CN103205508B - RT-LAMP test kit for viral hemorrhagic septicemia virus - Google Patents

RT-LAMP test kit for viral hemorrhagic septicemia virus Download PDF

Info

Publication number
CN103205508B
CN103205508B CN201310105578.9A CN201310105578A CN103205508B CN 103205508 B CN103205508 B CN 103205508B CN 201310105578 A CN201310105578 A CN 201310105578A CN 103205508 B CN103205508 B CN 103205508B
Authority
CN
China
Prior art keywords
vhsv
viral hemorrhagic
hemorrhagic septicemia
primer
lamp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201310105578.9A
Other languages
Chinese (zh)
Other versions
CN103205508A (en
Inventor
陈进会
黄伟
邱杨
刘建丽
赵丽
王学松
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Inspection & Quarantine Comprehensive Technology Center Dongguan Entry-Exit Inspection And Quarantine
Original Assignee
Inspection & Quarantine Comprehensive Technology Center Dongguan Entry-Exit Inspection And Quarantine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Inspection & Quarantine Comprehensive Technology Center Dongguan Entry-Exit Inspection And Quarantine filed Critical Inspection & Quarantine Comprehensive Technology Center Dongguan Entry-Exit Inspection And Quarantine
Priority to CN201310105578.9A priority Critical patent/CN103205508B/en
Publication of CN103205508A publication Critical patent/CN103205508A/en
Application granted granted Critical
Publication of CN103205508B publication Critical patent/CN103205508B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention belongs to the technical field of molecular biology, and relates to aquatic marine aquaculture industry detection method, particularly to a RT-LAMP test primer set, a test kit and a test method of viral hemorrhagic septicemia virus. The test primer set comprises outer primers, inner primers and ring primers. The test kit mainly comprises primer liquids, reaction solutions, DNA polymerase, reverse transcriptase and controls. The test method comprises that: RNA of virus to be tested is extracted, reverse transcription activity of the reverse transcriptase is utilized, and six specific primers and DNA polymerase with strand displacement activity are adopted to amplify the sample RNA template, wherein the pg grade pure viral RNA can be tested; and identification adopts SYBR Green I addition and ESE-Quant-tube Scanner instrument detection or adopts a turbidity instrument to determine whether the sample contains the viral hemorrhagic septicemia virus RNA. According to the present invention, advantages of rapidness, high efficiency, simple operation, high specificity, high sensitivity, simple identification, easy on-site test, and the like are provided, and popularization and application are easily achieved.

