) and the step (5), described screening culture medium is formulated by following component: potassium primary phosphate 4.38g, ammonium sulfate 8.76g, sal epsom 0.88g, calcium chloride 0.088g, Manganous chloride tetrahydrate 0.018g, Sodium orthomolybdate 0.0088g, ferric sulfate 0.12g, agar 30g, Weibull 10g is with being settled to 1 L after the distilled water water dissolution.
In step (2) and the step (6), described fermention medium is formulated by following component: Weibull 20g, sucrose 10g, SODIUMNITRATE 3g, dipotassium hydrogen phosphate 1g, Repone K 0.5g, ferric sulfate 0.01g, sal epsom 0.5g is with being settled to 1 L behind the dissolved in distilled water.
In step (2) and the step (6), described tannase extracts and the enzyme activity determination method, may further comprise the steps:
A, fermentation suspension obtain mycelium behind suction filtration, it is neutral that distilled water is washed till the pH value, precooling in refrigerator, with the 1:1:4 mixing by volume of mycelium, quartz sand, citrate buffer solution, grind pulping under ice bath, 0-4 ℃ of following centrifugal 30 min of 10000 r/min get supernatant liquor, be settled to 10 mL with citrate buffer solution, promptly get the tannase crude enzyme liquid.
Described citrate buffer solution compound method is: accurately take by weighing citric acid 21.01 g, add water and be settled to 1000 mL, as A liquid; Accurately take by weighing Trisodium Citrate 29.41g, be settled to 1000 mL, as B liquid, A liquid and B liquid are pressed the 1:2 mixed, the pH value to 5.0 of transferring mixed solution with A liquid and B liquid promptly gets citrate buffer solution again.
B, 1 control tube of preparation, 1 parallel mensuration pipe of blank pipe with 3, in every test tube, add earlier 1 mL tannase crude enzyme liquid, 45 ℃ of water-bath preheating 10 min, in measuring pipe, respectively add 1 mL Tenox PG solution then, in blank pipe, add 1 mL citrate buffer solution, in control tube, add 0.6 mL ethanol, react 20 min after, in measuring pipe and blank pipe, add 4 mL ethanol termination reactions respectively, in control tube, add 1 mL Tenox PG solution.After the question response liquid cooling but,, measure light absorption value under 270 nm with 9 times of citrate buffer solution dilutions.
The compound method of described Tenox PG solution is: accurately take by weighing 0.2122 g Tenox PG, be settled to 500 mL with citrate buffer solution.
C, prepare the Tenox PG solution of 20,40,60,80,100 μ mol/L respectively with citrate buffer solution, measure the light absorption value under its 270 nm, draw regression curve, according to the linear regression equation of this regression curve, control tube Tenox PG concentration should be 93.343A Right-1.6626, measuring pipe Tenox PG concentration then is 93.343A Survey-1.6626, calculate enzyme activity by following formula:
Figure 275799DEST_PATH_IMAGE001
。
Tannase vigor definition: 45 ℃ of temperature of reaction, under the condition of pH value 5.0, per hour hydrolysis reduces the needed enzyme amount of 0.01 μ mol substrate Tenox PG and is defined as an enzyme work unit (U).
What optimize is in the step (4), to carry out 60During the mutagenesis of Co gamma-ray irradiation, best radiation dose is 500Gy.
Bacterial strain of the present invention produces tannase under optimal culture conditions, it up to 5304.53 U/mg, produces tannin specific activity of enzyme 1788.15 U/mgs far above U.S. Sigma company than vigor after separation and purification.
Description of drawings
Fig. 1 is the Tenox PG typical curve.Ordinate zou is Tenox PG concentration (μ mol/L), and X-coordinate is light absorption value A.
Fig. 2 produces tannase vigor figure for each bacterial strain.Ordinate zou is enzyme activity (U/mL), and X-coordinate is a bacterial strain.
Fig. 3 is provided with figure for the PCR program.
Fig. 4 is a colonial morphology on the czapek's solution.
Fig. 5 is bacterial classification microscopic examination figure.
Fig. 6 is a PCR product electrophorogram.Annotate: swimming lane 1 is DL2000 marker, and swimming lane 2 is a pcr amplification product.
Fig. 7 is bacterial classification 18SrDNA sequencing result figure.
Fig. 8 is NCBI blast comparison result figure.
Fig. 9 is a phylogenetic tree.
Embodiment
One strain tannase superior strain, called after T3-5-1, through strain identification be aspergillus niger ( Aspergilluse niger), preserving number is CGMCC No.7423, the preservation time: on April 7th, 2013, depositary institution: China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC).
T3-5-1 tannase superior strain has the method screening preparation of following steps and gets:
