CN106834142A - A kind of preparation method for producing vigor tannase bacterial strain high - Google Patents
A kind of preparation method for producing vigor tannase bacterial strain high Download PDFInfo
- Publication number
- CN106834142A CN106834142A CN201710163227.1A CN201710163227A CN106834142A CN 106834142 A CN106834142 A CN 106834142A CN 201710163227 A CN201710163227 A CN 201710163227A CN 106834142 A CN106834142 A CN 106834142A
- Authority
- CN
- China
- Prior art keywords
- tannase
- bacterial strain
- water
- enzyme
- enzyme activity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Mycology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A kind of preparation method for producing vigor tannase bacterial strain high, including：（1）2 g angles times are taken, is rinsed with 5 mL dd water, in collecting flushing liquor to 50 mL triangular flasks, with dd water constant volume and shaken up, obtain 10‑1Bacterium solution, gradient dilution to 10‑10, each gradient bacterium solution in applying flat board 2 on screening and culturing medium, 28 DEG C of incubated 60 h, bacterium colony and the hydrolysis larger single bacterium colony of circle, are connected to the h of PDA slant activations 84 respectively on picking flat board；（2）By the spore on the PDA inclined-planes after activation, 2 × 10 are made into dd water6The spore liquid of individual/mL, is then inoculated with l mL in 50 mL solid-state fermentation culture mediums, and then 28 DEG C of incubated 84 h carry out tannase extraction and enzyme activity determination, determines to produce tannin enzyme activity highest bacterial strain by comparing enzyme activity.The present invention produces tannase using solid-state fermentation technology, produces tannin specific activity of enzyme and is up to 8658.37 U/mg, than the Rate activity that Sigma Co., USA produces tannase（3185.25 U/mg）5473.12 U/mg high, and process is simple, save the time.
Description
Technical field
The present invention relates to microbial technology field, and in particular to the related neck of microbe to screen, strain idenfication and enzymatic production
Domain, in particular, provides a kind of product vigor tannase bacterial strain high and preparation method thereof.
Background technology
Tannase（Tannase, E.C. 3.1.1.20）, i.e. tannin Acyl- hydrolase is a kind of inducible cell film knot
The small molecule things such as synthase, hydrolyzable nutgall acyl tannin and alkyl gallates, generation gallic acid, glucose and alkylol
Matter.
Based on to tanning matter effectively hydrolyzing effect, tannase food, beverage, wine brewing, medicine, chemical industry, process hides and
The fields such as sewage disposal are widely used research, and have been commercialized and sunk for removing " tea cream " in production of instant tea
Starch.However, because current tannase production efficiency is generally relatively low, production cost is higher, thus high market price limitation
The large-scale industrial application of tannase.
Learnt through document Investigation, current tannase is mainly produced by microbial fermentation, especially aspergillus and mould are fermented
The report for producing tannase is more.It is especially domestic to producing vigor high but it is not high to presently, there are the most producing enzyme of these microorganisms
The problems such as tannase bacterial strain lacks independent intellectual property right.The CN201310153857.2 reports that present inventor applies in the early time
A kind of bacterial strain aspergillus niger T3-5-1, CN201410121620.0 report a kind of bacterial strain aspergillus niger N5, the two production tannase
Liquid state fermentation technology is used, wherein aspergillus niger T3-5-1 produces tannin specific activity of enzyme for 5304.53 U/mg, compares the U.S.
Sigma companies produce the Rate activity of tannase（1788.15 U/mg）3516.38 U/mg high, aspergillus niger N5 produce tannase ratio
Vigor is 6546.78 U/mg, than the Rate activity that Sigma Co., USA produces tannase（3185.25 U/mg）It is high by 3361.53
U/mg.Need first to do cell broken wall treatment but the tannase of above-mentioned liquid state fermentation production is mainly endocellular enzyme, therefore before carrying enzyme,
Tannase is set to be extracted again after flowing out, technique is relative complex, and produced tannin specific activity of enzyme also needs further raising.
The content of the invention
The object of the invention is directed to the problem of above presence, there is provided a kind of preparation method of product vigor tannase bacterial strain high,
So as to improve fermentation tannin enzyme activity, solve the problems, such as that current tannin enzymatic process is relative complex, production efficiency is relatively low.