Description

The RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus
Technical field
The invention belongs to technical field of molecular biology, relate to the detection method of marine aquaculture industry, the RT-LAMP that is specifically related to a kind of viral hemorrhagic septicemia, VHS virus (VHSV) detects primer sets, detection kit and detection method.
Background technology
Viral hemorrhagic septicemia (VHS) be a kind of can infect the salmon trout at various ages and the lethality of various ocean fishes (as cod, Pacific herring, Ta, Channel-catfish, pike and turbot, lefteye flounder etc.) that can free livings, general transmissible disease.Conventionally at the beginning of last month of spring in winter and popular when 8～10 DEG C of water temperatures, water temperature rises to more than 15 DEG C, and sickness rate reduces.This disease is popular in whole Continent of Europe, North America and Japan, and infectivity is extremely strong, in every premium on currency in morbidity fishing ground, has 1000 viruses.The principal character of viral hemorrhagic septicemia is hemorrhage, and under natural condition, this disease latent period is 7-25 days.Because of symptom emergency and performance difference, point acute, chronic type and nervous system type three types.Viral hemorrhagic septicemia, VHS virus can be discharged virus by sick fish or the movement with malicious fish, ovum, seminal fluid etc., and in water body, diffusion is propagated, and virus is invaded fish body and infects through the fish gill.Sick fish shows as without point of destination floats, health blackout, skin and gill oozing of blood ulcer; Ophthalmoptosis, anus redness, belly enlargement.Cut open the visible a large amount of haemolysis ascites of inspection; Intestines, the heart, kidney, fish glue are sometimes also hemorrhage together with muscle, internal organ oedema.
The cause of disease of VHS is viral haemorrhagic septicaemia virus (VHSV), belongs to Rhabdoviridae Novirhabdovirus and belongs to.Viral genome is one section of minus-strand RNA, 5 albumen of its glm gene group coding comprise: nucleocapsid protein (N albumen), two structural protein (M1 and M2 albumen), glycoprotein (G albumen) and RNA polymerase (L albumen).VHSV particle is about 180nm, wide about 70nm.The about 12k of its a genome length base.Culture of isolated viral hemorrhagic septicemia, VHS virus generally needs just can obtain a result above for 15 days, and sense cycle is oversize, the requirements of the times that are not suitable with port rapid detection and are open to the custom greatly.Therefore, set up a kind of fast, accurately, high-throughput and the less demanding detection kit of instrument and detection method are become to current urgent problem.
Summary of the invention
Another object of the present invention is to provide a kind of RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus.
The technical solution adopted in the present invention is as follows:
The RT-LAMP of a kind of viral hemorrhagic septicemia, VHS virus (VHSV) detects primer sets, comprise a pair of outer primer VHSV-F3 and VHSV-B3, a pair of inner primer VHSV-FIP and VHSV-BIP, a pair of ring primer VHSV-LF and VHSV-LB, its nucleotide sequence is as follows respectively:
VHSV-F3：TTATCTCAACCATCTCATCACC(SEQ?ID?NO:1)；
VHSV-B3：TGATGCTGACTACTGCCT(SEQ?ID?NO:2)；
VHSV-FIP：GGATATTTTCCCAGAAGCGGTGCATGGCTCAAAGAACCG(SEQ?ID?NO:3)；
VHSV-BIP：TCTCAAAGTTTCGTCCCAGCCCAGTCACCTCGCATGATT(SEQ?ID?NO:4)；
VHSV-LF：CACTATGGGCATCTAGGCAC(SEQ?ID?NO:5)；
VHSV-LB：CACACTATCTTCTCAACGGTCA(SEQ?ID?NO:6)。
The RT-LAMP detection kit of a kind of viral hemorrhagic septicemia, VHS virus (VHSV), it comprises that RT-LAMP claimed in claim 1 detects primer sets.
The RT-LAMP detection kit of a kind of viral hemorrhagic septicemia, VHS virus (VHSV), comprises following composition: described RT-LAMP detects primer sets, reversed transcriptive enzyme, archaeal dna polymerase, RT-LAMP reaction solution, positive control and negative control.
Preferably, in described detection kit, in described primer sets, the mol ratio of outer primer, inner primer, ring primer is 1 ︰ 8 ︰ 4.
Preferably, in described detection kit, described archaeal dna polymerase is Bst archaeal dna polymerase; Described reversed transcriptive enzyme is AMV reversed transcriptive enzyme.
Preferably, in described detection kit, described RT-LAMP reaction solution contains: 10mM dNTP, 10 × ThermoPol reaction buffer, 150mM MgSO 4the aqueous solution, three's volume ratio is 8 ︰ 5 ︰ 2.
Preferably, in described detection kit, the T carrier cloning of described positive control for containing viral hemorrhagic septicemia, VHS virus (VHSV) envelope glycoprotein gene fragment, negative control is DEPC water.
In detection kit of the present invention, can also contain developer, described developer is fluorescence dye SYBR Green I.