1, produces the acquisition and the primary dcreening operation of tannase bacterial strain.Rotten Turkey-galls 10 g of picking add 90 mL sterilized waters, shake up, and are 10 -1Solution, gradient dilution to 10 -10, each gradient is coated with dull and stereotyped 3 on screening culture medium, cultivate 48 h for 30 ℃, and bacterium colony is preserved in test tube PDA inclined-plane than big and the bigger single bacterium colony of hydrolysis circle on the picking flat board.Wherein said screening culture medium consists of: potassium primary phosphate 4.38g, and ammonium sulfate 8.76g, sal epsom 0.88g, calcium chloride 0.088g, Manganous chloride tetrahydrate 0.018g, Sodium orthomolybdate 0.0088g, ferric sulfate 0.12g, agar 30g, Weibull 10g is settled to 1 L after the dissolving.
2, bacterial strain sieves again.With the primary dcreening operation bacterial strain, on the czapek's solution inclined-plane, activate preparation 10 6The spore suspension of individual/mL, inoculation l mL are in 30 mL fermention mediums, and 30 ℃, 120 r/min shaking culture, 72 h extract tannase and survey its vigor.Wherein said fermention medium consists of: Weibull 20g, and sucrose 10g, SODIUMNITRATE 3g, dipotassium hydrogen phosphate 1g, Repone K 0.5g, ferric sulfate 0.01g, sal epsom 0.5g is settled to 1 L after the dissolving.Wherein said tannase extracts and enzyme activity determination mainly may further comprise the steps:
2.1, crude enzyme liquid extracts.Fermentation suspension obtains mycelium behind suction filtration, it is neutral that distilled water is washed till the pH value, precooling in refrigerator.Mycelium, quartz sand, damping fluid are ground pulping in the 1:1:4 ratio under ice bath, 0-4 ℃ of following centrifugal 30 min of 10000 r/min.Get supernatant liquor, be settled to 10 mL, promptly get the tannase crude enzyme liquid with citrate buffer solution.Wherein said citrate buffer solution compound method is: accurately take by weighing citric acid 21.01 g, be settled to 1000 mL, as A liquid; Accurately take by weighing Trisodium Citrate 29.41g, be settled to 1000 mL, as B liquid.A liquid and B liquid are pressed the 1:2 mixed approximately, use this two kinds of solution adjust pHs to 5.0 again.
2.2, the tannase vitality test.Prepare 1 control tube, 1 parallel mensuration pipe of blank pipe with 3.In every test tube, add earlier 1 mL enzyme liquid, 45 ℃ of water-bath preheating 10 min, in measuring pipe, respectively add 1 mL Tenox PG solution then, in blank pipe, add 1 mL citrate buffer solution, in control tube, add 0.6 mL ethanol, behind accurate response 20 min, in measuring pipe and blank pipe, add 4 mL ethanol termination reactions respectively, in control tube, add 1 mL Tenox PG solution.After the question response liquid cooling but,, measure light absorption value under 270 nm with 9 times of citrate buffer solution dilutions.The compound method of wherein said Tenox PG solution is: accurately take by weighing 0.2122 g Tenox PG, be settled to 500 mL with citrate buffer solution.Tannase vigor definition: 45 ℃ of temperature of reaction, under the condition of pH value 5.0, per hour hydrolysis reduces the needed enzyme amount of 0.01 μ mol substrate Tenox PG and is defined as an enzyme work unit (U).
2.3, the tannase vigor calculates.Prepare the Tenox PG solution of 20,40,60,80,100 μ mol/L respectively with citrate buffer solution, measure the light absorption value under its 270 nm, draw regression curve, as shown in Figure 1.According to Fig. 1 cathetus regression equation, control tube Tenox PG concentration should be 93.343A Right-1.6626, measuring pipe Tenox PG concentration then is 93.343A Survey-1.6626.According to the enzyme activity definition, its calculation formula is as follows:
Figure 90171DEST_PATH_IMAGE002
3, mutagenic and breeding tannase superior strain.Mainly may further comprise the steps:
3.1 spore liquid preparation.To screen inoculation in the czapek's solution inclined-plane, cultivate 3-4 days for 30 ℃, treat the spore maturation after, spore is washed till in the triangular flask that granulated glass sphere is housed with an amount of physiological saline, 30 ℃ of shaking culture 1-2 h fully disperse spore.Filter with absorbent cotton, get monospore suspension.Get l mL monospore suspension and carry out gradient dilution and microscopy counting, adjust spore concentration to 10 6Individual/mL.
3.2 60The mutagenesis of Co gamma-ray irradiation.Get the test tube of 18 sterilizations, every pipe is respectively charged into freshly prepd 10 6Individual/mL monospore suspension 3 mL.Per 3 is 1 group, and being divided into is 6 groups.Radiation dose is respectively 0,100,300,500,700 and 900 Gy.
