CN103214572B - Anti-sterigmatocystin monoclonal antibody - Google Patents
Anti-sterigmatocystin monoclonal antibody Download PDFInfo
- Publication number
- CN103214572B CN103214572B CN201310136959.3A CN201310136959A CN103214572B CN 103214572 B CN103214572 B CN 103214572B CN 201310136959 A CN201310136959 A CN 201310136959A CN 103214572 B CN103214572 B CN 103214572B
- Authority
- CN
- China
- Prior art keywords
- antibody
- sterigmatocystin
- cell
- test kit
- add
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention discloses an anti-sterigmatocystin monoclonal antibody. The antibody comprises a light chain and a heavy chain, wherein an amino acid sequence of a variable region of the light chain is shown in a sequence table SEQ ID NO. 1, and an amino acid sequence of a variable region of the heavy chain is shown in a sequence table SEQ ID NO. 2. The invention further discloses a method for preparing the antibody. A detection kit for detecting sterigmatocystin is prepared by using the antibody disclosed by the invention. The sensitivity of the kit reaches 10 pgs per microliter, so that the content of the sterigmatocystin in a sample can be effectively detected. The kit is convenient to use and does not need valuable instruments, thereby facilitating large-scale popularization and application.
Description
Technical field
The present invention relates to a kind of monoclonal antibody, in particular to anti-sterigmatocystin monoclonal antibody ASH, also relate to this monoclonal antibody and preparing the application in sterigmatocystin detection kit.
Background technology
The mycotoxin of current known Polluted grains about has 100 kinds, and mycotoxin is the metabolism secondary pollutant of mould.Mycotoxin in feed is except causing animal mycotoxicosis, and major part also can suppress animal immune, reduces resistibility, thus brings out other diseases.Animal experiment shows: mycotoxin can cause the symptoms such as decreased heart rate, accelerated breathing, depilation and miscarriage.Mycotoxin also can remain in livestock product, indirect hazard human health.
Sterigmatocystin (Sterigmatocys is called for short ST) is that a kind of heterogeneous ring compound has very strong liver and kidney toxin, can bring out kinds of tumors.The Liver Cancer of certain areas, South Africa may be relevant with ST.Sterigmatocystin is, can cause cholangiocarcinoma and liver cancer, have mutagenicity, but lower to the pollution frequency of food.ST also can change into stronger carcinogens aflatoxin.ST can also cause some Animal diseases.ST can have more than 10 kind of fungal metabolite to produce, in the output of artificial medium up to 10g/kg.Knownly can be comprised by the food that ST pollutes: rice, wheat, corn, peanut, soybean, ham, cheese, coffee etc.Sterigmatocystin to be sprayed post-heating through aluminum chloride, can be yellow fluorescence under 365nm length ultraviolet light.The tlc of the detection sterigmatocystin that health research is set up was classified as national standard (GB/T5009.25-1996) in 1984.This method is 25 μ g/kg to the limit of identification of rice, corn, wheat, and soya bean, peanut are 50 μ g/kg.
Because ST harm is large, distribution is wide, and reduce its impact on people and animals, the ST effectively and fast detected in food and feed just seems extremely important.Make a definite diagnosis ST poisoning, more depend on and detect from the tissue of patient or secretory product, movement.Compared with the biology detection applied with tradition, thin layer chromatography (TLC), high performance liquid chromatography (HPLC) etc., the detection of immunochemistry detection method to mycotoxins have quick, special, sensitive, accurate, can batch detection, sample preparation simple, can the advantages such as automated operation be realized.The prerequisite that immunochemistry detects ST is then the antibody needing to possess for ST.
Then not easily be identified with the natural mycotoxin that the natural constituents form of food exists, and due to genotoxic potential large, thus very large threat can be caused to the health of human consumer.More early carrying out the easier harm by mycotoxin generation of mycotoxin detection drops to minimum.If just find mycotoxin from source, be then more convenient for taking rational controlling measurement mycotoxin early, endanger to cultivation industrial belt from the feed of mycotoxin contamination, thus make enterprise comprise food safety to cover with shade.
In actually operating, if just adopt the method for rapid screening in feedstuff raw material buying link, check that whether feedstuff raw material is containing mycotoxin, then enterprise can be made to avoid using the raw material production feed containing mycotoxin.So, develop detection method that is quick to mycotoxin, highly sensitive, high specific and seem particularly important.
Summary of the invention
The invention discloses a kind of anti-sterigmatocystin monoclonal antibody ASH, described monoclonal antibody comprises light chain and heavy chain, and its amino acid variable region sequences is respectively as shown in SEQ ID NO:1 in sequence table and SEQ ID NO:2.
The invention also discloses the preparation method of said monoclonal antibody ASH, mainly comprise as follows:
1. the structure of anti-sterigmatocystin monoclonal antibody hybridoma cell strain
1) preparation (BSA-ST) of antigen
ST and dilute sulphuric acid are refluxed in hot water bath and is derivatized to ST hemiacetal derivative, ST hemiacetal derivative after silica gel G column chromatography in neutral phosphate buffer liquid (PBS) and bovine serum albumin (BSA) react 5 hours, NaBH4 reduction is added under low temperature, excessive NaBH4 is removed again with dilute hydrochloric acid, then dialysis is watered, for subsequent use.Obtain complex antigen BSA-ST thus, packing freeze-drying, immune animal.The Conjugate ratio of BSA and ST is determined with ultra-violet absorption spectrum.
2) animal immune
5 BABLC BSA-ST carry out immunity, 200 μ g//times, and immunity 4 times, carries out the titration of mouse tail blood.Finally require that ELISA tires and reach more than 1: 25600.
3) feeder layer cells preparation (merge and prepared the day before yesterday)
Draw neck to put to death the mouse (BALB/C or kunming mice) without immunity, extract eyeball and get blood.By the mouse 75% alcohol-pickled sterilization without immunity, be placed on after taking-up in the sterile petri dish in Bechtop.Cut off mouse part skin (not damaging peritonaeum), tear skin up and down along otch, abundant exposure belly, changes scissors, tweezers, cuts off peritonaeum, size incision can allow sharp suction pipe arbitrarily to pass in and out, a pipe nutrient solution inhaled by the sharp suction pipe getting tip smooth, is added in mouse peritoneal, rinses, sucking-off, repeatedly several times (general 2 ~ 3 times), note not poking mouse digestive tube, contamination of cells.The feeder layer cells of collected by centrifugation, abandons supernatant, and be suspended from by cell in HAT nutrient solution, Trypan Blue living cell counting, dilutes according to amount of viable cell, makes every milliliter containing about 400,000 viable cell.Pour the sterilized volley of rifle fire groove volley of rifle fire after mixing into and cell suspension is added on (or instilling the aperture of 96 well culture plates with dropper) 37 DEG C in the aperture of 96 well culture plates, cultivate for subsequent use in the incubator of saturated humidity.
