CN103207173A - Enzymological detection method - Google Patents
Enzymological detection method Download PDFInfo
- Publication number
- CN103207173A CN103207173A CN2013100787296A CN201310078729A CN103207173A CN 103207173 A CN103207173 A CN 103207173A CN 2013100787296 A CN2013100787296 A CN 2013100787296A CN 201310078729 A CN201310078729 A CN 201310078729A CN 103207173 A CN103207173 A CN 103207173A
- Authority
- CN
- China
- Prior art keywords
- concentration
- detection
- citrulline
- atp
- adma
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
- G01N21/76—Chemiluminescence; Bioluminescence
Landscapes
- Physics & Mathematics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Plasma & Fusion (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to the technical field of measuring and testing and discloses an enzymological detection method for detecting concentrations of citrulline, asymmetric dimethylarginine and the like in a reaction system by ATP (adenosine triphosphate) detection. According to the basic principle of reaction, ADMA (asymmetric dimethylarginine) is hydrolyzed by dimethylarginine dimethylaminohydrolase to obtain citrulline; in the presence of ADP (adenosine diphosphate) and Mg2+, the citrulline is subjected to coupling catalysis through ornithine carbamoyl transferase and carbamyl phosphokinase to finally obtain ornithine, carbon dioxide, ammonia, and ATP, and the released ATP is detectable by reagents. The enzymological detection method has the main advantages that reaction is sensitive, quick and highly accurate, the price is low, the ADMA or citrulline with the least concentration of 0.1 micromol/L can be detected, the detected concentration is approximate to the concentration of the ADMA in normal physiological serum and is far lower than the concentration of citrulline in the normal physiological serum, and a new available method for clinical ADMA detection is provided.
Description
Technical field
The present invention relates to the medical test technical field, particularly the zymetology detection method that detects of a kind of ATP of utilization chemoluminescence method.
Background technology
Ng,Ng-Dimethylarginine (Asymmetric dimethylarginine, ADMA) be the protein degradation products that methylates, it is nitric oxide synthase inhibitors, the activity of the emulative inhibition nitricoxide synthase of energy, reduce nitrogen monoxide and generate, and can directly induce oxidative stress, as the endogenous relaxing factor, nitrogen monoxide has vasodilatory function, is bringing into play important effect in the disease of cardiovascular system.ADMA extensively is present in people's tissue, cell, blood plasma, the urine, mainly methylated under the effect of arginine methyltransferase by intracellular protein, generate through hydrolysis reaction again, the ADMA of 80 % is through diethylarginine dimethylamine hydrolytic enzyme (DDAH) metabolic inactivation ADMA in its human body, have only seldom partly to excrete through kidney with prototype form, so become the principal mode of internal metabolism with DDAH degraded ADMA.
Citrulline is a kind of alpha amino acid, be to generate urea cycle from ornithine and amido first vinegar phosphate, or seeing through nitricoxide synthase (NOS) catalysis generates arginic accessory substance, content and the multiple disease association of citrulline in the body.
Lot of domestic and international studies show that at present, and the content of ADMA and a lot of disease are as coronary heart disease, and hyperlipemia is pressed, and essential hypertension etc. are closely related, and ADMA has been acknowledged as a kind of new angiocardiopathy risk factor.ADMA is also closely related with organ function depletion, and the ADMA degraded is descended in the renal function damage and metabolism reduces.ADMA content has in vivo become the indicator that diagnoses the illness, therefore sets up the new detection method of ADMA and has very important significance.
ADMA mainly detects by high pressure liquid phase and euzymelinked immunosorbent assay (ELISA) means such as (as the inventions of CN102243227A) at present, but its complicated operation, consuming time long, expensive, need special instrument and equipment, can not be applied to the automated analysis of clinical big flow, it is just very necessary therefore to explore new ADMA detection method.
The detection of ATP biochemiluminescence method is sensitive, simple and accuracy is high, usually is used to detect the ATP of low concentration, is used widely in fields such as food hygienes.The least concentration that traditional ATP detection kit detects is 0.01 pmol/L, and the concentration of ADMA is approximately 0.1-1 μ mol/L in the normal human serum, therefore can provide a kind of possible new method for detecting ADMA with chemoluminescence method, have high scientific value and economic worth.
Summary of the invention
It is consuming time to the objective of the invention is to overcome existing detection Ng,Ng-Dimethylarginine assay method, complicated operation, need specific apparatus, can not be applied to the automated analysis of clinical big flow, and defective such as expensive, and provide a kind of zymetology detection method, this method has the sensitivity of detection, rapidly, the accuracy height, and characteristics such as low price, can realize the detection of the Ng,Ng-Dimethylarginine of low concentration and citrulline etc., be fit to detect the Ng,Ng-Dimethylarginine of physiological concentration, make clinical practice become possibility, have scientific value and economic worth preferably.
Detection method of the present invention can also detect the concentration of citrulline, arginine, diethylarginine dimethylamine hydrolytic enzyme, ornithine carbamyl transferase, arginine deiminase etc. simultaneously.
The technical solution adopted for the present invention to solve the technical problems is:
A kind of zymetology detection method detects the ATP that citrulline generates in the sample to be tested after ornithine carbamyl transferase and carbamyl phosphate kinases coupling reaction, and is converted into the concentration of target detection thing.Sample to be tested of the present invention can be urine, serum, blood plasma, cerebrospinal fluid, saliva etc.
Detection reaction principle of the present invention is as follows:
。
The ArcB that the present invention relates to had both had the ability of decomposing citrulline, the ability that equally also has synthetic citrulline, and its synthetic citrulline ability is much larger than its capacity of decomposition, but for the present invention, what need is the ability that its forward decomposes citrulline, just can better impel its reaction forward to decompose and add ArcC in system.
As preferably, described target detection thing is citrulline, Ng,Ng-Dimethylarginine, arginine, diethylarginine dimethylamine hydrolytic enzyme, ornithine carbamyl transferase or arginine deiminase.