3.3 dull and stereotyped primary dcreening operation.Test tube behind the irradiation, every pipe is got 1 mL, suitably dilutes with 10 times of dilution methods, gets 100 μ L and coats on the screening culture medium, is inverted for 30 ℃ and cultivates.After treating to grow bacterium colony in the culture dish, enumeration.Every group of mean value with 3 ware colony numbers is organized colony number as this.Compare is calculated lethality rate simultaneously.Early become hepatic single bacterium colony in the picking flat board, the inclined-plane is preserved.
3.4 shake flask fermentation sieves again.With the superior strain that filters out, on the czapek's solution inclined-plane, activate preparation 10 6The spore suspension of individual/mL is inoculated l mL in 50 mL fermention mediums, and 30 ℃, 120 r/min shaking culture, 72 h.
3.5. tannase extracts and enzyme activity determination.The same b2 of method.
In the aforementioned production method, wherein 1 step is separated to qualified bacterial strain 20 strains altogether, is numbered T1-T20.
In the aforementioned production method, wherein the highest bacterial strain of product tannase vigor that is sieved to again of 2 steps is T3, as shown in Figure 2.
In the aforementioned production method, preferred 500 Gy of radiation dose in 3 steps wherein, through radioinduction, just be sieved to the qualified bacterial strain of 23 strains, through shake flask fermentation, it is the highest to be sieved to mutagenic strain T3-5-1 product enzyme activity again, reaches 47.69 U/mL, comparison has improved 122.12 % according to bacterial strain T3 (21.47 U/mL), and is as shown in table 1.
Each mutagenic strain enzymatic production vigor of table 1 relatively
Bacterial strain Enzyme activity (U/mL) Bacterial strain Enzyme activity (U/mL)
T3L1 43.40 T3-5-3 40.13
T3L2 28.56 T3-5-4 29.40
T3L3 35.00 T3-5-5 19.60
T3L4 33.69 T3-5-6 29.40
T3L5 25.20 T3-5-7 28.00
T3L6 29.40 T3-5-8 23.80
T3L7 19.76 T3-5-9 21.00
T3L8 26.60 T3-5-10 39.20
T3L9 33.60 T3-5-11 23.80
T3L10 28.00 T3-5-12 30.80
T3-5-1 47.69 T3-5-13 18.20
T3-5-2 30.49 T3 (contrast) 21.47
The present invention has carried out strain identification to the bacterial strain T3-5-1 that screens, and authentication method comprises:
Morphology is identified.Comprise:
(1) observation of colony characteristics: it is some to make the czapek's solution flat board, the mycelia of having cultivated with PDA with the transfering loop picking a little, its point is connected to flat board, be inverted in 30 ℃ of incubators and cultivate more than 48 h, observe bacterium colony forming process and form.
(2) observation of cellular form: water dip slide method film-making, drip the blue cotton liquid of a lactic acid phenylic acid in clean wave carrier piece central authorities, draw from colony edge with dissecting needle and to get mycelium one fritter, put into the blue cotton liquid of lactic acid phenylic acid, covered, the mycelia that microscopically is observed bacterial strain has or not tabula, podocyte, observes the shape size and living mode and sporophore thereof of spore, and in conjunction with " fungi identification handbook " (Wei Jing is superfine, 1979) analysis.
Molecular biology identification.Key step comprises:
(1) strain gene group DNA extracts.Main extraction step comprises:
1. the bacterial classification behind the purifying is inserted the strain identification substratum, cultivate about 50 mg of picking thalline behind 48 h, place the sterilization mortar, (fungi is extracted test kit to add solution A, 200 μ L down together), add 20 μ L RNase A again, add 100 mg granulated glass spherees again, vibration 20 min on the vortex oscillation device.
2. the Proteinase K that adds 20 μ L l0 mg/mL, abundant mixing, 55 ℃ of water-baths digest 30 min.Put upside down the centrifuge tube mixing between the period of digestion for several times, centrifugal 2 min of 12000 r/min are transferred to supernatant in the new centrifuge tube.
3. in supernatant liquor, add 200 μ L solution B, fully mixing.55 ℃ of water-bath 5 min add 200 μ L ethanol, and fully mixing all adds solution and flocks in the adsorption column, places 2 min.
4. the centrifugal l min of 12000 r/min abandons waste liquid, and adsorption column is put into collection tube.Add 700 μ L rinsing liquids in adsorption column, the centrifugal l min of l2000 r/min abandons waste liquid, and adsorption column is put into collection tube.
5. add 500 μ L rinsing liquids in adsorption column, the centrifugal l min of l2000 r/min abandons waste liquid, and adsorption column is put into collection tube, and centrifugal 2 min of l2000 r/min place room temperature to place 5 min adsorption column.