One plant of product vigor tannase bacterial strain high that the present invention is filtered out, is aspergillus niger through strain idenfication（Aspergilluse niger）, aspergillus niger N5-5 is named as, from 2 28th, 2014, by China typical culture collection center（CCTCC）Preserve,
Deposit number CCTCC NO：M 2014051.
The preparation method of bacterial strain of the present invention is comprised the following steps：
（1）2 g angles times are taken, are rinsed with 5 mL dd water, in collecting flushing liquor to 50 mL triangular flasks, with dd water constant volume and shaken up,
Obtain 10-1Bacterium solution, gradient dilution to 10-10, each gradient bacterium solution is in painting flat board 2,28 DEG C of constant temperature on screening and culturing medium
60 h are cultivated, bacterium colony and the larger single bacterium colony of hydrolysis circle, are connected to the h of PDA slant activations 84 respectively on picking flat board；
（2）By the spore on the PDA inclined-planes after activation, 2 × 10 are made into dd water6The spore liquid of individual/mL, then be inoculated with l mL in
In 50 mL solid-state fermentation culture mediums, then 28 DEG C of incubated 84 h carry out tannase extraction and enzyme activity determination, by than
Determine to produce tannin enzyme activity highest bacterial strain compared with enzyme activity.
Step（1）In, the screening and culturing medium is formulated by following components：The g of ammonium nitrate 1.20, manganese chloride 0.025
G, the g of epsom salt 0.005, the g of potassium dihydrogen phosphate 0.005, the g of agar 28.00, the g of tannic acid 2.50, are determined with after dd water dissolves
Hold to 1 L.
Step（2）In, the solid-state fermentation culture medium is formulated by following components：The g of wheat bran 9.25, tannic acid 0.75
G, the g of ammonium nitrate 1.20, the g of manganese chloride 0.025, epsom salt 0.005 g, potassium dihydrogen phosphate 0.005g, after dd water dissolves
It is settled to 1 L.
Step（2）In, the tannase is extracted and enzyme activity determination method, is comprised the following steps：
A, toward 100 mL dd water are added in the triangular flask after fermentation ends, 28 DEG C, 150 r/min vibrate 30 min, then will
Mixed liquor is poured out, and with four layers of filtered through gauze, filtrate is collected and 10 min are centrifuged in 5000 r/min, is collected supernatant and is list
Peaceful enzyme enzyme liquid.
B, the EP pipes for taking 52 mL, 1 control tube of setting, 1 blank tube and 3 determine pipe.Often pipe adds 0.3 mL enzymes
Liquid, 45 °C of min of metal bath constant temperature 15.Then each pipe that determines adds 0.1 mL propylgallate titers, adds in blank tube
The mL of dd water 0.1, control tube adds the mL of 95% ethanol 0.6, reacts 20 min.Then determine pipe and blank tube adds 95% ethanol respectively
0.6 mL is terminating enzymatic reaction.Control tube is with the mL of propylgallate titer 0.1.After cooling, each pipe solution is diluted 10
Times.Each pipe solution absorbance value is determined at 275 nm wavelength.
Enzyme activity is defined：45 °C, 1 mL enzyme liquids gallic acid by hydrolyzing propyl ester titer per minute causes absorbance to subtract
The enzyme activity of few 0.001 absorption value is defined as 1 enzyme activity unit（U）.Define accordingly, enzyme activity computing formula can be obtained：Enzyme
Vigor（U/mL）= (A It is right-A Survey) ×2.5×103, wherein,A It is rightWithA SurveyRespectively control tube and determine pipe solution absorbance.
The propylgallate standard liquid making method is：0.4244 g propylgallates accurately are weighed, dd water is used
1000 mL are settled to, the propylgallate titer of 2 mmol/L is obtained final product.
The authentication method of bacterial strain of the present invention includes Morphological Identification and molecular biology identification.Wherein, Morphological Identification leads to
Crossing observation colony characteristicses and cellular morphology carries out Preliminary Identification；Molecular biology identification is by extracting strain gene group DNA and bacterium
Plant 18SrDNA fragments PCR amplifications, sequencing and comparative analysis and make final identification.