As preferably, the concrete operations of described zymetology detection method are: sample to be detected is put into detected reagent and form detection architecture, behind the 20-40 ℃ of reaction 15-40min, detect reagent with ATP and detect ATP concentration, converting obtains the concentration of target detection thing.
As preferably, ATP detects reagent and comprises luciferase and luciferin.Can adopt commercially available ATP detection kit.
As preferably, detection architecture comprises following component: ornithine carbamyl transferase 1-300 μ g/mL, carbamyl phosphate kinases 1-300 μ g/mL, sample to be tested.
Concrete detection architecture is as follows:
1, being used for the target detection thing is that the per 100 μ L detection architecture components of detection architecture of citrulline are as follows: pH 5.5-8.5 damping fluid 50-100mmol/L, ADP 0.1-10 μ mol/L, Mg
2+1-100 μ mol/L, ornithine carbamyl transferase 1-300 μ g/mL, carbamyl phosphate kinases 1-300 μ g/mL, sample to be tested.As preferably, the per 100 μ L detection architecture components of detection architecture that are used for the target detection thing and are citrulline are as follows: pH 6.5-7.5 damping fluid 50-100mmol/L, ADP 0.5-3 μ mol/L, Mg
2+10-50 μ mol/L, ornithine carbamyl transferase 100-200 μ g/mL, carbamyl phosphate kinases 100-200 μ g/mL, sample to be tested.
,The per 100 μ L detection architecture components of detection architecture that are used for the target detection thing and are Ng,Ng-Dimethylarginine are as follows: pH 5.5-8.5 damping fluid 50-100mmol/L, ADP 0.1-10 μ mol/L, Mg
2+1-100 μ mol/L, ornithine carbamyl transferase 1-300 μ g/mL, carbamyl phosphate kinases 1-300 μ g/mL, diethylarginine dimethylamine hydrolytic enzyme 1-300 μ g/mL, sample to be tested.As preferably, the per 100 μ L detection architecture components of detection architecture that are used for the target detection thing and are Ng,Ng-Dimethylarginine are as follows: pH6.5-7.5 damping fluid 50-100mmol/L, ADP 0.5-3 μ mol/L, Mg
2+10-50 μ mol/L, ornithine carbamyl transferase 100-200 μ g/mL, carbamyl phosphate kinases 100-200 μ g/mL, diethylarginine dimethylamine hydrolase 10 0-200 μ g/mL, sample to be tested.
Described damping fluid is selected from a kind of in phosphate buffer, Tris-HCL, HEPES damping fluid, MOPS damping fluid, the citric acid-sodium citrate damping fluid, when described damping fluid is a kind of in Tris-HCL, HEPES damping fluid, MOPS damping fluid, the citric acid-sodium citrate damping fluid, also contain the phosphate anion of 50-100mmol/L in the described damping fluid.Reaction system of the present invention needs phosphate radical, gets final product when damping fluid need not additionally to add phosphate radical during for phosphate buffer, and is more convenient like this, when damping fluid be other when several, then need additionally to add phosphate radical.
As preferably, described ornithine carbamyl transferase and carbamyl phosphate kinases all derive from Pseudomonas aeruginosa.Be that ornithine carbamyl transferase (ArcB) and carbamyl phosphate kinases (ArcC) have been cloned in the source with the Pseudomonas aeruginosa, there is the citrulline metabolic pathway in Pseudomonas aeruginosa, to compare security good with other fracisella tularesis etc., so selected this bacterial strain as enzyme source.The present invention when clone ArcB and ArcC, selected the pET28a expression vector and
E.coliBL21(DE3) expression strain, this carrier is controlled by t7 rna polymerase as prokaryotic expression carrier, its bacterial strain provides t7 rna polymerase, so when not inducing, destination protein is expressed hardly, and when fully inducing, has very high expression, and have affinity tag on its carrier, be fit to very much affinity purification, therefore selected this bacterial strain and carrier.
The kinase whose concrete preparation method of described ornithine carbamyl transferase and carbamyl phosphate is: be template with the Pseudomonas aeruginosa genome, carry out pcr amplification, the purpose fragment enzyme that obtains is cut and is connected to the pET28a expression vector establishment and becomes pET28a-ArcB and pET28a-ArcC, transforms then
E.coliBL21 bacterial strain, abduction delivering and purifying.
The pcr amplification the primer is F-ArcB, R-ArcB, F-ArcC and R-ArcC, and the sequence of F-ArcB is SEQ ID NO.1, and the sequence of R-ArcB is SEQ ID NO.2, and the sequence of F-ArcC is SEQ ID NO.3, and the sequence of R-ArcC is SEQ ID NO.4.
F-ArcB：CGCCATATGGCTTTCAACATGCACAACCGTAAC (SEQ ID NO.1)。
R-ArcB：CCGCTCGAGTTAGATGTCGGCGAGGGTCGA (SEQ ID NO.2)。
F-ArcC：CGCATATGCGTATCGTCGTCGCATT (SEQ ID NO.3)。
R-ArcC：AACTCGAGTCAGCGGTACTCGATGCC (SEQ ID NO.4)。
The invention has the beneficial effects as follows: set up first with chemoluminescence method and detected ADMA and citrulline, this method detection is sensitive, easy and simple to handle, reaction is quick, accuracy is high and cost is low, make ADMA become possibility for conventional sense project clinically, have high scientific value and economic worth.
Description of drawings
Fig. 1 is the pcr amplification of ornithine carbamyl transferase (ArcB).
Fig. 2 is the pcr amplification of carbamyl phosphate kinases (ArcC).
Fig. 3 is that ArcB and ArcC recombinant vector enzyme are cut checking
1.DNA standard molecular weight; 2. before the pET28a-ArcB enzyme is cut; 3. pET28a-ArcB single endonuclease digestion; 4. pET28a-ArcB double digestion; 5. before the pET28a-ArcC enzyme is cut; 6. pET28a-ArcC single endonuclease digestion; 7. pET28a-ArcC double digestion.