6. adsorption column is put into a clean centrifuge tube, to the elutriant of the unsettled dropping 100 μ L of adsorption film central authorities through 75 ℃ of water-bath preheatings, room temperature is placed 5 min, the centrifugal l min of l2000 r/min.
7. centrifugal gained elutriant adds in the adsorption column again, and room temperature is placed 2 min, and centrifugal 2 min of l2000 r/min promptly obtain genomic dna, carries out electrophoresis simultaneously and identifies.
(2) segmental amplification of bacterial strain 18SrDNA and evaluation.By preparing the pcr amplification system shown in the table 2, on the PCR instrument, increase then, amplification program is as shown in Figure 3.Main authentication step comprises:
Table 2 18SrDNA fragment PCR amplification system
Title Consumption Title Consumption
Template DNA
1 μL GCbuffer I (2×) 15 μL
* upstream primer NS1 (10 μ m/mL) 1 μL LA Taq(5U/μL) 0.5 μL
* downstream primer NS8 (10 μ m/mL) 1 μL DDH 2O Add to 30 μ L
Annotate: upstream primer NS1:GTAGTCATATGCTTGTCTC, downstream primer NS8:TCCGCAGGTTCACCTACGGA
1. amplification is finished after 1% agarose gel electrophoresis, and Gold view dyeing is observed under gel imaging system then and taken.
2. the PCR product is checked order, obtain splicing with softwares such as Bioedit behind the sequencing result.
3. analyze sequencing result, the bacterial strain ITS sequence that obtains is compared analysis with the Blast program among the GenBank and other bacterial strain in the database, draw similarity.Use software DNAMAN 6.4.0 to analyze and make up bacterial strain homology evolutionary relationship tree.
During above-mentioned morphology is identified, T3-5-1 activated on PDA 30 ℃ cultivate 96 h, bacterium colony is spherical in shape, diameter is 38.0 mm, having an even surface has nebenkern, in conjunction with closely, is the heavy fleece shape, the edge is white fine hair shape aerial hyphae, and there are radioactivity rill, slightly brown in the back side.In cultivating 24h, bacterium colony becomes white hypha, and behind 48 h, the bacterium colony surface produces the black spore, and the bacterium colony surface gradually becomes the black (see figure 4), and doubtful is aspergillus niger.
During above-mentioned morphology is identified; T3-5-1 is made up of mycelia, conidiophore and top capsule, and the top capsule is spherical in shape, and the conidial head brown-black is radial; be covered with one deck metulae on it; length has string shape conidium on the stigma, and spore is spherical in shape or subsphaeroidal, pediculated cells; conidiophore is vertically born by podocyte; the conidium metulae does not have tabula, smooth surface, and mycelia has every (see figure 5).With reference to " fungi identification handbook ", identify that this bacterial strain belongs to imperfect fungi (Fungi Imperfecti), from stalk embrace an order ( Moniliales), from stalk embrace a section ( Moniliaceae), aspergillus family ( Aspergilleae), Aspergillus ( Aspergillus Micheli ex Fr.).
In the above-mentioned molecular biology identification, strain gene group DNA extracts after electrophoresis is accredited as a bright band, does not have any assorted band and has (see figure 6), shows the extracting genome DNA success, does not have and decomposes, and is pollution-free.Pcr amplification successfully obtains the bright band of an about 1800bp of length, with reference to other documents, and doubtful required band, band brightness is higher, does not have other assorted bands simultaneously and disturbs, and the PCR product is delivered biotech company's purifying and order-checking.Sequencing data obtains this bacterium 18SrDNA sequence through the software splicing, and length is 1230 (see figure 7)s.Through the NCBI sequence alignment, this sequence and aspergillus niger ( Aspergilluse niger) etc. homology more than 99%, belong to Deuteromycotina fungi (see figure 8).From the GenBank database, compile the ITS sequence of the Aspergillus niger strain of some representative different generas of having reported, add the ITS sequence that this experiment obtains, utilize NJ method constructing system evolutionary tree (see figure 9).Can find out that from systematic evolution tree T3-5-1 is arranged in the branch that aspergillus niger belongs on classification position, can determine that thus T3-5-1 is the different sorts in the aspergillus niger Pseudomonas.
Comprehensive above conclusion, identify T3-5-1 be aspergillus niger ( Aspergilluse niger), belong to the Deuteromycotina fungi.