4) preparation of immune spleen cell
The BALB/C mice of immunity, eyeball gets blood, uses as positive control.The BALB/C mice 75% alcohol-pickled sterilization of immunity, be placed in the sterile petri dish in Bechtop after taking-up, cut off and fully peel off skin of abdomen, peritonaeum mentioned by transducer set aseptic nipper and scissors, cut off an osculum, transducer set aseptic nipper and scissors again, use scissors separating spleen, try not to be with reticular tissue, spleen is transferred on the cell sieve in culture dish, spleen is cut off with scissors, spleen is extruded gently with 20ml glass syringe piston, draw serum-free 1640 substratum with dropper and rinse piston and steel mesh, top operation several times repeatedly, until spleen only surplus coating.By centrifugal for filtrate serum-free 1640 substratum suspension cell, the splenocyte suspension that takes a morsel carries out trypan blue cell counting, detect live cell fraction (should 80% be greater than), determine the quantity of splenocyte alive, according to the quantity of splenocyte, SP2/0 myeloma cell is prepared, (a mouse boosting cell about 10 by 5: 1 ~ 10: 1
8individual, with SP2/0 myeloma cell 2 × 10
7individual, fusion 50%PEG40001ml).
5) myeloma cell's suspension
Within 7 ~ 10 days before fusion, frozen myeloma cell in liquid nitrogen is recovered, cultivated for 1 ~ 2 generation.The cell that growth selection is vigorous, form is good carries out enlarged culturing.Collected the cell being in logarithmic phase the same day in cytogamy, cell counting and cell viability detection were carried out to the cell collected.Bright non-staining viable cell should account for more than 90%.After counting, according to the quantity of splenocyte, the myeloma cell's suspension drawing respective numbers by 5: 1 ~ 10: 1 injects the 50mL centrifuge tube for subsequent use (2 × 10 of sterilizing
7individual myeloma cell).
6) cytogamy and cultivation
Be placed on spirit lamp by the glass centrifuge tube of dress PEG4000, slightly cool, add 0.5ml serum-free 1640 after fusing, mixing, be 50%PEG4000,37 DEG C of water-bath equilibrium temperatures are for subsequent use.Ready splenocyte, myeloma cell's two kinds of cell suspensions are fully mixed rear centrifugal.Wash once with RPMI-1640 nutrient solution again.By on empty dry (or with dropper exhaust residual liquid), in order to avoid affect the concentration of PEG.With pointing bullet pine sedimentation cell group gently, two kinds of cells are made to be mixed into pasty state.Centrifuge tube is placed in 37 DEG C of water-baths, the 50%PEG4000 limit edged slowly adding 1mL37 DEG C of preheating stirs evenly, and 1min completes.Leave standstill 1min, then added in 1min in cell by a suction pipe serum-free medium, action is as far as possible soft, and limit edged stirs, and last fluid infusion is to 20ml.Centrifugally abandon supernatant liquor, cell is suspended from gently in 20% import tire ox RPMI1640HAT substratum.Spread 96 orifice plate 5 pieces.Within second day, check whether pollution, within the 5th day, calculate fusion rate, within the 7th day, change liquid, changed liquid once every 3 ~ 4 days later, within the tenth day, detect positive colony.Observe every hole clonal growth situation every day, make a record, when changing liquid, the nutrient solution of sucking-off half, adds new substratum, after myeloma cell is killed completely, uses HT substratum instead.
The cell can expressing anti-sterigmatocystin antibody is obtained, its anti-sterigmatocystin antibody called after ASH expressed by aforesaid method.
2. the fishing that is light, heavy chain gene of anti-sterigmatocystin antibody A SH is got
Detected the supernatant of hybridoma by the method for ELISA, filter out the cell strain that can combine with sterigmatocystin, extract the cell RNA of the cell strain of screening, through RT-PCR, fish the weight chain gene getting antibody with two pairs of Auele Specific Primers.Conventional method connects into carrier, transform competent bacteria, the single bacterium colony of picking after cultivating, and carries out DNA sequencing analysis after extracting plasmid PCR qualification.
Pass through above-mentioned steps, construct carrier that is light containing anti-sterigmatocystin antibody A SH, heavy chain gene, obtain through order-checking that sterigmatocystin antibody A SH is light, heavy chain gene information, its amino acid variable region sequences of light chain is as SEQ ID NO:1 in sequence table, and heavy chain amino variable region sequences is as shown in sequence table SEQ ID NO:2.
The present invention utilizes monoclonal antibody parting kit to identify ASH antibody, and it is IgG2a that result shows ASH antibody of the present invention.
The present invention is detected by ELISA cross reaction, and result shows being combined with sterigmatocystin of ASH antibodies specific of the present invention, and is not combined with BSA, and Westem Blot detected result is consistent with ELISA detected result.
The antibody A SH that the present invention utilizes aforesaid method to screen to obtain and the present inventor screen the anti-sterigmatocystin antibody A SP1 (ScFv antibody) obtained by phage library, prepare detection sterigmatocystin test kit, the wherein variable region amino acid sequence of ASP1 light chain and heavy chain, respectively as shown in SEQ ID NO:3 and SEQID NO:4 in sequence table.Described detection sterigmatocystin test kit comprises: the anti-versicolorin A SP1 antibody (HRP-Sulfo-SMCC-ASP1) of anti-versicolorin A SH antibody, HRP mark, horseradish peroxidase substrate buffer solution, ST standard substance (100ug/ml, 0.1ml), negative control sample BSA.Wherein horseradish peroxidase substrate buffer solution: take 10mg3,3 ', 5,5 '-tetramethyl benzidine (TMB) is dissolved in 5ml dehydrated alcohol and is prepared into TMB stock solution.Get 0.5ml TMB stock solution time to be used and be added to 10ml phosphate citrate acid substrate buffer solution (0.2MNa
2hPO
4, 0.1M citric acid) in, then add 32 μ l0.75%H
2o
2mixing, is configured to horseradish peroxidase substrate buffer solution.