The present invention produces tannase using solid-state fermentation technology, produces tannin specific activity of enzyme and is up to 8658.37 U/mg, than
Sigma Co., USA produces the Rate activity of tannase（3185.25 U/mg）5473.12 U/mg high.It can be seen that, using of the invention
Bacterial strain is far above the tannin that the bacterial strain reported before this is produced by liquid state fermentation by the tannin specific activity of enzyme that solid state fermentation is produced
Specific activity of enzyme.Need first to do at breaking-wall cell in addition, the tannase of liquid state fermentation production is mainly endocellular enzyme, therefore before carrying enzyme
Reason, makes tannase be extracted again after flowing out；And the tannase of solid state fermentation production is mainly ectoenzyme, can directly be carried after fermentation ends
Take, thus process is simple, save the time.
Specific embodiment
To make those skilled in the art further appreciate that the present invention, specific embodiment of the invention is set forth below, explains in detail
State technical scheme.It is emphasized that embodiment not all possible embodiments of technical solution of the present invention is poor
Lift, therefore be not used in and limit the scope of the invention.
Embodiment
1 materials and methods
1.1 materials and reagent
1.1.1 material
Angle times, Zhangjiajie Jiu Rui bio tech ltd provides.
1.1.2 reagent
Gallic acid, propylgallate, Key Laboratory of Hunan Forest Products Chemical Engineering provides, purity >=99%；Wheat bran, extensively
Zhou Lvcui bio tech ltd provides, the % of moisture 5.24；PDA culture medium, Czapek's medium, the triumphant microorganism of Guangdong ring
Science and Technology Ltd.；Tannic acid, 95% ethanol, ammonium nitrate, potassium dihydrogen phosphate, potassium chloride, epsom salt, manganese chloride, phenol,
Lactic acid, glycerine, cotton is blue, bromophenol blue, and agar is pure, the Guangzhou Chemical Reagent Factory of analysis；Fungal genomic DNA extracts kit,
Solarbio companies；D-2000 DNA molecular amount standard Marker, LA Taq archaeal dna polymerases, GCbuffer I in-dash computers R
Buffer, dNTPs, Takara company；Amplimer, Shanghai Jimei Biological Engineering Co., Ltd.；Ago-Gel, Spain
Biowest companies；II type Gold view, the excellent Nikon bio tech ltd in Beijing.
1.1.3 culture medium is prepared
Screening and culturing medium：The g of ammonium nitrate 1.20, the g of manganese chloride 0.025, the g of epsom salt 0.005, potassium dihydrogen phosphate 0.005
G, the g of agar 28.00, the g of tannic acid 2.50, with dd water dissolves and are settled to 1 L.
Solid-state fermentation culture medium：Wheat bran 9.25 g, dd water 1 mL, the g of tannic acid 0.75, the g of ammonium nitrate 1.20, manganese chloride
0.025 g, epsom salt 0.005 g, potassium dihydrogen phosphate 0.005g.
1.1.4 main solution is prepared
(1) propylgallate titer
0.4244 g propylgallates accurately are weighed, 1 L is settled to dd water, obtain final product the propylgallate mark of 2 mmol/L
Quasi- liquid.
(2) cotton blue lactophenol oil dye liquor
10 g phenol are placed in 40 mL water, heating for dissolving, and (density is 1.21 kg/m to add 10 g lactic acid3) and 20 g glycerine
(density 1.21kg/m3), add 0.05 g cottons blue.
1.2 experimental techniques
1.2.1 the screening of tannase bacterial strain is produced
(1) 2 g angles times are taken, is rinsed with 5 mL dd water, in collecting flushing liquor to 50 mL triangular flasks, with distilled water constant volume and shaken
It is even, obtain 10-1Bacterium solution, gradient dilution to 10-10, each gradient bacterium solution is in painting flat board 2,28 DEG C of perseverances on screening and culturing medium
Temperature 60 h of culture, bacterium colony and the larger single bacterium colony of hydrolysis circle on picking flat board（Totally 6, numbering N5-1 ~ N5-6）It is connected to respectively
The h of PDA slant activations 84.