Claims (8)

1. a tannase superior strain is an aspergillus niger through strain identification, is preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, and preserving number is CGMCC No.7423.
2. the preparation method of a tannase superior strain is characterized in that, may further comprise the steps:
(1) the septic Turkey-galls of picking is mixed with 10 -1Solution, gradient dilution to 10 -10, each gradient is coated with dull and stereotyped 3 on screening culture medium, cultivate 48 h for 30 ℃, and bacterium colony is preserved in test tube PDA inclined-plane than big and the bigger single bacterium colony of hydrolysis circle on the picking flat board;
(2) (1) obtained strains is activated preparation 10 on the czapek's solution inclined-plane 6The spore suspension of individual/mL, inoculation l mL are in 30 mL fermention mediums, and 30 ℃, 120 r/min shaking culture, 72 h extract tannase and survey its vigor;
(3) inoculation that primary dcreening operation is obtained is in the czapek's solution inclined-plane, cultivated 3-4 days for 30 ℃, after treating the spore maturation, spore is washed till in the triangular flask that granulated glass sphere is housed with 10mL physiological saline, 30 ℃ of shaking culture 1-2 h fully disperse spore, filter with absorbent cotton, get monospore suspension, get l mL monospore suspension and carry out gradient dilution and microscopy counting, adjust spore concentration to 10 6Individual/mL;
(4) in test tube, pack 10 into 6Individual/mL monospore suspension 3 mL, carry out 60The mutagenesis of Co gamma-ray irradiation, radiation dose are 400～600Gy;
(5) behind the irradiation, get 1 mL monospore suspension, with 10 times of dilution method dilutions, get 100 μ L and coat on the screening culture medium, be inverted for 30 ℃ and cultivate, after treating to grow bacterium colony in the culture dish, the inclined-plane is preserved, and described screening culture medium is identical with step (1) screening culture medium;
(6), on the czapek's solution inclined-plane, activate preparation 10 with the bacterial strain that filters out 6The spore suspension of individual/mL, inoculation l mL are in 50 mL fermention mediums, and 30 ℃, 120 r/min shaking culture, 72 h carry out tannase then and extract and enzyme activity determination.
3. the preparation method of tannase superior strain according to claim 2 is characterized in that, in step (1) and the step (5), described screening culture medium is formulated by following component: potassium primary phosphate 4.38g, ammonium sulfate 8.76g, sal epsom 0.88g, calcium chloride 0.088g, Manganous chloride tetrahydrate 0.018g, Sodium orthomolybdate 0.0088g, ferric sulfate 0.12g, agar 30g, Weibull 10g is with being settled to 1 L after the distilled water water dissolution.
4. the preparation method of tannase superior strain according to claim 2, it is characterized in that, in step (2) and the step (6), described fermention medium is formulated by following component: Weibull 20g, sucrose 10g, SODIUMNITRATE 3g, dipotassium hydrogen phosphate 1g, Repone K 0.5g, ferric sulfate 0.01g, sal epsom 0.5g is with being settled to 1 L behind the dissolved in distilled water.
5. the preparation method of tannase superior strain according to claim 2 is characterized in that, in step (2) and the step (6), described tannase extracts and the enzyme activity determination method, may further comprise the steps:
A, fermentation suspension obtain mycelium behind suction filtration, it is neutral that distilled water is washed till the pH value, precooling in refrigerator, with the 1:1:4 mixing by volume of mycelium, quartz sand, citrate buffer solution, grind pulping under ice bath, 0-4 ℃ of following centrifugal 30 min of 10000 r/min get supernatant liquor, be settled to 10 mL with citrate buffer solution, promptly get the tannase crude enzyme liquid;
B, prepare 1 control tube, 1 parallel mensuration pipe of blank pipe with 3, in every test tube, add earlier 1 mL tannase crude enzyme liquid, 45 ℃ of water-bath preheating 10 min, in measuring pipe, respectively add 1 mL Tenox PG solution then, in blank pipe, add 1 mL citrate buffer solution, in control tube, add 0.6 mL ethanol, after reacting 20 min, in measuring pipe and blank pipe, add 4 mL ethanol termination reactions respectively, in control tube, add 1 mL Tenox PG solution, after the question response liquid cooling but,, measure light absorption value under 270 nm with 9 times of citrate buffer solution dilutions;
C, prepare the Tenox PG solution of 20,40,60,80,100 μ mol/L respectively with citrate buffer solution, measure the light absorption value under its 270 nm, draw regression curve, according to the linear regression equation of this regression curve, control tube Tenox PG concentration should be 93.343A Right-1.6626, measuring pipe Tenox PG concentration then is 93.343A Survey-1.6626, calculate enzyme activity by following formula:
Figure 829203DEST_PATH_IMAGE001
。
6. the preparation method of tannase superior strain according to claim 5 is characterized in that, described citrate buffer solution compound method is: accurately take by weighing citric acid 21.01 g, add water and be settled to 1000 mL, as A liquid; Accurately take by weighing Trisodium Citrate 29.41g, be settled to 1000 mL, as B liquid, A liquid and B liquid are pressed the 1:2 mixed, the pH value to 5.0 of transferring mixed solution with A liquid and B liquid promptly gets citrate buffer solution again.
7. the preparation method of tannase superior strain according to claim 5 is characterized in that, the compound method of described Tenox PG solution is: accurately take by weighing 0.2122 g Tenox PG, be settled to 500 mL with citrate buffer solution.
8. the preparation method of tannase superior strain according to claim 2 is characterized in that, in the step (4), is carrying out 60During the mutagenesis of Co gamma-ray irradiation, radiation dose is 500Gy.
CN2013101538572A 2013-04-28 2013-04-28 Tannase high-producing strain and preparation method thereof Pending CN103215193A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN2013101538572A CN103215193A (en) 2013-04-28 2013-04-28 Tannase high-producing strain and preparation method thereof
CN201410121620.0A CN104263650A (en) 2013-04-28 2014-03-28 A high-tannase-yield strain and a preparing method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2013101538572A CN103215193A (en) 2013-04-28 2013-04-28 Tannase high-producing strain and preparation method thereof