Utilize above-mentioned test kit to detect the method for viral hemorrhagic septicemia, VHS virus (VHSV), comprise the steps
(1), the extraction of sample RNA to be checked: adopt viral RNA to extract test kit and extract sample RNA;
(2), constant temperature gene amplification reaction: 25 μ l reaction systems contain: VHSV-F3 0.2 μ M, VHSV-B30.2 μ M, VHSV-FIP 1.6 μ M, VHSV-BIP 1.6 μ M, VHSV-LF 0.8 μ M, VHSV-LB 0.8 μ M, RT-LAMP reaction solution 12.5 μ l, reversed transcriptive enzyme 1U, archaeal dna polymerase 8U, RNA1～100ng to be checked, uses DEPC water polishing to 25 μ l; Positive control and negative control are set; The PCR pipe preparing is mixed rear centrifugal, and in 63～65 DEG C of reaction 60～90min, and at 80 DEG C of lasting 2min;
(3), result judgement: change to judge amplification by the turbidity precipitating in observing response pipe.
The in the situation that of containing developer in test kit, in reaction tubes, add 10 × SYBR Green I, 0.5 μ l, then will in reaction tubes, be placed in ESE-Quant Tube Scanner, the fluorescent signal reading in real time according to instrument judges amplification.
The present invention is according to the envelope glycoprotein gene of viral hemorrhagic septicemia, VHS virus (VHSV) (gly G gene, GenBank accession number is DQ401190.1) design six Auele Specific Primers, apply above-mentioned six primers, 6 regions of amplified target sequence, in 6 regions, any region is not mated and all can not be carried out nucleic acid amplification with primer, therefore its specificity is high, and highly stable, form primer dimer probability low, ensured carrying out smoothly of reaction; Make that the present invention has rapidly and efficiently, easy and simple to handle, high specific, highly sensitive, qualification are easy, be applicable to the beneficial effects such as Site Detection:
(1), rapidly and efficiently: whole amplification only can complete with 60～90min, amplification output can reach 10 9～10 10individual copy;
(2), easy and simple to handle: do not need complicated instrument, do not need special reagent, do not need to carry out in advance the loaded down with trivial details step such as sex change of double-stranded DNA, only need a steady temperature instrument just to react and detect, condition is gentleer;
(3), high specific: to common several fishes virus SVCVs (SVCV), infectious hematopoietic necrosis's poison (IHNV), and flounder rhabdovirus (HRV), pike juvenile rhabdovirus (PFRV), infectious pancreatic necrosis virus (IPNV) RNA no cross reaction.
(4), highly sensitive: the lowest detection limit can reach 4.5pg/ reaction;
(5), identify easy: can add SYBR Green I colour-change or whether exist magnesium pyrophosphate to precipitate whether to judge amplification by observation, without other any analytical procedures such as electrophoresis, be applicable to Site Detection.
Brief description of the drawings
Fig. 1 is the specificity of primer VHSV-2 to SVCV, IHNV in the present invention,
Wherein, 1,2:DEPC processes water contrast; 3,6:IHNV RNA; 4,7:SVCV RNA; 5,8:VHSV RNA;
Fig. 2 is the specificity of primer VHSV-2 to HRV, PFRV in the present invention,
Wherein, 1,2:DEPC processes water contrast; 3,4:HRV RNA; 5,6:PFRV RNA; 7,8:VHSV RNA;
Fig. 3 is the specificity of primer VHSV-2 to IPNV in the present invention,
Wherein, 1,2:DEPC processes water contrast; 3,4:VHSV RNA; 5,6:IPNV RNA;
Fig. 4 is the sensitivity of RT-LAMP primer VHSV-2 in the present invention.
Wherein, 1:10 0doubly dilution; 2:10 1doubly dilution; 3:10 2doubly dilution; 4:10 3doubly dilution; 5:10 4doubly dilution; 6:10 5doubly dilution; 7:10 6doubly dilution; The contrast of 8:DEPC water.
Embodiment
Below in conjunction with embodiment, the present invention is further illustrated, but be not limited to this.
Embodiment 1
The foundation of viral hemorrhagic septicemia, VHS virus RT-LAMP detection kit
The RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus, comprises RT-LAMP primer sets, RT-LAMP reaction solution, Bst archaeal dna polymerase, AMV reversed transcriptive enzyme, positive control and negative control.
(1), RT-LAMP design of primers: with envelope glycoprotein gene (the gly G gene of viral hemorrhagic septicemia, VHS virus (VHSV), GenBank accession number is DQ401190.1) be target gene, utilize online design software Primer Explorer version4 (http://primerexplorer.jp/e) to carry out the design of LAMP primer.Primer sequence is in table 1.
Table 1 primer sequence table
(2), RT-LAMP reaction solution: contain 10mM dNTP, 10 × ThermoPol reaction buffer, the 150mM MgSO4 aqueous solution, three's volume ratio is 8 ︰ 5 ︰ 2.