(2) by the spore on the PDA inclined-planes after activation, 2 × 10 are made into dd water6The spore liquid of individual/mL, is then inoculated with l
ML is in 50 mL solid-state fermentation culture mediums（It is placed in 250 mL triangular flasks）In, 28 DEG C of incubated 84 h extract tannase and survey
Its vigor, determines to produce tannin enzyme activity highest bacterial strain by comparing enzyme activity.
1.2.2 tannase is extracted and enzyme activity determination
(1) tannase is extracted
100 mL dd water are added toward the triangular flask after fermentation ends, 28 DEG C, 150 r/min vibrate 30 min, then will be mixed
Close liquid to pour out, with four layers of filtered through gauze, collect filtrate and 10 min are centrifuged in 5000 r/min, collect supernatant and be tannase enzyme
Liquid.
(2) tannin enzyme activity determination
5 EP pipes of 2 mL are taken, 1 control tube of setting, 1 blank tube and 3 determine pipe.Often pipe adds 0.3 mL enzyme liquids, 45
°C min of metal bath constant temperature 15.Then each pipe that determines adds 0.1 mL propylgallate titers, and dd water is added in blank tube
0.1 mL, control tube adds the mL of 95% ethanol 0.6, reacts 20 min.Then determine pipe and blank tube adds the mL of 95% ethanol 0.6 respectively
To terminate enzymatic reaction.Control tube is with the mL of propylgallate titer 0.1.After cooling, each pipe solution is diluted 10 times.275
Each pipe solution absorbance value is determined at nm wavelength.
(3) enzyme activity definition
45 °C, 1 mL enzyme liquids gallic acid by hydrolyzing propyl ester titer per minute causes absorbance to reduce by 0.001 absorption value
Enzyme activity be defined as 1 enzyme activity unit（U）.Define accordingly, enzyme activity computing formula can be obtained：Enzyme activity（U/mL）= (A It is right-A Survey) ×2.5×103, wherein,A It is rightWithA SurveyRespectively control tube and determine pipe solution absorbance.
(5) enzyme activity is calculated
Defined according to enzyme activity, enzyme activity computing formula can be obtained：Enzyme activity（U/mL）= (A It is right-A Survey) ×2.5×103, wherein,A It is rightWithA SurveyRespectively control tube and determine pipe solution absorbance.
1.2.3 strain idenfication
1.2.3.1 Morphological Identification
(1) colony characteristicses observation
Make Czapek's medium flat board some, a little with oese picking PDA slant pores, point is connected to flat board, 28 DEG C of incubators
It is middle to be inverted 60 h of culture, observe bacterium colony forming process and feature.
(2) cellular morphology observation
With water logging piece method film-making, it is added dropwise one in clean wave carrier piece center and drips lactic acid carbolic acid indigo plant cotton liquid, with dissecting needle from bacterium colony
Edge is drawn and takes mycelium a little, is put into lactic acid carbolic acid indigo plant cotton liquid, and covered is examined under a microscope.Observation bacterial strain
Mycelia whether there is tabula, sertoli cell, observe spore shape size and raw mode and its sporophore, and binding to fungal identification hand
Volume analysis.
1.2.3.2 molecular biology identification
(1) strain gene group DNA is extracted
1. by the mg of picking thalline about 50 after 28 DEG C of 60 h of culture of optimal bacterial strain, it is placed in sterilizing mortar, adds solution A (fungi
Extracts kit, similarly hereinafter) 200 μ L, 20 μ L RNase A are added, and 100 mg beades are put into, in vortex oscillator
Vibrate 20 min.
2. the Proteinase K of 20 μ L l0 mg/mL is added, is fully mixed, 55 DEG C of water-baths digest 30 min.Run during digestion
For several times, 12000 r/min are centrifuged 2 min, and supernatant is transferred in a new centrifuge tube for the mixing of falling centrifuge tube.
3. 200 μ L solution Bs are added in supernatant, is fully mixed.55 DEG C of min of water-bath 5, add 200 μ L ethanol, fill
Point mix, during solution and flocculent deposit all added into adsorption column, place 2 min.
4. 12000 r/min centrifugations l min, abandon waste liquid, and adsorption column is put into collecting pipe.To adding 700 in adsorption column
μ L rinsing liquids, l2000 r/min centrifugation l min, abandon waste liquid, and adsorption column is put into collecting pipe.