Publications (1)

Publication Number Publication Date
CN103215193A true CN103215193A (en) 2013-07-24

Family

ID=48813358

Family Applications (2)

Application Number Title Priority Date Filing Date
CN2013101538572A Pending CN103215193A (en) 2013-04-28 2013-04-28 Tannase high-producing strain and preparation method thereof
CN201410121620.0A Pending CN104263650A (en) 2013-04-28 2014-03-28 A high-tannase-yield strain and a preparing method thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
CN201410121620.0A Pending CN104263650A (en) 2013-04-28 2014-03-28 A high-tannase-yield strain and a preparing method thereof

Country Status (1)

Country Link
CN (2) CN103215193A (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103436505A (en) * 2013-08-13 2013-12-11 广西大学 Preparation method of tannase
CN104195121A (en) * 2014-09-05 2014-12-10 广西大学 Solid culture medium for cassava leaves as well as preparation method and application of solid culture medium
CN104263650A (en) * 2013-04-28 2015-01-07 曹庸 A high-tannase-yield strain and a preparing method thereof
CN106367359A (en) * 2016-11-16 2017-02-01 中国林业科学研究院林产化学工业研究所 Aspergillus niger and application thereof to preparing citric acid from fermented acorns
CN114107161A (en) * 2021-11-15 2022-03-01 泸州老窖股份有限公司 Method for producing ellagic acid by degrading pomegranate rind with mixed domesticated strain

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106834142A (en) * 2017-03-19 2017-06-13 曹庸 A kind of preparation method for producing vigor tannase bacterial strain high
CN116919876B (en) * 2023-09-18 2023-12-12 广东迪美新材料科技有限公司 Plant fermentation extract, preparation method thereof and application thereof in anti-aging cosmetics