(3), the T carrier cloning of positive control for containing viral hemorrhagic septicemia, VHS virus (VHSV) envelope glycoprotein gene fragment, its preparation method is: taking the viral hemorrhagic septicemia, VHS virus of isolation identification as template, utilize the outer primer (SEQ ID NO:1 and SEQ ID NO:2) in table 1 to carry out reverse transcription to VHSV RNA, obtain the cDNA containing target-gene sequence, after use again outer primer SEQ ID NO:1 and SEQ ID NO:2) amplification, gained gene fragment length is 221bp, sequence is as shown in SEQ ID NO:7, reclaim this amplified fragments, utilize ordinary method to be connected in T carrier, be positive control.
(4), negative control is DEPC water.
Use turbidimeter to set up viral hemorrhagic septicemia, VHS virus RT-LAMP detection method, utilize the test kit of above-mentioned gained to detect the method for viral hemorrhagic septicemia, VHS virus, comprise the steps:
(1), the extraction of sample RNA to be checked: adopt viral RNA to extract test kit and extract sample RNA;
(2), constant temperature gene amplification reaction: 25 μ l reaction systems contain: VHSV-F30.2 μ M, VHSV-B30.2 μ M, VHSV-FIP1.6 μ M, VHSV-BIP1.6 μ M, VHSV-LF0.8 μ M, VHSV-LB0.8 μ M, RT-LAMP reaction solution 12.5 μ l, AMV reversed transcriptive enzyme 1U, Bst archaeal dna polymerase 8U, RNA1～100ng to be checked, uses DEPC water polishing to 25 μ l; Positive control and negative control are set; The PCR pipe preparing is mixed rear centrifugal, and in 63～65 DEG C of reaction 60～90min, and at 80 DEG C of lasting 2min;
(3), result judgement: change to judge amplification by the turbidity precipitating in observing response pipe.Positive if there is precipitation, negative without precipitation.
Embodiment 2
ESE-Quant tube scanner detects
The developer (SYBR Green I) not having in increasing embodiment 1 in test kit, all the other are with embodiment 1.
By the following method viral hemorrhagic septicemia, VHS virus to be measured (VHSV) is detected with above-mentioned test kit:
(1), the extraction of sample RNA to be checked: adopt viral RNA to extract test kit and extract purifying testing sample RNA;
(2), constant temperature gene amplification reaction: 25 μ l reaction systems contain: VHSV-F3 0.2 μ M, VHSV-B30.2 μ M, VHSV-FIP 1.6 μ M, VHSV-BIP 1.6 μ M, VHSV-LF 0.8 μ M, VHSV-LB 0.8 μ M, RT-LAMP reaction solution 12.5 μ l, AMV reversed transcriptive enzyme 1U, Bst archaeal dna polymerase 8U, 10 × SYBR Green I0.5 μ l, RNA1～100ng to be checked, uses DEPC water polishing to 25 μ l; Positive control and negative control are set; The PCR pipe preparing is mixed rear centrifugal, in 65 DEG C of reaction 60min, and at 80 DEG C of lasting 2min;
(3), result judgement: reaction tubes is placed in ESE-Quant tube Scanner and is reacted, observe ESE-Tube Scanner software and judge amplification, positive if there is " S " type curve, nothing " S " type curve is negative.
Specificity experiment
With method viral hemorrhagic septicemia, VHS virus (VHSV) RNA to separation and purification, SVCV (SVCV) RNA, infectious hematopoietic necrosis's poison (IHNV) RNA respectively of embodiment 2, and flounder rhabdovirus (HRV), pike juvenile rhabdovirus (PFRV), infectious pancreatic necrosis virus (IPNV) RNA detect.
Qualification result shows: taking viral hemorrhagic septicemia, VHS virus (VHSV) RT-LAMP primer as primer, VHSV RNA normally increases, and negative water contrast and SVCV, IHNV do not increase, and demonstrate good specificity (seeing Fig. 1).VHSV RNA normally increases, and negative water contrast and HRV, PFRV do not increase, and demonstrates good specificity (seeing Fig. 2).VHSV RNA normally increases, and amplification does not appear in negative water contrast and IPNV RNA, demonstrates good specificity (seeing Fig. 3).
Sensitivity experiment
Viral hemorrhagic septicemia, VHS virus (VHSV) RNA of purifying is made to 10 times of gradient dilutions, respectively viral hemorrhagic septicemia, VHS virus (VHSV) RNA after diluting is detected by the working method of embodiment 1.
Qualification result shows: taking VHSV LAMP primer as primer, and 10 0～10 6doubly dilute VHSV RNA and increase, 10 4, 10 5, 10 6doubly dilution and not amplification of negative water contrast.Through the measurement of rna content, obtain viral hemorrhagic septicemia, VHS virus (VHSV) primer and p g level VHSV RNA (seeing Fig. 4) can be detected.
Above embodiment shows, method of the present invention has rapidly and efficiently, easy and simple to handle, high specific, highly sensitive, qualification are easy, be applicable to the advantages such as Site Detection, is suitable for applying.
Above-described embodiment is preferably embodiment of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under spirit of the present invention and principle, substitutes, combination, simplify; all should be equivalent substitute mode, within being included in protection scope of the present invention.