The invention also discloses the using method of above-mentioned detection sterigmatocystin ELISA kit:
A) anti-versicolorin A SH antibody (1mg/ml) diluted by 1: 320 with coating buffer (PH9.60.05M carbonate buffer solution), get the ASH antibody diluent after dilution, add in enzyme plate, every hole 100 μ l, 4 DEG C are spent the night;
B) washings (PH7.4PBS) cleaning of enzyme target 3 times, shakes 5-8min at every turn on shaking table;
C) getting 100 μ l testing samples joins in the enzyme plate of bag quilt, hatch 2h for 37 DEG C, standard substance, by 2 holes, are carried out gradient dilution simultaneously and are followed successively by 5pg/ul, 10pg/ul, 15pg/ul, 20pg/ul25pg/ul, 30pg/ul by each sample bag, every hole 100 μ l;
D) the antibody A SP1 (HRP-Sulfo-SMCC-ASP1) horseradish peroxidase marked is by 1: 3000 ~ 1: 5000 dilutions, and every hole 100 μ l, hatches 2h for 37 DEG C;
E) clean 5 times with washings again, add horseradish peroxidase substrate buffer solution 100 μ l, after colour developing 5min, add stop buffer 100 μ l, color development stopping;
F) detect the value of OD450 by microplate reader, the light absorption value preparation standard curve of establishing criteria product, thus judge the concentration of ST in institute's test sample product according to light absorption value.
The sensitivity of above-mentioned ELISA kit is detected by standard substance, the extent of dilution of standard substance ST is as follows: 500pg/ μ l, 250pg/ μ l, 125pg/ μ l, 62.5pg/ μ l, 31.25pg/ μ l, 15.625pg/ μ l, 7.8125pg/ μ l, 3.90625pg/ μ l, 1.953125pg/ μ l, 0.9765625pg/ μ l, 0.4882812pg/ μ l, 0.2441406pg/ μ l, result shows, and the bottom line that test kit of the present invention can detect is 10pg/ μ l.
Beneficial effect of the present invention is as follows:
1) present invention utilizes the method that traditional mouse monoclonal combines with the technology of phage antibody library, make double crush syndrome method sensitiveer.The preparation technology of phage library antibody is more simple, and make whole ELSIA detect data more stable, more convenient, traditional monoclonal antibody is coated on elisa plate as first antibody, gives full play to the ability of traditional monoclonal antibody capture antigen.
2) required equipment simple (ELISA method only needs a microplate reader or do not need test set, directly carries out observing judging after application of sample) compared with the method such as ST toxin ELISA detection technique and traditional chromatogram, mass spectrum.Pre-treatment program simplifies (not needing purification).Fast, measurement capacity is large, and inspection cost is low in inspection.Because the method that falls is simple, do not need specific installation, therefore can detect in production scene.Cereal etc. can be passed through the extracting of extracting profit, concentrate also again but sampling detection in water-soluble solution.Do not need purification, its checked operation (not comprising pre-treatment) can complete in several minutes was to several hours.Measurement capacity, according to the difference of solid phase used, can analyze tens even more Multi-examples at every turn simultaneously.
Accompanying drawing explanation
Figure 1A SH antibody with synantigen is not in conjunction with situation, ST is sterigmatocystin, BSA-ST the coupling ST of BSA, HAS: human serum albumin;
Fig. 2 Westem Blot detect ASH antibody and sterigmatocystin in conjunction with situation, 1:BSA-ST swimming lane, 2: pure BSA swimming lane.
Embodiment
Can more easily understand content of the present invention by consulting following embodiment, these embodiments just for further illustrating the present invention, and do not mean that restriction scope of the present invention.
The structure of embodiment primary antibodie sterigmatocystin monoclonal antibody hybridoma cell strain
One, material
20% foetal calf serum: Beijing unit Heng Shengma biotechnology research institute product; Serum-free RPMI1640:Gibco Products; SP2/0 cell: ATCC introduces; Freund's complete adjuvant and freund 's incomplete adjuvant, colouring reagents TMB:Sigma Products; Balb/c and C57BL/6 mouse; Aminopterin, xanthoglobulin and thymidine, all the other reagent are commercial.
Two, method and result
1, preparation work
1) aminopterin (A) storage liquid (100 ×):
1.8mgA is dissolved in 90ml tri-distilled water, drips 1mM NaOH0.5ml magnetic agitation and dissolves, and drips 1mMHCL0.5ml neutralization, constant volume to 100ml filtration sterilization, 1ml packing ,-20 DEG C of storages.
2) xanthoglobulin and thymidine (HT) storage liquid (100 ×):
H136mg, T39mg, add tri-distilled water 100ml, after mixing, and dissolution in 50 ~ 60 DEG C of water-baths, filtration sterilization, 1ml packing ,-20 DEG C of storages.
3) dual anti-preparation:
Penicillin sodium salt 1,000,000 unit (0.6g1 IU penicillin is equivalent to 0.60 microgram Crystalline Penicillin G Sodium salt), Streptomycin sulphate 1g is dissolved in tri-distilled water 100ml filtration sterilization 1ml packing ,-20 DEG C of storages.
4)50%PEG4000:
0.5g/ manages, autoclaving ,-20 DEG C of storages, and slightly cool after used time spirit lamp fusing, add 0.5ml serum-free 1640, mixing is 50%PEG.
2, animal immune
1) preparation (BSA-ST) of antigen
Immunizing antigen:
ST and dilute sulphuric acid are refluxed in hot water bath and is derivatized to ST hemiacetal derivative, ST hemiacetal derivative after silica gel G column chromatography in neutral phosphate buffer liquid (PBS) and bovine serum albumin (BSA) react 5 hours, NaBH4 reduction is added under low temperature, excessive NaBH4 is removed again with dilute hydrochloric acid, then dialysis is watered, for subsequent use.Obtain complex antigen BSA-ST thus, packing freeze-drying, immune animal.The Conjugate ratio of BSA and ST is determined with ultra-violet absorption spectrum.Also can find out that ST is coupled on BSA by SDS-PAGE electrophoresis.
2) animal immune
5 BABLC BSA-ST carry out immunity, 200 μ g//times, and immunity 4 times, carries out the titration of mouse tail blood.Finally require that ELISA tires and reach more than 1: 25600.
3, cytogamy
1) feeder layer cells preparation (merge and prepared the day before yesterday)
(1) draw neck to put to death the mouse (BALB/C or kunming mice) without immunity, extract eyeball and get blood.
(2) tap water is clean.
(3) 75% alcohol-pickled sterilization 10min, are placed on after taking-up in the sterile petri dish in Bechtop.