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101260392A (en) * 2008-04-17 2008-09-10 贵州大学 Solid fermentation method for producing tannase by using gallnut raw material

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103215193A (en) * 2013-04-28 2013-07-24 曹庸 Tannase high-producing strain and preparation method thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101260392A (en) * 2008-04-17 2008-09-10 贵州大学 Solid fermentation method for producing tannase by using gallnut raw material

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
林健辉: "曲霉T3-5-1产单宁酶培养条件优化", 《食品科学》, vol. 31, no. 19, 31 December 2010 (2010-12-31), pages 245 - 249 *
王挥: "单宁酶制备研究进展", 《食品与机械》, vol. 28, no. 3, 31 May 2012 (2012-05-31), pages 246 - 249 *
陶素芬: "产单宁酶菌株的筛选及选育", 《食品科学》, vol. 33, no. 1, 31 December 2012 (2012-12-31), pages 226 - 229 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104263650A (en) * 2013-04-28 2015-01-07 曹庸 A high-tannase-yield strain and a preparing method thereof
CN103436505A (en) * 2013-08-13 2013-12-11 广西大学 Preparation method of tannase
CN103436505B (en) * 2013-08-13 2014-09-17 广西大学 Preparation method of tannase
CN104195121A (en) * 2014-09-05 2014-12-10 广西大学 Solid culture medium for cassava leaves as well as preparation method and application of solid culture medium
CN106367359A (en) * 2016-11-16 2017-02-01 中国林业科学研究院林产化学工业研究所 Aspergillus niger and application thereof to preparing citric acid from fermented acorns
CN106367359B (en) * 2016-11-16 2019-07-30 中国林业科学研究院林产化学工业研究所 A kind of aspergillus niger and its application in citric acid is prepared in fermentation acorn
CN114107161A (en) * 2021-11-15 2022-03-01 泸州老窖股份有限公司 Method for producing ellagic acid by degrading pomegranate rind with mixed domesticated strain

Also Published As

Publication number Publication date
CN104263650A (en) 2015-01-07

Similar Documents

Publication Publication Date Title
CN103215193A (en) Tannase high-producing strain and preparation method thereof
CN101486970B (en) Fungus strain and uses thereof
CN105385609B (en) The aspergillus niger of one plant height malaga carbohydrate oxidase and its application
CN108102929B (en) Isaria javanica for resisting pymetrozine and application thereof
CN101560478A (en) Bacillus subtilis subso natto for producing natto kinase and application thereof
CN108504594B (en) Amycolatopsis and application thereof in preparation of pseudo-ginseng root rot resistant agent
US20220369648A1 (en) Endophytic falciphora oryzae fo-r20 and its application
CN106434457B (en) One plant of alkali protease superior strain and its produced alkali protease
CN105039171B (en) Bolt bacterium and its application
CN113308392B (en) Application of Nori endophytic Siamese bacillus
CN103667070A (en) Plant endophytic fungi of huperzia serrata and application thereof in preparing huperzine A
CN108865895A (en) Paecilomyces hepiali chen ZJB18001 and its application
CN110042061A (en) High yield gibberellin GA3Gibberella fujikuroi mutant strain and its application
CN108220169A (en) A kind of separation screening and its identification method of degraded polystyrene strain
CN105039183A (en) Dichotomomyces cejpii FS110 protoplast and preparation and conversion method thereof
CN110564627B (en) Trichoderma strain HB20111 for preventing and treating soil-borne diseases of American ginseng and improving yield and application thereof
CN104830698A (en) Pokkah boeng disease pathogen separating and identifying method
CN113801804B (en) Banana wilt biocontrol antagonistic strain and application thereof
CN110016440A (en) Monascus purpureus and its screening technique and purposes
CN110343621A (en) A kind of Trichoderma asperellum strain and its application
CN106929433B (en) Phosphate solubilizing penicillium and application thereof
CN110591927B (en) Application of trichoderma strain HB20111 in digesting phenolic acid autotoxic substances of crop continuous cropping obstacle factors and microbial inoculum
CN105420167B (en) A kind of Bacillus cercus and its application
CN103773709A (en) Bacillus subtilis with efficient phosphate solubilizing effect and application thereof
CN115305222B (en) Bacillus strain and application thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20130724