Claims (5)

1. a RT-LAMP detection kit for viral hemorrhagic septicemia, VHS virus, is characterized in that, comprises that following composition: RT-LAMP detects primer sets, reversed transcriptive enzyme, archaeal dna polymerase, RT-LAMP reaction solution, positive control and negative control;
Described RT-LAMP detects primer sets, comprises a pair of outer primer VHSV-F3 and VHSV-B3, a pair of inner primer VHSV-FIP and VHSV-BIP, a pair of ring primer VHSV-LF and VHSV-LB, and its nucleotide sequence is as follows respectively:
VHSV-F3：TTATCTCAACCATCTCATCACC；
VHSV-B3：TGATGCTGACTACTGCCT；
VHSV-FIP：GGATATTTTCCCAGAAGCGGTGCATGGCTCAAAGAACCG；
VHSV-BIP：TCTCAAAGTTTCGTCCCAGCCCAGTCACCTCGCATGATT；
VHSV-LF：CACTATGGGCATCTAGGCAC；
VHSV-LB：CACACTATCTTCTCAACGGTCA；
Mol ratio between described outer primer, inner primer, ring primer is 1 ︰ 8 ︰ 4.
2. the RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus according to claim 1, is characterized in that: described archaeal dna polymerase is Bst archaeal dna polymerase, and described reversed transcriptive enzyme is AMV reversed transcriptive enzyme.
3. the RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus according to claim 1, is characterized in that: described RT-LAMP reaction solution contains: 10mM dNTP, 10 × ThermoPol reaction buffer, 150mM MgSO 4the aqueous solution, three's volume ratio is 8 ︰ 5 ︰ 2.
4. the RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus according to claim 1, is characterized in that: positive control is the T carrier cloning that contains viral hemorrhagic septicemia, VHS virus envelope glycoprotein gene fragment, and negative control is DEPC water.
5. the RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus according to claim 1, is characterized in that: also contain developer SYBR Green I.
CN201310105578.9A 2013-03-28 2013-03-28 RT-LAMP test kit for viral hemorrhagic septicemia virus Expired - Fee Related CN103205508B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310105578.9A CN103205508B (en) 2013-03-28 2013-03-28 RT-LAMP test kit for viral hemorrhagic septicemia virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310105578.9A CN103205508B (en) 2013-03-28 2013-03-28 RT-LAMP test kit for viral hemorrhagic septicemia virus

Publications (2)

Publication Number Publication Date
CN103205508A CN103205508A (en) 2013-07-17
CN103205508B true CN103205508B (en) 2014-11-26