(4) a 50ml centrifuge tube is got, add 5 ~ 6ml serum-free RPMI1640 nutrient solution, cut off mouse part skin (not damaging peritonaeum), tear skin up and down along otch, abundant exposure belly, change scissors, tweezers, cut off peritonaeum, size incision can allow sharp suction pipe arbitrarily to pass in and out, a pipe nutrient solution inhaled by the sharp suction pipe getting tip smooth, is added in mouse peritoneal, rinses, sucking-off, repeatedly several times (general 2 ~ 3 times), note not poking mouse digestive tube, contamination of cells.
(5) feeder layer cells in centrifugal 50ml centrifuge tube, 1000rpm, 5min, abandon supernatant, and be suspended from by cell in 10mLHAT nutrient solution, Trypan Blue living cell counting, dilutes according to amount of viable cell, makes every milliliter containing about 400,000 viable cell.Pour the sterilized volley of rifle fire groove volley of rifle fire after mixing into and cell suspension is added on (or instilling the aperture of 96 well culture plates with dropper) in the aperture of 96 well culture plates, every hole 0.1mL about 2 ~ 40,000/hole, place the CO of 5% ~ 7%
2in incubator, 37 DEG C, cultivate for subsequent use in the incubator of saturated humidity.
(6) observation of cell upgrowth situation.
(7) according to after second day cytogamy spread 96 orifice plate numbers, prepare enough feeder layer cells.
2) preparation of immune spleen cell
(1) BALB/C mice of immunity, eyeball gets blood, uses as positive control.
(2) tap water is clean.
(3) 75% alcohol-pickled sterilization 10min, are placed on after taking-up in the sterile petri dish in Bechtop.
(4) cut off and fully peel off skin of abdomen, peritonaeum mentioned by transducer set aseptic nipper and scissors, cuts off an osculum
(5) transducer set aseptic nipper and scissors again, use scissors separating spleen, try not to be with reticular tissue.
(6) spleen is transferred on the cell sieve in culture dish, cut off spleen with scissors, extrude spleen gently with 20ml glass syringe piston, draw serum-free 1640 substratum with dropper and rinse piston and steel mesh, top operation several times repeatedly, until spleen only surplus coating.Filtrate is sucked in 50ml centrifuge tube, finally rinse culture dish, proceed in 50 blood centrifuge tubes in the lump, the static 10min of room temperature.
(7) 1000r/min, 5min, with 10mL serum-free 1640 substratum suspension cell, the obvious tissue block of sucking-off.
(8) splenocyte suspension that takes a morsel carries out trypan blue cell counting, detect live cell fraction (should 80% be greater than), determine the quantity of splenocyte alive, according to the quantity of splenocyte, SP2/0 myeloma cell is prepared, (a mouse boosting cell about 10 by 5: 1 ~ 10: 1
8individual, with SP2/0 myeloma cell 2 × 10
7individual, fusion 50%PEG40001ml).
3) myeloma cell's suspension
(1) frozen myeloma cell in liquid nitrogen was recovered in 7 ~ 10 days before fusion, cultivated for 1 ~ 2 generation.
(2) cell that growth selection is vigorous, form is good carries out enlarged culturing.48h before merging, be inoculated in by cell in 100mL culturing bottle, about 4 ~ 6 bottles, every bottle adds complete culture solution 15mL, is 5 × 10 containing cell count
4~ 5 × 10
5individual/mL.Be positioned over 5% ~ 7%CO
2, 37 DEG C, cultivate for subsequent use in the incubator of saturated humidity.
(3) cell of logarithmic phase is in 50mL centrifuge tube, the centrifugal 5min of 1000r/min in cytogamy collection on the same day.Tissue Culture Flask, supplements nutrient solution and continues to cultivate.
(4) cell is suspended from 20mL RPMI-1640 nutrient solution.
(5) trypan blue carries out cell counting and cell viability detection.Bright non-staining viable cell should account for more than 90%.After counting, according to the quantity of splenocyte, the myeloma cell's suspension drawing respective numbers by 5: 1 ~ 10: 1 injects the 50mL centrifuge tube for subsequent use (2 × 10 of sterilizing
7individual myeloma cell).
4) cytogamy and cultivation
(1) be placed on spirit lamp by the glass centrifuge tube of dress PEG4000, slightly cool, add 0.5ml serum-free 1640 after fusing, mixing, be 50%PEG4000,37 DEG C of water-bath equilibrium temperatures are for subsequent use.
(2) ready splenocyte, myeloma cell's difference 1000r/min, 5min20ml serum-free 1640 wash twice.
(3) splenocyte and myeloma cell are mixed in 50mL centrifuge tube.
(4) fully mix rear centrifugal by two kinds of cell suspensions, 1000r/min, 5min, abandon supernatant liquor.Wash once with RPMI-1640 nutrient solution again.By on empty dry (or with dropper exhaust residual liquid), in order to avoid affect the concentration of PEG.With pointing bullet pine sedimentation cell group gently, two kinds of cells are made to be mixed into pasty state.
(5) centrifuge tube is placed in 37 DEG C of water-baths, the 50%PEG4000 limit edged slowly adding 1mL37 DEG C of preheating stirs evenly, and 1min completes.Leave standstill 1min (time in summer is 1min, and the time in winter is 1.5min), then a suction pipe serum-free medium is added in cell in 1min, action is as far as possible soft, limit edged stirs, and (now, cell is out of shape shrinkage under PEG effect, and liquid feeding is too fast, action is excessively thick, cell rupture death can be caused), subsequently, without timing, but still slowly to drip nutrient solution, last fluid infusion is to 20ml.
(6) the centrifugal 5min of 1000r/min, abandons supernatant liquor, is suspended from gently by cell in 50mL20% import tire ox RPMI1640HAT substratum.Spread 96 orifice plate 5 pieces.Within second day, check whether pollution, within the 5th day, calculate fusion rate, within the 7th day, change liquid, changed liquid once every 3 ~ 4 days later, within the tenth day, detect positive colony.
(7) observe every hole clonal growth situation every day, make a record, when changing liquid, the nutrient solution of sucking-off half, adds new substratum, after myeloma cell is killed completely, uses HT substratum instead.
The cell can expressing anti-sterigmatocystin antibody is obtained by aforesaid method.
Embodiment two secretes the screening and identification of the hybridoma cell strain of anti-sterigmatocystin monoclonal antibody
One, material
20% foetal calf serum: Beijing unit Heng Shengma biotechnology research institute product; Serum-free RPMI1640:Gibco Products; SP2/0 cell: ATCC introduces; Colouring reagents TMB:Sigma Products; Two resist: sheep anti-Mouse-HRP; All the other reagent are commercial.