5. to adding 500 μ L rinsing liquids, l2000 rpm that l min are centrifuged, waste liquid is abandoned in adsorption column, adsorption column is put into receipts
In collector, l2000 r/min are centrifuged 2 min, and adsorption column is placed in into room temperature places 5 min.
6. adsorption column is put into a clean centrifuge tube, to the hanging 100 μ L that are added dropwise in adsorbed film center through 75 DEG C of water
The eluent of preheating is bathed, room temperature places 5 min, l2000 r/min centrifugation l min.
7. during centrifugation gained eluent adds adsorption column, room temperature places 2 min, and l2000 r/min are centrifuged 2 min, i.e.,
Genomic DNA is obtained, while carrying out electroresis appraisal.
(2) amplification of strain 18SrDNA fragments and identification
According to PCR amplification system is prepared table 1 Suo Shi, then expanded in PCR instrument.
The strain 18SrDNA fragment PCR amplification systems of table 1
| Title | Consumption | Title | Consumption |
| Template DNA | 1 μL | GCbuffer I (2×) | 15 μL |
| * sense primer NS1 (10 μm/mL) | 1 μL | LA Taq(5U/μL) | 0.5 μL |
| * anti-sense primer NS8 (10 μm/mL) | 1 μL | Add to 30 μ L |
Note：Sense primer NS1：GTAGTCATATGCTTGTCTC, anti-sense primer NS8：TCCGCAGGTTCACCTACGGA
1. through 1% agarose gel electrophoresis after completing, then Gold view dyeing observed and clapped under gel imaging system
Take the photograph.
2. PCR primer is sequenced, is spliced with softwares such as Bioedit after obtaining sequencing result.
3. sequencing result is analyzed, in the Blast programs in the bacterial strain ITS sequence GenBank that will be obtained and database
Other bacterial strains are compared analysis, draw similitude.The structure homologous evolution of bacterial strain is analyzed using software DNAMAN 6.4.0
Relational tree.
2 results and analysis
The screening of 2.1 optimal bacterial strains
(1) according to 1.2.1 methods, 6 plants of pure bacterial strain, numbering N5-1 ~ N5-6 are obtained.
(2) each strain enzyme-producing vigor after fermenting, the producing enzyme vigor highest of bacterial strain N5-5, is 475.25 U/mL.
2.2 strain idenfications
2.2.1 Morphological Identification
(1) colony characteristicses observation result.N5-5 bacterium colonies are spherical in shape, and the mm of diameter 38.0, surface is flat with nebenkern, with reference to tight
Close, in heavy fleece shape, edge is white fluffy aerial hyphae, and there are radioactivity rill, bit brownish in the back side.In 24 h of culture,
Into white hypha, after 60 h, bacterium colony surface produces black spore to bacterium colony, and bacterium colony surface gradually becomes black, and the strain is doubtful to be
Aspergillus niger.
(2) cellular morphology observation result.N5-5 is made up of mycelia, conidiophore and top capsule, and top capsule is spherical in shape, mitogenetic
Spore head brown-black is radial, and one layer of metulae is covered with thereon, and length has a string-like conidium on stigma, and spore is spherical in shape or nearly ball
Shape, pediculated cells, conidiophore is vertically born by sertoli cell, and conidium metulae is without tabula, and surface is smooth, mycelia have every.
With reference to Fungal identification handbook, identify that this bacterial strain belongs to Fungi Imperfecti (Fungi Imperfecti), from stalk embrace a mesh (Moniliales),
From Geng Bao sections (Moniliaceae), aspergillus race (Aspergilleae), aspergillus (Aspergillus Micheli ex Fr.)。
2.2.2 molecular biology identification
(1) fungal genomic DNA is extracted and PCR amplifications
After strain extracting genome DNA through electroresis appraisal be a bright band, without it is any it is miscellaneous band exist, show extracting genome DNA
It is extremely successful, it is pollution-free without decomposition.PCR amplifications successfully obtain a bright band of the bp of length about 1800, with reference to other documents, doubt
The band like needed for, band brightness is higher, while without other miscellaneous band interference, can by PCR primer deliver biotech company's purifying and
Sequencing.