Fig. 4 is ArcB abduction delivering purifying
1 ﹑ 10.Marker; 2. before inducing; 3. after inducing; 4. broken supernatant; 5. fragmentation precipitation; 6-8. penetrate liquid; 9.10 mmol/L imidazoles wash-out; 11. 20 mmol/L imidazoles wash-outs; 12 ﹑, 13. 50 mmol/L imidazoles wash-outs; 14. 100 mmol/L imidazoles wash-outs; 15 ﹑, 16.250 mmol/L imidazoles wash-outs; 17. 500 mmol/L imidazoles wash-outs.
Fig. 5 is ArcC abduction delivering purifying
1 ﹑ 6.Marker; 2. before inducing; 3. after inducing; 4. broken supernatant; 5. fragmentation precipitation; 7 ﹑ 8. penetrate liquid; 9.10 mmol/L imidazoles wash-out; 10. 20 mmol/L imidazoles wash-outs; 11. 50 mmol/L imidazoles wash-outs; 12. 100 mmol/L imidazoles wash-outs; 13.250 mmol/L imidazoles wash-out; 14. 500 mmol/L imidazoles wash-outs.
Fig. 6 is that TLC thin-layer chromatography checking ArcB and ArcC conjugate enzyme are lived
1 ﹑, 4. citrulline standard items; 2. ArcB catalyzing hydrolysis citrulline product; 3 ﹑, 6. ornithine standard items; 5. inactivation ArcB catalyzing hydrolysis citrulline product.
Fig. 7 is the NADH typical curve of surveying ammonia process.
Fig. 8 is the typical curve that the present invention detects ATP.
Fig. 9 is that the present invention detects the citrulline concentration curve.
Figure 10 is that the present invention detects the ADMA concentration curve.
Figure 11 is that the present invention detects citrulline and the ADMA in the urine.
Embodiment
Below by specific embodiment, and by reference to the accompanying drawings, technical scheme of the present invention is described in further detail.
Among the present invention, if not refer in particular to, the raw material that adopts and equipment etc. all can be buied from market or this area is commonly used.Method among the following embodiment if no special instructions, is the conventional method of this area.
A kind of zymetology detection method detects the ATP that citrulline generates in the sample to be tested after ornithine carbamyl transferase and carbamyl phosphate kinases coupling reaction, and is converted into the concentration of target detection thing.Described target detection thing is citrulline, Ng,Ng-Dimethylarginine, arginine, diethylarginine dimethylamine hydrolytic enzyme, ornithine carbamyl transferase or arginine deiminase.
The concrete operations of zymetology detection method are: sample to be detected is put into detection reagent form detection architecture, behind the 20-40 ℃ of reaction 15-40min, detect ATP concentration with the ATP detection kit, the concentration of the acquisition target detection thing that converts.
The per 100 μ L detection architecture components of detection architecture that are used for the target detection thing and are citrulline are as follows:
PH 5.5-8.5 damping fluid 50-100mmol/L, ADP 0.1-10 μ mol/L, Mg
2+1-100 μ mol/L, ornithine carbamyl transferase 1-300 μ g/mL, carbamyl phosphate kinases 1-300 μ g/mL, sample to be tested.
The per 100 μ L detection architecture components of detection architecture that are used for the target detection thing and are Ng,Ng-Dimethylarginine are as follows:
PH 5.5-8.5 damping fluid 50-100mmol/L, ADP 0.1-10 μ mol/L, Mg
2+1-100 μ mol/L, ornithine carbamyl transferase 1-300 μ g/mL, carbamyl phosphate kinases 1-300 μ g/mL, diethylarginine dimethylamine hydrolytic enzyme 1-300 μ g/mL, sample to be tested.
Described damping fluid is selected from a kind of in phosphate buffer, Tris-HCL, HEPES damping fluid, MOPS damping fluid, the citric acid-sodium citrate damping fluid, when described damping fluid is a kind of in Tris-HCL, HEPES damping fluid (50mmol/L), MOPS damping fluid (50mmol/L), the citric acid-sodium citrate damping fluid (50mmol/L), also contain the phosphate anion (optimum condition) of 100mmol/L in the described damping fluid.
When detecting Ng,Ng-Dimethylarginine, under not having diethylarginine dimethylamine hydrolytic enzyme, detect earlier the original citrulline concentration that itself contains in the sample to be tested (converting by ATP), add diethylarginine dimethylamine hydrolytic enzyme then and be used for hydrolysis Ng,Ng-Dimethylarginine acquisition citrulline, detect and obtain total citrulline concentration (converting by ATP), the difference that total citrulline concentration deducts original citrulline concentration can convert and obtain Ng,Ng-Dimethylarginine concentration.
1, the genomic extraction of Pseudomonas aeruginosa
Pseudomonas aeruginosa
Pseudomonas aeruginosa(Schroeter)(bacterial classification is preserved number: 132405) available from microorganism fungus kind preservation center, Guangdong Microbes Inst, bacterium is shaken in the Pseudomonas aeruginosa inoculation to spend the night, it is (commercially available to extract kit with bacterial genomes, it root biochemical technology company limited) extracts genome, agarose gel electrophoresis detects its integrality, (TECAN infinite M200) detects its concentration and purity with multi-functional microplate reader, and the result is fit to do pcr template.
2, the pcr amplification of ornithine carbamyl transferase (ArcB) and carbamyl phosphate kinases (ArcC)
According to ArcB(gene accession number NP_253859.1 among the GenBank) and ArcC(gene accession number NP_253860.1) sequence, the design primer, wherein the ArcB upstream primer is 5 '-CGC
CATATG(the underscore place is GCTTTCAACATGCACAACCGTAAC-3 '
NdeThe I restriction enzyme site), downstream primer is 5 '-CCG
CTCGAG(the underscore place is TTAGATGTCGGCGAGGGTCGA-3 '
XhoThe I restriction enzyme site); The ArcC upstream primer is 5 '-CG
CATATG(the underscore place is CGTATCGTCGTCGCATT-3 '
NdeThe I restriction enzyme site), downstream primer is 5 '-AA
CTCGAG(the underscore place is TCAGCGGTACTCGATGCC-3 '
XhoThe I restriction enzyme site).Get the genome of step 1 extraction as template, (TaKaRa) carries out pcr amplification with the PfuDNA polymerase, and reaction system is as follows:
1.0 μ l template (5 ng/ μ l)
5.0 μl 10×Pfu Buffer
μ l primer upstream 1.0 (10 μ M)
μ l primer downstream 1.0 (10 μ M)
4.0 μl dNTPs（2.5 mM）
0.3 μl Pfu（2.5 U/μl）
37.7 μl ddH
2O
Totally 50 μ l.