Two, method and result
1, filtering hybridoma:
(1) when hybrid cell colony growth arrives a certain size after merging, screening antibodies activity (detecting when changing liquid at every turn) can just be started.
(2) ELISA detects, and gets supernatant liquid 100mL and measures.Define the positive after being detected by 2 times, just carry out subclone (Growth of Cells accounts for the 1/4-1/3 of hole floorage) immediately, limiting dilution assay carries out subclone.Culture plate is placed in the 5%CO of 37 DEG C
2cultivate in incubator, after about 5 days, can be observed cell clone under the microscope.Change liquid in good time, detect, get positive monoclonal cell strain and carry out enlarged culturing, timely freeze-stored cell strain.By aforesaid method, finally obtain the cell strain that anti-ST high-affinity is secreted in a strain, the antibody called after ASH of its secretion.
2, the cross reaction of antibody A SH detects: carried out the cross detection between antigen, different carriers to cell strain secretion supernatant, experimental design:
A1-A4 is that negative sky and elisa plate do not wrap by any antigen;
B1-H1 bag is by pure ST;
B2-H2 bag is by BST-ST immunizing antigen;
B3-H3 bag is by pure BSA albumen;
B4-H4 bag is by pure HAS albumen (human serum albumin);
B1-B4 primary antibodie does not add object juice but adds ghost SP2/0 cell culture fluid;
H1-H4 bis-is anti-adds blank PBS.
C, D, E, F, G are revision test, and primary antibodie adds object juice, and two anti-add sheep anti-Mouse-HRP;
Concrete detecting step is as follows:
A) by above-mentioned design respectively, wrap respectively by ST, BST-ST, BSA, HAS in enzyme plate, every hole 100 μ l, wherein A1-A4 is that negative blank and elisa plate do not wrap by any antigen; 4 DEG C are spent the night.
B) washings cleaning of enzyme target 3 times, shakes 5-8min at every turn on shaking table, with sample diluting liquid sealase more than target 4h at 37 DEG C.
C) emiocytosis liquid is added, wherein B1-B4 primary antibodie does not add object juice but adds ghost SP2/0 cell culture fluid every hole 100 μ l, all the other add the cell strain juice every hole 100 μ l secreting anti-ST high-affinity, hatch 2h for 37 DEG C, then clean 3 times with washings.
D) resist two: sheep anti-Mouse-HRP is by 1: 3000-1: 5000 dilutions, and add respectively in hand-hole, every hole 100 μ l, hatches 2h for 37 DEG C, then clean 3 times with washings, wherein H1-H4 does not add sheep anti-Mouse-HRP two and resists, and only adds 100 μ lPBS.
E) add horseradish peroxidase substrate buffer solution 100 μ l, after colour developing 5min, add stop buffer 100 μ l, color development stopping, detect the value of OD450 by microplate reader.
Experimental result is as shown in table 1:
The cross reaction detected result of table 1 antibody A SH
1 | 2 | 3 | 4 | |
A | 0.104 | 0.118 | 0.14 | 0.14 |
B | 0.132 | 0.113 | 0.121 | 0.125 |
C | 1.438 | 1.242 | 0.143 | 0.155 |
D | 1.137 | 1.132 | 0.164 | 0.125 |
E | 1.14 | 1.149 | 0.164 | 0.125 |
F | 1.124 | 1.181 | 0.154 | 0.159 |
G | 1.252 | 1.244 | 0.185 | 0.118 |
H | 0.171 | 0.128 | 0.161 | 0.151 |
Above-mentioned experimental result display, the present invention obtains monoclonal antibody antibody ASH and can specificly be combined with ST, and is not combined with BSA, human serum albumin, and the light absorption value of ASH antibody and the not combination of synantigen as shown in Figure 1.
3, Westem Blot detects
(1) by BSA-ST and BSA protein example, SDS-PAGE electrophoresis is done;
(2) transferring film: by the gel after SDS-PAGE electrophoresis, energising transfer, low temperature constant voltage 80V shifts 3h, by the protein delivery on gel on pvdf membrane;
(3) close: after transferring film terminates, careful taking-up gel and film, cut off to mark by one of film jiao, can observe the band of pre-dyed Marker on film, film is put into the container filling confining liquid (skim-milk of 5%), room temperature shaker closes 1h;
(4) primary antibodie is hatched: with skim-milk dilution primary antibodie (antibody A SH) of 5%, often open film and be about 4ml; Pvdf membrane after closing carefully is put into hybridization bag, then adds the primary antibodie solution prepared, carefully get rid of bubble, after sealing machine sealing, under room temperature, shaking table slowly sways and hatches 1-3h; Film is taken out, washes film 3 times with TBST shaking table, each 5min, to remove residual primary antibodie.
(5) two anti-hatch: the skim-milk with 5% resists (usual 1: 4000) by two anti-specification sheets dilution proportion two, pvdf membrane is carefully placed in hybridization bag, often opens film and add the two anti-solution that 4ml prepares, avoid bubble to produce, seal hybrid belt mouth, room temperature shaker hatches 2h; After hatching, film is taken out, wash film 3 times with TBST shaking table, each 10min;
(6) hatched after two anti-film TBST wash film, added luminescent solution A, B and expose in darkroom.
As shown in Figure 2, antibody A SH and ST combination, be not combined with BSA Westem Blot detected result.
The fishing that is light, heavy chain gene of embodiment three anti-sterigmatocystin monoclonal antibody ASH is got
1. material
DNA fragmentation purification kit: OMEGA biotechnology Products; T4DNA ligase enzyme: NewEngland Biolabs product; Carrier PGEM Teasy:Promega Products; Competence bacterium JM109: purchased from Promega company, primer is as follows:
VLPD:GCGCCGTCTAGAATTAACACTCATTCCTGTTGAA
VHPD:GTTCTGACTAGTGGGCACTCTGGGCTC
VHPU5:AGGTCCAACTGCTCGAGTCTGG
VHPU6:AGGTCCAACTGCTCGAGTCAGG
VHPU7:AGGTCCAACTTCTCGAGTCTGG
VHPU8:AGGTCCAACTTCTCGAGTCAGG
VLPU5:CCAGATGTGAGCTCGTGATGACCCAGACTCCA
VLPU6:CCAGATGTGAGCTCGTCATGACCCAGTCTCCA
VLPU7:CCAGTTCCGAGCTCGTGATGACACAGTCTCCA
All the other are with embodiment two.