(2) sequencing and comparison result
Sequencing data obtains strain 18SrDNA sequences through software splicing, and length is 1230.Through NCBI sequence alignments, the sequence
Have high homology with aspergillus niger accessory, with aspergillus niger (Aspergilluse niger) etc. homology more than 99%, category partly know
Bacterium subphylum fungi.
To sum up, identify bacterial strain N5-5 for aspergillus niger (Aspergilluse niger), therefore the Strain Designation is aspergillus niger
N5-5。
Claims (5)
1. a kind of preparation method for producing vigor tannase bacterial strain high, it is characterised in that comprise the following steps：
（1）2 g angles times are taken, are rinsed with 5 mL dd water, in collecting flushing liquor to 50 mL triangular flasks, with dd water constant volume and shaken up,
Obtain 10-1Bacterium solution, gradient dilution to 10-10, each gradient bacterium solution is in painting flat board 2,28 DEG C of constant temperature on screening and culturing medium
60 h are cultivated, bacterium colony and the larger single bacterium colony of hydrolysis circle, are connected to the h of PDA slant activations 84 respectively on picking flat board；
（2）By the spore on the PDA inclined-planes after activation, 2 × 10 are made into dd water6The spore liquid of individual/mL, is then inoculated with l mL
In 50 mL solid-state fermentation culture mediums, then 28 DEG C of incubated 84 h carry out tannase extraction and enzyme activity determination, pass through
Compare enzyme activity to determine to produce tannin enzyme activity highest bacterial strain.
2. the preparation method for producing vigor tannase bacterial strain high according to claim 1, it is characterised in that step（1）In, institute
Screening and culturing medium is stated to be formulated by following components：The g of ammonium nitrate 1.20, the g of manganese chloride 0.025, the g of epsom salt 0.005,
The g of potassium dihydrogen phosphate 0.005, the g of agar 28.00, the g of tannic acid 2.50, with being settled to 1 L after dd water dissolves.
3. the preparation method for producing vigor tannase bacterial strain high according to claim 1, it is characterised in that step（2）In, institute
Solid-state fermentation culture medium is stated to be formulated by following components：The g of wheat bran 9.25, the g of tannic acid 0.75, the g of ammonium nitrate 1.20, chlorination
The g of manganese 0.025, epsom salt 0.005 g, potassium dihydrogen phosphate 0.005g, with being settled to 1 L after dd water dissolves.
4. the preparation method for producing vigor tannase bacterial strain high according to claim 1, it is characterised in that step（2）In, institute
State tannase to extract and enzyme activity determination method, comprise the following steps：
A, toward 100 mL dd water are added in the triangular flask after fermentation ends, 28 DEG C, 150 r/min vibrate 30 min, then will
Mixed liquor is poured out, and with four layers of filtered through gauze, filtrate is collected and 10 min are centrifuged in 5000 r/min, is collected supernatant and is list
Peaceful enzyme enzyme liquid；
B, the EP pipes for taking 52 mL, 1 control tube of setting, 1 blank tube and 3 determine pipe；Often pipe adds 0.3 mL enzyme liquids,
45 °C of min of metal bath constant temperature 15；Then each pipe that determines adds 0.1 mL propylgallate titers, and dd is added in blank tube
The mL of water 0.1, control tube adds the mL of 95% ethanol 0.6, reacts 20 min；Then determine pipe and blank tube adds 95% ethanol 0.6 respectively
ML is terminating enzymatic reaction；Control tube is with the mL of propylgallate titer 0.1；After cooling, each pipe solution is diluted 10 times；
Each pipe solution absorbance value is determined at 275 nm wavelength.