The pcr amplification condition: 94 ℃, 3 min; [94 ℃: 30 s, 56 ℃: 30 s, 72 ℃: 120 s] * 30 circulation; 72 ℃, 10 min.Getting 2 μ l products detects with the agarose gel electrophoresis of 1.2 %, wherein increasing and obtaining the ArcB size is 1011 bp(Fig. 1), the ArcC size is 933 bp(Fig. 2), the PCR product reclaims the kit purifying with Ago-Gel and reclaims (day root biochemical technology company limited).
3, the structure of recombinant vector pET28a-ArcB and pET28a-ArcC
Owing to be connected into corresponding restriction enzyme site at purpose fragment two ends, therefore can be connected the carrier that passes through double digestion simultaneously with the purpose fragment, consider that subsequent experimental may need not to be with the enzyme of fusion tag, so selected
NdeThe I restriction enzyme site, the destination protein behind its expression and purification can cut with fibrin ferment.To ArcB, ArcC purpose fragment and pET28a use
NdeI,
XhoI is double digestion simultaneously, and system is as follows:
5 μl 10×Buffer3
0.5 μl 100×BSA
1.5 μ l (10 U/ μ l are available from NEB)
XhoI
1.5 μ l (10 U/ μ l are available from NEB)
NdeI
2 μ g plasmid DNA
With potpourri mixing gently, centrifugal being collected at the pipe end changes 80 ℃ of water-bath 20 min over to behind 37 ℃ of water-bath 3 h.Get 5 μ L double digestion products and carry out 1.0 % agarose gel electrophoresis, remaining enzyme is cut product and is used for the agarose gel electrophoresis recovery, measures the concentration that purifying reclaims product with multi-functional microplate reader.
Product after enzyme cut spends the night with 16 ℃ of connections of T4 ligase (TaKaRa), and linked system is as follows:
1 μl 10×T4 Ligase Buffer
0.5 μl（10 U/μl） T4 DNA Ligase
50 ng pET28a digested plasmids
200 ng ArcB or ArcC enzyme are cut product
Spend the night in 16 ℃ of connections, connect product and transform 100 μ l
E.coliDH5a, overnight incubation, when cloning easy picking by the time, whether bacterium colony PCR checking is positive colony, the positive colony of checking extracts plasmid, uses
NdeI,
XhoThe I double digestion is verified whether successful connection (Fig. 3), and the plasmid of successful connection checks order.
4, recombinant vector pET28a-ArcB and pET28a-ArcC transform and express the bacterial strain inducing expression
The carrier that step 3 order-checking is correct transforms
E.coliBL21(DE3, commercially available), carry out bacterium colony PCR evaluation and enzyme and cut evaluation, the positive colony abduction delivering.Picking list bacterium colony after 37 ℃ of incubated overnight with 1:50(v/v) change over to and continue in the LB nutrient culture media that 100 mL contain kanamycins (50 μ g/mL) to cultivate, extremely
OD 600About 0.6, get in 1 mL bacterium liquid to the 1.5 mL centrifuge tube, centrifugal 5 min of 12000 r/min abandon supernatant, and adding IPTG in the remaining bacterium liquid is 1 mmol/L to final concentration, 20 ℃ of abduction deliverings that spend the night, the bacterium liquid after getting 0.3 mL and inducing is done same treatment.With bacterium liquid behind the abduction delivering in 10000 r/min, 4 ℃ of centrifugal 10 min, collect thalline, with the resuspended thalline of PBS damping fluid of 10 mL, 100 mmol/L pH 7.0, it is centrifugal to get the broken liquid of 30 μ L after the ultrasonication, as cleer and peaceful broken precipitation in the fragmentation, get before inducing simultaneously and the thalline after inducing, add sample-loading buffer, carry out SDS-PAGE electrophoretic analysis (Fig. 4,5).
The present invention has selected 20 ℃ of low temperature when protein induced expression, the inducing temperature height easy formation inclusion body, and derivant IPTG concentration selected 1 mmol/L, selection of time 20 h, expressing quantity is quite big like this, induces the back destination protein to account for 50 % of total protein greatly.5, Expression of Fusion Protein, purifying, concentration determination
Remaining thalline places 4 ℃ after getting above-mentioned ultrasonication, and centrifugal 15 min of 8000 r/min collect supernatant solution, and supernatant solution is joined in the 2 mL Ni-NTA chromatographic columns, and protein liquid is fully mixed with filler, and ice bath 1 h carries out nickel post affinity purification:
(1) with 100 mmol/L PBS damping fluid balance pillars, slowly add the supernatant solution after ultrasonic then, control flow velocity well, the flow of solution in the post is worn, get 40 μ L streams and wear liquid and carry out the SDS-PAGE electrophoresis detection.
(2) Xiang Zhuzhong adds the 100 mmol/L PBS damping fluids that do not contain imidazoles of two bed volumes, and eluent is oozed.
(3) imidazole concentration of two bed volumes of Xiang Zhuzhong adding is the PBS eluent of 10 mmol/L, and eluent is oozed, and gets 40 μ L washing lotions and carries out the SDS-PAGE electrophoresis detection.
(4) imidazole concentration of two bed volumes of Xiang Zhuzhong adding is the PBS eluent of 20 mmol/L, and eluent is oozed, and gets 40 μ L eluents and carries out the SDS-PAGE electrophoresis detection.