2. methods and results
(1) Example 2 screens the cell 5 × 10 of the logarithmic phase obtained
6~ 1 × 10
7individual, centrifugal segregation supernatant, evenly upsprings cell.Add 1ml TRJzol (Invitrogen) repeatedly to blow and beat and make the abundant cracking of cell, vibrate after 3 minutes, add 0.2ml chloroform, vibrate 15 seconds, room temperature places 2 ~ 3min, 4 DEG C of 12000r/min, centrifugal 10min, get supernatant in another new pipe, after adding 500 μ l Virahol mixings, room temperature places 10 minutes, 4 DEG C of centrifugal 10min of 12000r/min.75% washing with alcohol precipitation, after drying, precipitates without the deionized water dissolving of RNA enzyme with 25 μ l.
(2) solution of 4 μ l total serum IgE is got, add AMV5 × damping fluid 4 μ l successively, Oligo (dT) (500ng/ μ l) 0.5 μ l, 2.5mmol/L dNTP2 μ l, Rnasin (50U/ μ l) 0.5 μ l, mend deionized water to 20 μ l, ThermoScript II 4U, 42 DEG C extend 1 hour.95 DEG C of sex change 5min, put in ice bath, and product is cDNA first chain.Heavy chain amplimer: VHPD+ upstream, downstream VHPU5-8; Light chain amplimer: VLPD+ upstream, downstream VLPU5-7; In 20 μ l PCR reaction systems, add reverse transcription product 2 μ l respectively, Taq enzyme 10 × buffer2 μ l, upstream and downstream primer each 1 μ l, 2.5mmol/L dNTP1 μ l, adds Taq enzyme 2U, mends deionized water to 20 μ l.95 DEG C of sex change 2 minutes, loop parameter is: 94 DEG C of 1min, 55 DEG C of 1min, 72 DEG C of 1min, and totally 30 circulations, extend 10min after 72 DEG C.
(3) amplified production second step obtained, carry out agarose gel electrophoresis, under long wave ultraviolet light, the blob of viscose containing target DNA fragment is cut after electrophoresis, with DNA fragmentation purification kit recovery DNA fragmentation and by the DNA fragmentation of purifying 20 μ l sterilized water wash-outs, after the DNA fragmentation reclaimed is mixed in the ratio (mol ratio) of 3: 1 and carrier PGEM Teasy in T4DNA ligase enzyme damping fluid, the T4DNA ligase enzyme adding 1U spends the night in 16 DEG C of connections, and the cumulative volume of ligation is 10 μ L.
(4) above-mentioned (3) step connecting fluid 10 μ l is got and 90 μ l competence bacterium JM109 softly mix, ice bath 30min, 42 DEG C of water-bath heat-shockeds 90 seconds, proceed to rapidly ice bath 3min, add 400 μ l2YT substratum, at 37 DEG C of constant-temperature tables, the centrifugal 1min of wave and culture 45min, 8000r/min, discards 300 μ l supernatants, get the solid 2YT that precipitation coats containing Amp (final concentration is 100 μ g/ml) dull and stereotyped, flat-plate inverted is placed in 37 DEG C of incubator 12 ~ 18h.
(5) the single clone of picking in above-mentioned flat board, is inoculated in the 2YT substratum containing acillin (100 μ g/ml).37 DEG C of constant-temperature table 120rpm, concussion overnight incubation.Getting 3ml bacterium liquid adds in 1.5mlEppendorf pipe, and the centrifugal 1min of 10000r/min, abandons supernatant.Carry middle amount test kit (TIANGEN Biotech (Beijing) Co., Ltd.) extract bacterial plasmid with high purity plasmid is little, dissolve with 40 μ L aseptic double-distilled waters, carry out PCR qualification and DNA sequencing analysis.
Carrier that is light containing anti-sterigmatocystin antibody A SH, heavy chain gene is constructed by above-mentioned steps, be that mouse immuning ball protein is light, heavy chain gene through sequencing analysis, sequence alignment, the aminoacid sequence of its correspondence is respectively SEQ ID NO:1, SEQ ID NO:2.
The qualification of the protein subunit of the anti-sterigmatocystin antibody of embodiment 4
1, material:
Monoclonal antibody parting kit, ELISA coating buffer, PBST, TMB, H
2sO
4.
2 methods and result:
According to monoclonal antibody parting kit working instructions, adopt the ELISA of antigen mediation to carry out antibody subtype qualification, concrete steps are as follows:
1) bag quilt: with PH=9.6 carbonate buffer solution dilution BSA-ST bag by enzyme linked immunological plate, spend the night in 4 DEG C; Dry after washing plate 4 times with PBST;
2) close: with containing the PBS confining liquid of 1%BSA, every hole 200 μ l, hatches 1h for 37 DEG C, dries after washing plate 4 times with PBST.
3) the anti-sterigmatocystin antibody 10 μ g/mL that purifying obtains is added, every hole 100 μ l, totally 12 holes, hatch 1h for 37 DEG C, PBST washes plate 4 times, add monoclonal antibody (IgA, IgM, IgG1, Ig2a, Ig2b, IgG3) the subtype typing antibody 100 μ l/ hole of 1: 1000 dilution, hatch 45min for 37 DEG C, the samely to wash.
4) the anti-goat three of rabbit adding the horseradish peroxidase-labeled of 1: 1000 dilution resists, and hatches 45min for 37 DEG C, washes plate 7 times with PBST.
5) develop the color: add the reaction of TMB room temperature lucifuge 5 ~ 10min, 2M H
2sO
4termination reaction; OD value is measured in 450nm wavelength,
6) judge: according to the light absorption value that different subtype two is anti-, judge hypotype belonging to anti-sterigmatocystin antibody, according to the result of table 2 light absorption value, judge anti-human CD-31 IgG antibody 1.
Table 2 anti-sterigmatocystin antibody protein hypotype qualification ELISA result
Above experimental result display, the antibody A SH that the present invention obtains is IgG2a.
Embodiment 5 one kinds detects the preparation of the ELISA detection kit of sterigmatocystin
1, material
Anti-versicolorin A SH antibody (1mg/ml), anti-versicolorin A SP1 antibody (1mg/ml), horseradish peroxidase (HRP), 4-(N-maleimidomehyl) hexanaphthene-1-carboxylic acid sulfonic group succinimide ester sodium salt (sulfo-SMCC), Sephadex G25, phosphate buffered saline buffer (PBS), BSA, ST, NaBH
4.Wherein anti-versicolorin A SP1 antibody is that contriver screens the ScFv antibody obtained by phage library, and wherein ASP1 heavy chain amino acid sequence is as sequence table SEQ ID NO.3, and light-chain amino acid sequence is as sequence table SEQ ID NO.4.