Family

ID=48752911

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310105578.9A Expired - Fee Related CN103205508B (en) 2013-03-28 2013-03-28 RT-LAMP test kit for viral hemorrhagic septicemia virus

Country Status (1)

Country Link
CN (1) CN103205508B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103952499B (en) * 2014-05-20 2016-07-20 吴斌 For detecting LAMP Primer composition and the application thereof of viral haemorrhagic septicaemia virus
KR20240038884A (en) * 2022-09-16 2024-03-26 재단법인 대구경북첨단의료산업진흥재단 Composition For Detecting Viral Hemorrhagic Septicemia Virus, Kit For Detecting the Same and Method of Detecting VHSV Using the Same based on loop mediated isothermal amplification combined with CRISPR/Cas diagnosis

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
安元龙 等.荧光环介导逆转录等温扩增（RT-LAMP)技术在病毒性出血性败血症（VHS）诊断中的应用.《中国动物检疫》.2012,第29卷(第12期),23-26. *

Also Published As

Publication number Publication date
CN103205508A (en) 2013-07-17

Similar Documents

Publication Publication Date Title
Hope et al. Comparison of quantitative RT-PCR with cell culture to detect viral hemorrhagic septicemia virus (VHSV) IVb infections in the Great Lakes
CN110129485A (en) A kind of detection kit and its detection method of quick identification African swine fever virus
CN101343672B (en) Detection reagent kit for porcine propagate and breath complex virus and uses thereof
CN103045759B (en) RT-LAMP detection primer group of spring viremia of carp virus (SVCV), kit and detection method
CN101006186A (en) Primer and probe for detection of sars coronavirus, kit comprising the primer and/or the probe, and detection method thereof
CN107828915A (en) Shrimp cream head virus（YHV）RAA constant temperature fluorescence detection method and reagent
CN103725796A (en) BVDV (bovine viral diarrhea virus) internal control typing fluorescent PCR (polymerase chain reaction) detection kit and preparation thereof
CN104032038A (en) Detection kit and detection method for siniperca chuatsi rhabdoviruses
CN104673934A (en) Koi herpesvirus RT-LAMP detection primer group, kit and detection method thereof
CN105296669A (en) RT-LAMP detection primer pairs, kit and detection method for infectious haematopoietic necrosis virus (IHNV)
CN105002298B (en) A kind of fluorescent quantitative PCR detection method of huichun viremia virus
CN103205508B (en) RT-LAMP test kit for viral hemorrhagic septicemia virus
Xu et al. The complete mitochondrial genome of the marbled rockfish Sebastiscus marmoratus (Scorpaeniformes, Scorpaenidae): genome characterization and phylogenetic considerations
CN103173568B (en) Primer group, kit and method for rapidly identifying 1 type dengue fever virus
Shi et al. A survey of jaagsiekte sheep retrovirus (JSRV) infection in sheep in the three northeastern provinces of China
CN101487064B (en) Method and special reagent kit for detecting five zoonosis virus
CN101294226B (en) RT-PCR method for testing hantavirus genome
CN106435020B (en) For detecting the universal kit of different genotype infectious bronchitis virus
CN106191319B (en) A kind of multi-fluorescence immunoassay method of 6 kinds of fowl respiratory pathogens of quick differentiation
CN108998575B (en) Establishment of double PCR detection method for chicken parvovirus and chicken newcastle disease virus
CN102108420B (en) Fluorescence quantitative polymerase chain reaction (PCR) kit for detecting dengue virus type 1
CN116083654A (en) Double PCR detection method for type 2 and type 3 herpesviruses of carp
CN113234862B (en) African swine fever virus LAMP detection primer group and kit
Seo et al. Rapid diagnosis of two marine viruses, red sea bream iridovirus and viral hemorrhagic septicemia virus by PCR combined with lateral flow assay
CN109628640B (en) RPA-LFD primer, method and kit for rapidly detecting spring viremia of carp virus

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20141126

Termination date: 20150328

EXPY Termination of patent right or utility model