(5) imidazole concentration of two bed volumes of Xiang Zhuzhong adding is the PBS eluent of 50 mmol/L, and eluent is oozed, and gets 40 μ L eluents and carries out the SDS-PAGE electrophoresis detection.
(6) imidazole concentration of two bed volumes of Xiang Zhuzhong adding is the PBS eluent of 100 mmol/L, and eluent is oozed, and gets 40 μ L eluents and carries out the SDS-PAGE electrophoresis detection.
(7) imidazole concentration of two bed volumes of Xiang Zhuzhong adding is the PBS eluent of 250 mmol/L, and eluent is oozed, and gets 40 μ L eluents and carries out the SDS-PAGE electrophoresis detection.
(8) imidazole concentration of two bed volumes of Xiang Zhuzhong adding is the PBS eluent of 500 mmol/L, and eluent is oozed, and gets 40 μ L eluents and carries out the SDS-PAGE electrophoresis detection.
Albumen behind the purifying is joined molecular cut off
MR is in 14000 the albumen bag filter, 4 ℃ of dialysis 24 h in 100 mmol/L PBS dislysates, wherein protein liquid and dislysate ratio are 1:100, average 8 h change fresh dialysis fluid one time, BCA protein concentration quantification kit (green skies biotechnology research institute) detects protein concentration, and with Image J software prediction purity of protein, the ratio of final protein and glycerine 1:1 is mixed frozen in-20 ℃ of refrigerators.
The present invention is when purifying protein, with imidazoles gradient elution purifying, imidazole concentration is diluted to 0 mmol/L, 10 mmol/L, 20 mmol/L, 50 mmol/L, 100 mmol/L, 250 mmol/L and 500 mmol/L, can remove the part foreign protein in the time of the imidazoles wash-out of low concentration, can remove most of foreign protein in the time of the imidazoles wash-out of higher concentration, but also having a small amount of destination protein is eluted, and purer destination protein under the direct wash-out of the imidazoles of high concentration determines that at last 250 mmol/L imidazole concentrations are wash-out concentration.
6, TLC thin-layer chromatography detection ArcB and ArcC conjugate enzyme are lived
ArcB and ArcC coupling activity with TLC thin layer chromatography detection purifying comprise (100 mmol/L PBS pH, 7.0,10 mmol/L ADP, 2 mmol/L MgCl in the 100 μ L systems
2200 μ g/mL ArcB, 200 μ g/mL ArcC, 40 mmol/L L-citrulline), behind 37 ℃ of reaction 20 min, with the ArcB enzyme reaction of 95 ℃ of inactivations in contrast, citrulline, ornithine standard items and reacted product point sample are detected conjugate enzyme live (Fig. 6) in the TLC chromatoplate.
7, surveying ammonia process detection ArcB and ArcC conjugate enzyme lives
With surveying ArcB and the ArcC coupling activity that ammonia process detects purifying, the product ammonia can be at a-ketoglutaric acid (a-oxoglutarate), NADH, H
+Exist down, generate glutamic acid by glutamte dehydrogenase (GIDH) catalysis, simultaneously NADH and H
+Be oxidized to oxidized coenzyme I (NAD
+), NADH has strong absorption peak at 340 nm places, therefore can live according to the variation indirect calculation ArcB enzyme of 340 nm place absorbances.Wherein comprise (100 mmol/L PBS pH, 7.0,5.7 mmol/L a-oxoglutarate, 0.5 mmol/L NADH, 2 U/mL GIDH, 2 mmol/L MgCl in the 100 μ L systems
210 mmol/L ADP, 200 μ g/mL ArcB, 200 μ g/mL ArcC, 40 mmol/L L-citrulline), behind 37 ℃ of reaction 20 min, with the ArcB enzyme reaction of 95 ℃ of inactivations in contrast, changing value calculating ArcB enzyme work according to the substrate NADH that detects between experimental group and the control group at last is approximately 0.082 μ mol/minmg, NADH typical curve (Fig. 7).
The present invention is when surveying conjugate enzyme reaction alive, at first with qualitative ArcB and the ArcC coupling activity verified of TLC thin layer chromatography, thereby judge according to the relative displacement of citrulline on the thin layer plate and ornithine whether two enzymes have activity, having groped 37 ℃ of its forwards of reaction 20 min, to decompose effect better; Quantitatively detected ArcB and ArcC coupling activity with surveying ammonia process, the product ammonia can be at a-ketoglutaric acid (a-oxoglutarate), NADH, H
+Exist down, generate glutamic acid by glutamte dehydrogenase (GIDH) catalysis, simultaneously NADH and H
+Be oxidized to oxidized coenzyme I (NAD
+), NADH has strong absorption peak at 340 nm places, therefore can live according to the variation indirect calculation ArcB enzyme of 340 nm place absorbances, and the enzyme work that records at last is approximately 0.082 μ mol/minmg.
8, the preparation of the ATP typical curve in the chemiluminescence detection reaction system
(commercially available to the ATP detection kit, the production of Invitrogen company) the standard items ATP in carries out chemiluminescence detection, the ATP standard solution is diluted to a series of concentration 1 μ mol/L, 100 nmol/L, 10 nmol/L, 1 nmol/L, 100 pmol/L, 10 pmol/L, 1 pmol/L, 0 pmol/L, join in the detection reagent of ATP detection kit, detect relative luminous intensity with multi-functional microplate reader, the least concentration that the result detects is greatly about 1-10 nmol/L, and the ATP of lower concentration then changes not obvious (Fig. 8).
The present invention is when detecting ATP with the ATP detection kit, its kit utilizes the Luminometer Chemiluminescence Apparatus can detect 0.01 pmol/LATP, and the ATP standard items concentration of the multi-functional microplate reader that this laboratory is used (TECAN infinite M200) lowest detection is approximately 1-10 nmol/L.In enzyme is lived reaction, also be mixed with the ATP of trace among the ADP of adding, in order to solve the background interference problems of too, tentatively decided 100 μ L reaction systems, ADP concentration is decided to be 1 μ mol/L, Mg
2+Concentration is decided to be 40 μ mol/L, needs phosphate anion in the reaction system, so selected PBS as damping fluid.