2, method
2.1. the coupling of anti-versicolorin A SP1 antibody and horseradish peroxidase
1) the ASP1 antibody that purifying is good carries out 0.01M PBS dialysis and removes all possible material containing NH3, and such as TRIS alkali etc., 3M NaOH regulates pH value about 7.
2) by Sulfo-SMCC specification sheets, dissolve sulfo-SMCC with pure water, ASP1 antibody and Sulfo-SMCC=1: 100 ratio, under agitation sulfo-SMCC dropwise is slowly added in ASP1 antibody-solutions, more than stirring at room temperature 30min.
3) with equilibration buffer Sephadex G25 post 30min, completely reacted sulfo-smcc/ASP1 antibody mixing liquid is crossed post, collects protein conjugate climax, to remove free sulfo-smcc with ultraviolet detection instrument.
4) getting and dissolve with the HRP PBS of ASP1 antibody equivalent, then when stirring, slowly joining in ASP1+Sulfo-SMCC mixture, room temperature reaction more than 2 hours.
5) removed by sieve chromatography, HRP and ASP1+Sulfo-SMCC of non-coupling, be finally thoroughly coupled at HRP-Sulfo-SMCC-ASP1 mixture together.
6) antibody of mark is added 20%-50% glycerine in-20 DEG C of preservations.
2.2. the ELISA kit assembling of sterigmatocystin is detected
The ELISA kit detecting sterigmatocystin comprises: the anti-versicolorin A SP1 antibody (HRP-Sulfo-SMCC-ASP1) of anti-versicolorin A SH antibody, HRP mark, horseradish peroxidase substrate buffer solution, protein standard substance ST (100ug/ml, 0.1ml), negative control sample BSA.Wherein horseradish peroxidase substrate buffer solution: take 10mg3,3 ', 5,5 '-tetramethyl benzidine (TMB) is dissolved in 5ml dehydrated alcohol and is prepared into TMB stock solution.Get 0.5ml TMB stock solution time to be used and be added to 10ml phosphate citrate acid substrate buffer solution (0.2MNa
2hPO
4, 0.1M citric acid) in, then add 32 μ l0.75%H
2o
2mixing, is configured to horseradish peroxidase substrate buffer solution.
The using method of the ELISA kit of 2.3 detection sterigmatocystins:
G) anti-versicolorin A SH antibody (1mg/ml) diluted by 1: 320 with coating buffer (PH9.60.05M carbonate buffer solution), get the ASH antibody diluent after dilution, add in enzyme plate, every hole 100 μ l, 4 DEG C are spent the night;
H) washings (PH7.4PBS) cleaning of enzyme target 3 times, shakes 5-8min at every turn on shaking table;
I) getting 100 μ l testing samples joins in the enzyme plate of bag quilt, hatch 2h for 37 DEG C, standard substance, by 2 holes, are carried out gradient dilution simultaneously and are followed successively by 5pg/ul, 10pg/ul, 15pg/ul, 20pg/ul25pg/ul, 30pg/ul by each sample bag, every hole 100 μ l;
J) the antibody A SP1 (HRP-Sulfo-SMCC-ASP1) horseradish peroxidase marked is by 1: 3000 ~ 1: 5000 dilutions, and every hole 100 μ l, hatches 2h for 37 DEG C;
K) clean 5 times with washings again, add horseradish peroxidase substrate buffer solution 100 μ l, after colour developing 5min, add stop buffer 100 μ l, color development stopping;
L) detect the value of OD450 by microplate reader, the light absorption value preparation standard curve of establishing criteria product, thus judge the concentration of ST in institute's test sample product according to light absorption value.
The susceptibility that embodiment 6 one kinds detects the ELISA kit of sterigmatocystin detects
The sensitivity of the ELISA kit prepared by embodiment 5 is detected by standard substance, the extent of dilution of standard substance ST is as follows: 500pg/ μ l, 250pg/ μ l, 125pg/ μ l, 62.5pg/ μ l, 31.25pg/ μ l, 15.625pg/ μ l, 7.8125pg/ μ l, 3.90625pg/ μ l, 1.953125pg/ μ l, 0.9765625pg/ μ l, 0.4882812pg/ μ l, 0.2441406pg/ μ l, above extent of dilution wraps the hole be numbered as on 1-12 enzyme plate successively, ELISA step as described in Example 5, the results are shown in Table 3
The susceptibility of table 3ELISA test kit detects
1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | |
A | 2.481 | 2.518 | 1.129 | 1.091 | 0.599 | 0.489 | 0.148 | 0.107 | 0.108 | 0.086 | 0.063 | 0.055 |
B | 2.135 | 1.465 | 1.482 | 0.86 | 0.801 | 0.347 | 0.158 | 0.15 | 0.1 | 0.077 | 0.069 | 0.055 |
C | 2.01 | 2.455 | 1.523 | 0.99 | 0.918 | 0.893 | 0.125 | 0.122 | 0.108 | 0.076 | 0.073 | 0.053 |
D | 2.618 | 1.94 | 1.064 | 0.952 | 0.908 | 0.291 | 0.057 | 0.053 | 0.047 | 0.045 | 0.045 | 0.083 |
A, B, C, D are the multiple hole of different concns, and above result display, the minimum quantity that test kit of the present invention can detect is 10pg/ μ l.
Claims (7)
1. an anti-sterigmatocystin monoclonal antibody, comprises light chain and heavy chain, it is characterized in that, the aminoacid sequence of described variable region of light chain is as shown in SEQ ID NO:1 in sequence table; The aminoacid sequence of described variable region of heavy chain is as shown in SEQ ID NO:2 in sequence table.
2. monoclonal antibody according to claim 1 is preparing the application in reagent, medicament or the test kit detecting sterigmatocystin.
3. one kind is detected sterigmatocystin test kit, it is characterized in that, described test kit comprises: antibody according to claim 1, anti-versicolorin A SP1 antibody, and the aminoacid sequence of wherein said its variable region of light chain of ASP1 antibody is as shown in SEQ ID NO:3 in sequence table; The aminoacid sequence of the variable region of heavy chain of described ASP1 antibody is as shown in SEQ ID NO:4 in sequence table.
4. detection sterigmatocystin test kit according to claim 3, is characterized in that, described anti-versicolorin A SP1 antibody is with biomarker or chemical labeling, and described biomarker or chemical labeling are fluorescent mark, radio-labeling or enzyme labelling.