5. the preparation method for producing vigor tannase bacterial strain high according to claim 4, it is characterised in that the gallic acid
Propyl ester standard liquid making method is：0.4244 g propylgallates accurately are weighed, 1000 mL are settled to dd water, obtain final product 2
The propylgallate titer of mmol/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710163227.1A CN106834142A (en) | 2017-03-19 | 2017-03-19 | A kind of preparation method for producing vigor tannase bacterial strain high |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710163227.1A CN106834142A (en) | 2017-03-19 | 2017-03-19 | A kind of preparation method for producing vigor tannase bacterial strain high |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106834142A true CN106834142A (en) | 2017-06-13 |
Family
ID=59144896
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710163227.1A Pending CN106834142A (en) | 2017-03-19 | 2017-03-19 | A kind of preparation method for producing vigor tannase bacterial strain high |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106834142A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107904219A (en) * | 2017-12-29 | 2018-04-13 | 集美大学 | A kind of tannase solid-state fermentation culture medium preparation method and applications |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2363466A4 (en) * | 2008-10-24 | 2012-08-08 | Amano Enzyme Inc | Tannase, gene encoding same, and process for producing same |
| CN104263650A (en) * | 2013-04-28 | 2015-01-07 | 曹庸 | A high-tannase-yield strain and a preparing method thereof |
-
2017
- 2017-03-19 CN CN201710163227.1A patent/CN106834142A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2363466A4 (en) * | 2008-10-24 | 2012-08-08 | Amano Enzyme Inc | Tannase, gene encoding same, and process for producing same |
| CN104263650A (en) * | 2013-04-28 | 2015-01-07 | 曹庸 | A high-tannase-yield strain and a preparing method thereof |
Non-Patent Citations (4)
| Title |
|---|
| 周家华: "《食品添加剂》", 31 January 2001, 化学工业出版社 * |
| 李秧针: "单宁酶发酵生产的研究进展", 《中国酿造》 * |
| 李远华: "《茶叶生物技术》", 30 June 2017, 中国轻工业出版社 * |
| 马伟光: "《天然植物药的生物转化研究》", 31 May 2013, 云南科学技术出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107904219A (en) * | 2017-12-29 | 2018-04-13 | 集美大学 | A kind of tannase solid-state fermentation culture medium preparation method and applications |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104263650A (en) | A high-tannase-yield strain and a preparing method thereof | |
| CN105112303B (en) | A kind of Aspergillus niger strain of production wine complex enzyme | |
| CN101280277A (en) | Trametes gallica, culture method and application thereof | |
| CN113416657B (en) | Paecilomyces lilacinus M-1 and application thereof | |
| CN109294933A (en) | One Accharomyces cerevisiae and its method for co-culturing raising traditional fermented food quality with ester-producing yeast | |
| CN106916752B (en) | Method for preparing cellulase and/or xylanase and special strain thereof | |
| CN103937691A (en) | Aspergillus oryzae strain capable of producing beta-fructofuranosidase, as well as culture method and application thereof | |
| CN104726355B (en) | The method that (S) carbonyl reductase II asymmetric transformations of saccharomyces cerevisiae spore expression prepare (S) benzoglycols | |
| CN105602917A (en) | Production method of hesperidinase and application | |
| CN106834142A (en) | A kind of preparation method for producing vigor tannase bacterial strain high | |
| CN101544958B (en) | High-yield paenibacillus amyloliquefaciens csuft F14 for chitin deacetylase and its application | |
| CN109609388B (en) | Aspergillus niger and application thereof | |
| CN107674839B (en) | Fusarium solani and method for producing dextranase by fermenting fusarium solani | |
| CN105779309B (en) | Aspergillus terreus strain and application thereof in preparation of xylanase | |
| CN110358687B (en) | Gibberellin for producing D-pantolactone hydrolase and application and fermentation method thereof | |
| CN114644984A (en) | Method for separating microorganism producing amylase from soil | |
| CN110055183B (en) | Penicillium expansum and application thereof | |
| CN113528492A (en) | Method for producing cellulase liquid by recycling lignocellulose hydrolysate for fermentation | |
| CN104726354A (en) | Method of stereoselectively preparing (R)-phenylethanol with spore microcapsule enzyme of (S)-carbonyl reductase II/E228S | |
| CN111733087A (en) | Lacquercus humilis for producing laccase and application thereof | |
| Zhang et al. | Screening and identification of a cutinase-producing Rhodotorula mucilaginosa and properties of the cutinase | |
| CN108865903B (en) | Trichoderma aquaticum and method for producing cellulase by trichoderma aquaticum | |
| CN113151004B (en) | Novel strain of Asira zeylanica and application thereof | |
| CN113980823B (en) | New strain of genus of Nostoc of family Nostocaceae and application thereof | |
| CN116286557B (en) | Salt-tolerant bacillus beijerinckii for producing cellulase and culture method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20170613 |
|
| WD01 | Invention patent application deemed withdrawn after publication |