9, the concentration curve of chemiluminescence detection citrulline
The direct substrate of ArcB is citrulline, has therefore groped the detected minimum citrulline concentration of energy, comprises (100 mmol/L PBS pH, 7.0,1 μ mol/L ADP, 40 μ mol/L MgCl in the 100 μ L systems
2100 μ g/mL ArcB, 100 μ g/mL ArcC, and the citrulline of gradient dilution), behind 37 ℃ of reaction 20 min, add and detect reagent 10 μ L in the ATP detection kit, detect relative luminous intensity with multi-functional microplate reader, with corresponding ATP typical curve result contrast, efficient after two enzymatics can convert, convert ArcB and ArcC catalytic reaction efficient of result is approximately 10 %, and detected minimum citrulline concentration is 0.1 μ mol/L, and lower concentration then changes not obvious (Fig. 9).
10, the concentration curve of chemiluminescence detection ADMA
Grope the detected minimum ADMA concentration of energy, comprised (100 mmol/L PBS pH, 7.0,1 μ mol/L ADP, 40 μ mol/L MgCl in the 100 μ L systems
2100 μ g/mL ArcB, 100 μ g/mL ArcC, 100 μ g/mL DDAH, and the ADMA of gradient dilution), DDAH(is commercially available), behind 37 ℃ of reaction 20 min, add and detect reagent 10 μ L in the ATP detection kit, detect relative luminous intensity with multi-functional microplate reader, with corresponding ATP typical curve result contrast, efficient after three enzymatics can convert, efficient is approximately 10 % as a result, and the least concentration of detected ADMA is 0.1 μ mol/L, and the ADMA of lower concentration then changes not obvious (Figure 10).
11, the citrulline in the chemiluminescence detection urine
Comprise (100 mmol/L PBS pH, 7.0,1 μ mol/L ADP, 40 μ mol/L MgCl in the 100 μ L systems
2100 μ g/mL ArcB, 100 μ g/mL ArcC, urine), behind 37 ℃ of reaction 20 min, add and detect reagent 10 μ L in the ATP detection kit, detect relative luminous intensity with multi-functional microplate reader, compare with citrulline concentration curve in the corresponding step 9, the citrulline concentration that can converse in the urine is approximately 0.8 μ mol/L(Figure 11).
12, the ADMA in the chemiluminescence detection urine
Comprise (100mmol/L PBS pH 7.0,1 μ mol/L ADP, 40 μ mol/L MgCl in the 100 μ L systems
2100 μ g/mL ArcB, 100 μ g/mL ArcC, 100 μ g/mL DDAH, urine), behind 37 ℃ of reaction 20 min, add and detect reagent 10 μ L in the ATP detection kit, detect relative luminous intensity with multi-functional microplate reader, compare with ADMA concentration curve in the corresponding step 10, the ADMA concentration that can converse in the urine is approximately 6 μ mol/L(Figure 11).
Detecting ADMA in the serum and citrulline can be with reference to the detection method in the above-mentioned urine, in addition, as long as citrulline be intermediate product in the metabolic pathway can be with this method detection, the citrulline that under the arginine hydrolase effect, generates of arginine for example.
The operation steps reference example 1 of present embodiment, its difference with embodiment 1 is the different of target detection thing and takes different detection architecture:
The arginic concentration curve of chemiluminescence detection
Comprise (100mmol/L PBS pH 7.0,1 μ mol/L ADP, 40 μ mol/L MgCl in the 100 μ L systems
2, 100 μ g/mL ArcB, 100 μ g/mL ArcC, 100 μ g/mL ADI(arginine deiminases), the arginine solution of gradient dilution), behind 37 ℃ of reaction 20 min, add and detect reagent 10 μ L in the ATP detection kit, detect relative luminous intensity with multi-functional microplate reader.
Arginic concentration in the chemiluminescence detection thing to be detected
Comprise (100mmol/L PBS pH 7.0,1 μ mol/L ADP, 40 μ mol/L MgCl in the 100 μ L systems
2100 μ g/mL ArcB, 100 μ g/mL ArcC, 100 μ g/mL ADI, thing to be detected), behind 37 ℃ of reaction 20 min, add and detect reagent 10 μ L in the ATP detection kit, detect relative luminous intensity with multi-functional microplate reader, compare with arginic concentration curve, can converse arginic concentration in the thing to be detected.
The operation steps reference example 1 of present embodiment, its difference with embodiment 1 is the different of target detection thing and takes different detection architecture:
The concentration curve of chemiluminescence detection ornithine carbamyl transferase
Comprise (100mmol/L PBS pH 7.0,1 μ mol/L ADP, 40 μ mol/L MgCl in the 100 μ L systems
2, the ornithine carbamyl transferase of gradient dilution, 100 μ g/mL ArcC, 100 μ mol/L L-citrulline), behind 37 ℃ of reaction 20 min, add and detect reagent 10 μ L in the ATP detection kit, detect relative luminous intensity with multi-functional microplate reader.
The concentration of ornithine carbamyl transferase in the chemiluminescence detection thing to be detected
Comprise (100mmol/L PBS pH 7.0,1 μ mol/L ADP, 40 μ mol/L MgCl in the 100 μ L systems
2Thing to be detected, 100 μ g/mL ArcC, 100 μ mol/L L-citrulline), behind 37 ℃ of reaction 20 min, add and detect reagent 10 μ L in the ATP detection kit, detect relative luminous intensity with multi-functional microplate reader, compare with the concentration curve of ornithine carbamyl transferase, can converse the concentration of ornithine carbamyl transferase in the thing to be detected.