5. detection sterigmatocystin test kit according to claim 3, is characterized in that, described anti-versicolorin A SP1 antibody is horseradish peroxidase mark.
6. detection sterigmatocystin test kit according to claim 5, it is characterized in that, described test kit also comprises: horseradish peroxidase substrate buffer solution, 100 μ g/ml ST standard substance 0.1ml, negative control sample BSA.
7. a method for the detection sterigmatocystin of non-diagnostic object, comprises the following steps:
A) by anti-sterigmatocystin antibody according to claim 1, concentration is 1mg/ml, and dilute by 1: 320 as coating buffer with the carbonate buffer solution of pH9.6 0.05M, get the antibody diluent after dilution, add in enzyme plate, every hole 100 μ l, 4 DEG C are spent the night;
B) pH7.4PBS is as washings cleaning of enzyme target 3 times, shakes 5-8min on shaking table at every turn;
C) getting 100 μ l testing samples joins in the enzyme plate of bag quilt, hatch 2h for 37 DEG C, standard substance, by 2 holes, are carried out gradient dilution simultaneously and are followed successively by 5pg/ul, 10pg/ul, 15pg/ul, 20pg/ul, 25pg/ul, 30pg/ul by each sample bag, every hole 100 μ l;
D) antibody A SP1 horseradish peroxidase marked is by 1: 3000 ~ 1: 5000 dilutions, and every hole 100 μ l, hatches 2h for 37 DEG C;
E) clean 5 times with washings again, add horseradish peroxidase substrate buffer solution 100 μ l, after colour developing 5min, add stop buffer 100 μ l, color development stopping;
F) detect the value of OD450 by microplate reader, the light absorption value preparation standard curve of establishing criteria product, thus judge the concentration of ST in institute's test sample product according to light absorption value.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310136959.3A CN103214572B (en) | 2013-04-19 | 2013-04-19 | Anti-sterigmatocystin monoclonal antibody |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310136959.3A CN103214572B (en) | 2013-04-19 | 2013-04-19 | Anti-sterigmatocystin monoclonal antibody |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103214572A CN103214572A (en) | 2013-07-24 |
CN103214572B true CN103214572B (en) | 2015-04-08 |
Family
ID=48812774
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310136959.3A Expired - Fee Related CN103214572B (en) | 2013-04-19 | 2013-04-19 | Anti-sterigmatocystin monoclonal antibody |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103214572B (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103849604B (en) * | 2014-03-26 | 2015-03-11 | 中国农业科学院油料作物研究所 | Hybridoma cell strain ST03, anti-aflatoxin biosynthesis precursor ST monoclonal antibody and application thereof |
CN105199965B (en) * | 2015-08-19 | 2019-01-08 | 广东省微生物研究所 | One plant of Soxhlet Bipolaris and application thereof |
-
2013
- 2013-04-19 CN CN201310136959.3A patent/CN103214572B/en not_active Expired - Fee Related
Non-Patent Citations (3)
Title |
---|
单克隆抗体在真菌毒素检测中的应用进展;刘江;《国外医学卫生学分册》;19951231;第22卷(第2期);90-93 * |
杂色曲霉素单克隆抗体的研制与特性鉴定;楼建龙 等;《中华预防医学杂志》;19950331;第29卷(第2期);92-95 * |
粮食中杂色曲霉素酶联免疫吸附测定方法;田禾菁 等;《卫生研究》;20040131;第33卷(第1期);111 * |
Also Published As
Publication number | Publication date |
---|---|
CN103214572A (en) | 2013-07-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN108884152A (en) | Identify the screening technique of the antibody of combination cell surface epitope | |
CN106366188B (en) | The monoclonal antibody and its cell strain of porcine epidemic diarrhea resisting virus and application | |
CN104480072B (en) | Hybridoma cell strain secreting anti-amantadine monoclonal antibody and application of hybridoma cell strain | |
CN107033242B (en) | A kind of monoclonal antibody and application of the anti-Ebola virus envelope glycoprotein of source of people | |
CN103665152B (en) | Canine parvovirus single domain antibody and its preparation method and application | |
CN107459574A (en) | A kind of PRV gB monoclonal antibodies and its application | |
CN108329378A (en) | Senecan paddy virus VP 1 albumen, encoding gene, hybridoma cell strain and monoclonal antibody and its application | |
CN106350533A (en) | Anti-PD-L1-CAR-T, and preparation method and application thereof | |
CN101592661B (en) | Brucellosis antibody competitive enzyme-linked immunosorbent assay reagent kit | |
CN101519447A (en) | Anti-rabbit hemorrhagic disease virus VP60 albumen monoclonal antibody | |
CN106282214A (en) | A kind of method of quick acquisition nano antibody and application thereof | |
CN102621329A (en) | Bird's-nest enzyme linked immunosorbent assay kit | |
CN107475203A (en) | A kind of H7 avian influenza virus monoclonal antibody and application | |
CN107449912B (en) | Anti- H7N9 subtype avian influenza virus monoclonal antibody antigen epitope and its screening technique and application | |
CN110441512A (en) | A kind of colloidal gold immunochromatographimethod detection device of ethylmaltol haptens and ethylmaltol | |
CN101429250A (en) | Mold toxin penicillic acid monoclone antibody and preparation method thereof | |
CN103214572B (en) | Anti-sterigmatocystin monoclonal antibody | |
CN109705216B (en) | Monoclonal antibody for resisting bovine skeletal muscle troponin I and application thereof | |
CN106990247A (en) | Colloidal gold strip of 1 type and 3 type duck hepatitis A virus and preparation method thereof is detected simultaneously | |
CN106589124A (en) | Application of CD146 monoclonal antibody in detection and separation and identification of glioma perivascular cells | |
CN103777015A (en) | Colloidal gold test strip and method for detecting erythromycin | |
CN104965083B (en) | A kind of kit of detection H3N2 hypotype canine influenza virus | |
CN1920571A (en) | Fast detection method of poultry and animal epiornitic and drug residues self hemagglutination | |
CN103713133A (en) | Test strip for detecting spiramycin, streptomycin, gentamycin and neomycin, and method | |
CN103777018A (en) | Preparation method of test strip for rapidly diagnosing porcine contagious pleuropneumonia actinobacillus |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
DD01 | Delivery of document by public notice | ||
DD01 | Delivery of document by public notice |
Addressee: Jiang Feijian Document name: payment instructions |
|
DD01 | Delivery of document by public notice | ||
DD01 | Delivery of document by public notice |
Addressee: Jiang Feijian Document name: Notice of termination of patent right |
|
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150408 Termination date: 20210419 |