The operation steps reference example 1 of present embodiment, its difference with embodiment 1 is the different of target detection thing and takes different detection architecture:
The concentration curve of chemiluminescence detection diethylarginine dimethylamine hydrolytic enzyme
Comprise (100mmol/L PBS pH 7.0,1 μ mol/L ADP, 40 μ mol/L MgCl in the 100 μ L systems
2, 100 μ g/mL ArcB, 100 μ g/mL ArcC, 100 μ mol/L ADMA, the diethylarginine dimethylamine hydrolytic enzyme of gradient dilution), behind 37 ℃ of reaction 20 min, add and detect reagent 10 μ L in the ATP detection kit, detect relative luminous intensity with multi-functional microplate reader.
The concentration of diethylarginine dimethylamine hydrolytic enzyme in the chemiluminescence detection thing to be detected
Comprise (100mmol/L PBS pH 7.0,1 μ mol/L ADP, 40 μ mol/L MgCl in the 100 μ L systems
2100 μ g/mL ArcB, 100 μ g/mL ArcC, 100 μ mol/L ADMA, thing to be detected), behind 37 ℃ of reaction 20 min, add and detect reagent 10 μ L in the ATP detection kit, detect relative luminous intensity with multi-functional microplate reader, with the concentration curve comparison of diethylarginine dimethylamine hydrolytic enzyme, can converse the concentration of diethylarginine dimethylamine hydrolytic enzyme in the thing to be detected.
The operation steps reference example 1 of present embodiment, its difference with embodiment 1 is the different of target detection thing and takes different detection architecture:
The concentration curve of chemiluminescence detection arginine deiminase
Comprise (100mmol/L PBS pH 7.0,1 μ mol/L ADP, 40 μ mol/L MgCl in the 100 μ L systems
2, 100 μ g/mL ArcB, 100 μ g/mL ArcC, 100 μ mol/L Arginine, the arginine deiminase of gradient dilution), behind 37 ℃ of reaction 20 min, add and detect reagent 10 μ L in the ATP detection kit, detect relative luminous intensity with multi-functional microplate reader.
The concentration of arginine deiminase in the chemiluminescence detection thing to be detected
Comprise (100mmol/L PBS pH 7.0,1 μ mol/L ADP, 40 μ mol/L MgCl in the 100 μ L systems
2100 μ g/mL ArcB, 100 μ g/mL ArcC, 100 μ mol/L Arginine, thing to be detected), behind 37 ℃ of reaction 20 min, add and detect reagent 10 μ L in the ATP detection kit, detect relative luminous intensity with multi-functional microplate reader, with the concentration curve comparison of arginine deiminase, can converse the concentration of arginine deiminase in the thing to be detected.
Although content of the present invention describes in conjunction with present embodiment, those skilled in the art may also need to modify slightly to some system on the appended instructions, and these modifications or modification drop in protection scope of the present invention equally.
SEQUENCE LISTING
＜110〉Shaoxing Institute of Technology of College of Engineering, Peking University
＜120〉a kind of zymetology detection method
<130> 2013.3.11
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 33
<212> DNA
＜213〉artificial sequence
<400> 1
cgccatatgg ctttcaacat gcacaaccgt aac 33
<210> 2
<211> 30
<212> DNA
＜213〉artificial sequence
<400> 2
ccgctcgagt tagatgtcgg cgagggtcga 30
<210> 3
<211> 25
<212> DNA
＜213〉artificial sequence
<400> 3
cgcatatgcg tatcgtcgtc gcatt 25
<210> 4
<211> 26
<212> DNA
＜213〉artificial sequence
<400> 4
aactcgagtc agcggtactc gatgcc 26
Claims (6)
1. a zymetology detection method is characterized in that: detect the ATP that citrulline generates in the sample to be tested after ornithine carbamyl transferase and carbamyl phosphate kinases coupling reaction, and be converted into the concentration of target detection thing.
2. a kind of zymetology detection method according to claim 1, it is characterized in that: described target detection thing is citrulline, Ng,Ng-Dimethylarginine, arginine, diethylarginine dimethylamine hydrolytic enzyme, ornithine carbamyl transferase or arginine deiminase.
3. a kind of zymetology detection method according to claim 2, it is characterized in that: the concrete operations of described zymetology detection method are: sample to be detected is put into detection reagent form detection architecture, 20-40 ℃ of reaction, detect reagent with ATP and detect ATP concentration, converting obtains the concentration of target detection thing.
4. a kind of zymetology detection method according to claim 3 is characterized in that: ATP detects reagent and comprises luciferase and luciferin.
5. a kind of zymetology detection method according to claim 3, it is characterized in that: detection architecture comprises following component: ornithine carbamyl transferase 1-300 μ g/mL, carbamyl phosphate kinases 1-300 μ g/mL, sample to be tested.
6. according to any described a kind of zymetology detection method of claim 1-5, it is characterized in that: described ornithine carbamyl transferase and carbamyl phosphate kinases all derive from Pseudomonas aeruginosa.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310078729.6A CN103207173B (en) | 2013-03-13 | 2013-03-13 | Enzymological detection method |
| PCT/CN2013/078102 WO2014139240A1 (en) | 2013-03-13 | 2013-06-27 | Enzymology detection method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310078729.6A CN103207173B (en) | 2013-03-13 | 2013-03-13 | Enzymological detection method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103207173A true CN103207173A (en) | 2013-07-17 |
| CN103207173B CN103207173B (en) | 2015-06-17 |
Family
ID=48754461
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310078729.6A Expired - Fee Related CN103207173B (en) | 2013-03-13 | 2013-03-13 | Enzymological detection method |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN103207173B (en) |
| WO (1) | WO2014139240A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108507984A (en) * | 2018-02-28 | 2018-09-07 | 山东大学第二医院 | A kind of method and its application of enzyme process detection trimethylamine oxide TMAO |
| CN115948316A (en) * | 2022-12-13 | 2023-04-11 | 四川大学 | Method for improving acid resistance of lactic acid bacteria |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000046395A1 (en) * | 1999-02-05 | 2000-08-10 | Panorama Research, Inc. | Assay for asymmetrical dimethyl-l-arginine (adma) |
| CN101438148A (en) * | 2006-03-02 | 2009-05-20 | 珀金埃金默Las公司 | Methods for distinguishing isomers using mass spectrometry |
| CN102154444A (en) * | 2010-12-30 | 2011-08-17 | 北京九强生物技术股份有限公司 | Method for measuring concentration of asymmetric dimethylarginine and diagnostic reagent kit |
| CN102243227A (en) * | 2010-12-16 | 2011-11-16 | 浙江亚太药业股份有限公司 | Measuring method of asymmetric dimethylarginine concentration and measuring reagent thereof |
| WO2012058621A2 (en) * | 2010-10-29 | 2012-05-03 | Shire Human Genetic Therapies Inc. | Assays and kits to determine urea cycle enzyme activity on solid support |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102140495B (en) * | 2010-12-17 | 2014-03-26 | 浙江亚太药业股份有限公司 | Method for testing dimethyl arginine dimethylamine hydrolytic enzyme and diagnostic reagent thereof |
-
2013
- 2013-03-13 CN CN201310078729.6A patent/CN103207173B/en not_active Expired - Fee Related
- 2013-06-27 WO PCT/CN2013/078102 patent/WO2014139240A1/en active Application Filing
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000046395A1 (en) * | 1999-02-05 | 2000-08-10 | Panorama Research, Inc. | Assay for asymmetrical dimethyl-l-arginine (adma) |
| CN101438148A (en) * | 2006-03-02 | 2009-05-20 | 珀金埃金默Las公司 | Methods for distinguishing isomers using mass spectrometry |
| WO2012058621A2 (en) * | 2010-10-29 | 2012-05-03 | Shire Human Genetic Therapies Inc. | Assays and kits to determine urea cycle enzyme activity on solid support |
| CN102243227A (en) * | 2010-12-16 | 2011-11-16 | 浙江亚太药业股份有限公司 | Measuring method of asymmetric dimethylarginine concentration and measuring reagent thereof |
| CN102154444A (en) * | 2010-12-30 | 2011-08-17 | 北京九强生物技术股份有限公司 | Method for measuring concentration of asymmetric dimethylarginine and diagnostic reagent kit |
Non-Patent Citations (1)
| Title |
|---|
| AHMED T. ABDELAL等: "Carbamate Kinase from Pseudomonas aeruginosa:Purification, Characterization, Physiological Role, and Regulation", 《JOURNAL OF BACTERIOLOGY》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108507984A (en) * | 2018-02-28 | 2018-09-07 | 山东大学第二医院 | A kind of method and its application of enzyme process detection trimethylamine oxide TMAO |
| CN115948316A (en) * | 2022-12-13 | 2023-04-11 | 四川大学 | Method for improving acid resistance of lactic acid bacteria |
| CN115948316B (en) * | 2022-12-13 | 2024-03-22 | 四川大学 | Method for improving acid resistance of lactic acid bacteria |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2014139240A1 (en) | 2014-09-18 |
| CN103207173B (en) | 2015-06-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| McGrath et al. | Intracellular accumulation of polyphosphate by the yeast Candida humicola G-1 in response to acid pH | |
| CN111812066B (en) | Biosensor based on CRISPR/Cas12a system, kit and application thereof in small molecule detection | |
| Akyilmaz et al. | Sensitive determination of L-lysine with a new amperometric microbial biosensor based on Saccharomyces cerevisiae yeast cells | |
| Salman et al. | Hydroxyapatite as a novel reversible in situ adsorption matrix for enzyme thermistor-based FIA | |
| CN102363815B (en) | Reagent for detecting salmonellae by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for salmonellae | |
| CN110358786A (en) | A kind of enzyme mutant | |
| CN103834744B (en) | The quantitative analysis method of clostridium, milk-acid bacteria, genus bacillus, methanobacteria in the mud of cellar for storing things | |
| CN103207173B (en) | Enzymological detection method | |
| Mei et al. | A sequential injection analysis/chemiluminescent plant tissue-based biosensor system for the determination of diamine | |
| US9708639B2 (en) | Method for quantifying amino acids with pyrophosphate | |
| CN101492741A (en) | Method for quantitative detection of mycoplasma hyopneumoniae | |
| WO2023246507A1 (en) | Cell-free reaction system based on escherichia coli and use thereof | |
| Frattini et al. | Analyzing the D-amino acid content in biological samples by engineered enzymes | |
| CN104745544B (en) | A kind of D LOs and its application in D lactate detections | |
| CN106479999A (en) | A kind of L dglutamic oxidase CBD merges enzyme and its expressing gene and application | |
| CN102559572B (en) | Genetic engineering bacterium, method for preparing recombinant S-adenosyl-L-homocysteine hydrolase by using same, and application of hydrolase | |
| CN105462939A (en) | Expressing method for biotinylation luciferase | |
| CN105734027B (en) | A kind of xanthine dehydrogenase and its encoding gene and application | |
| Huang et al. | A Graphene Quantum Dots-Enzyme Hybrid System for the Fluorescence Assay of Alkaline Phosphatase Activity and Inhibitor Screening | |
| Wolpert et al. | Multienzyme complex for carbon dioxide fixation | |
| CN101851665B (en) | Kit for enzymatic determination of 1,5-anhydro-D-glucitol | |
| Cho et al. | Purification and characterization of lactate dehydrogenase A 4 isozyme in mandrin fish (Siniperca scherzeri) | |
| CN104789639A (en) | Fusion protein for detecting NADH dependent type enzyme substrate and application of fusion protein | |
| Chen et al. | Expression, purification and functional characterization of a novel 3α-hydroxysteroid dehydrogenase from Pseudomonas aeruginosa | |
| JP5303715B2 (en) | Amino acid quantification method using pyrophosphate quantification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent of invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Hu Guang Inventor after: Zhang Ming Inventor after: Tu Huihui Inventor before: Hu Guang Inventor before: Zhang Ming |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: HU GUANG ZHANG MING TO: HU GUANG ZHANG MING TU HUIHUI |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150617 Termination date: 20160313 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |