CN103205508A - RT-LAMP test primer set, kit and test method for viral hemorrhagic septicemia virus - Google Patents
RT-LAMP test primer set, kit and test method for viral hemorrhagic septicemia virus Download PDFInfo
- Publication number
- CN103205508A CN103205508A CN2013101055789A CN201310105578A CN103205508A CN 103205508 A CN103205508 A CN 103205508A CN 2013101055789 A CN2013101055789 A CN 2013101055789A CN 201310105578 A CN201310105578 A CN 201310105578A CN 103205508 A CN103205508 A CN 103205508A
- Authority
- CN
- China
- Prior art keywords
- vhsv
- lamp
- viral hemorrhagic
- hemorrhagic septicemia
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention belongs to the technical field of molecular biology, and relates to aquatic marine aquaculture industry detection method, particularly to a RT-LAMP test primer set, a test kit and a test method of viral hemorrhagic septicemia virus. The test primer set comprises outer primers, inner primers and ring primers. The test kit mainly comprises primer liquids, reaction solutions, DNA polymerase, reverse transcriptase and controls. The test method comprises that: RNA of virus to be tested is extracted, reverse transcription activity of the reverse transcriptase is utilized, and six specific primers and DNA polymerase with strand displacement activity are adopted to amplify the sample RNA template, wherein the pg grade pure viral RNA can be tested; and identification adopts SYBR Green I addition and ESE-Quant-tube Scanner instrument detection or adopts a turbidity instrument to determine whether the sample contains the viral hemorrhagic septicemia virus RNA. According to the present invention, advantages of rapidness, high efficiency, simple operation, high specificity, high sensitivity, simple identification, easy on-site test, and the like are provided, and popularization and application are easily achieved.
Description
Technical field
The invention belongs to technical field of molecular biology, relate to the detection method of marine aquaculture industry, the RT-LAMP that is specifically related to a kind of viral hemorrhagic septicemia, VHS virus (VHSV) detects primer sets, detection kit and detection method.
Background technology
Viral hemorrhagic septicemia (VHS) be a kind of salmon trout that can infect the various ages and various ocean fishes (as cod, Pacific herring, Ta, Channel-catfish, pike and turbot, lefteye flounder etc.) that can free livings lethality, the general transmissible disease.Usually at the beginning of last month of spring in winter and popular during 8～10 ℃ of water temperatures, water temperature rises to more than 15 ℃, and sickness rate reduces.This disease is popular in whole Europe continent, North America and Japan, and infectivity is extremely strong, in every premium on currency in morbidity fishing ground 1000 viruses is arranged.The principal character of viral hemorrhagic septicemia is hemorrhage, and this disease latent period is 7-25 days under the natural condition.Because of symptom emergency and performance difference, divide three types of acute, chronic type and nervous system types.Viral hemorrhagic septicemia, VHS virus can be discharged virus by sick fish or with the movement of malicious fish, ovum, seminal fluid etc., and diffusion is propagated in water body, and virus is invaded the fish body and infected through the fish gill.Sick fish shows as no point of destination and floats, health blackout, skin and gill oozing of blood ulcer; Ophthalmoptosis, anus redness, belly enlargement.Cut open the visible a large amount of haemolysis ascites of inspection; Intestines, the heart, kidney, fish glue are also hemorrhage together with muscle sometimes, the internal organ oedema.
The cause of disease of VHS is viral haemorrhagic septicaemia virus (VHSV), belongs to Rhabdoviridae Novirhabdovirus and belongs to.Viral genome is one section minus-strand RNA, and 5 albumen of its glm gene group coding comprise: nucleocapsid protein (N albumen), two structural protein (M1 and M2 albumen), glycoprotein (G albumen) and RNA polymerase (L albumen).The VHSV particle is about 180nm, wide about 70nm.The about 12k of its a genome length base.Culture of isolated viral hemorrhagic septicemia, VHS virus generally needs just can obtain a result more than 15 days, and sense cycle is oversize, incompatibility port rapid detection and the requirements of the times of being open to the custom greatly.Therefore, set up a kind of fast, accurately, high-throughput and instrument less demanding detection kit and detection method become present urgent problem.
The gene test of technology has well solved the drawback of present gene test just based on a kind of new constant temperature nucleic acid amplification method (loop-mediated isothermal amplification of DNA is called for short LAMP).The LAMP technology is utilized Bst archaeal dna polymerase and the special inside and outside primer of two couples that designs according to different target sequences, and six isolated areas on the specific recognition target sequence start the endless chain replacement(metathesis)reaction.In the LAMP reaction, inner primer is hybridized in the target dna district, and it is synthetic to start complementary strand, causes dumbbell shaped DNA to produce.This structure is very fast carries out the synthetic extension of DNA with from as template, forms stem-circular DNA structure, and this stem-ring structure DNA is as the initial structure of LAMP circulation.Owing to inner primer is hybridized on the ring of stem-ring, the synthetic DNA of primer strand displacement produces a stem jaggy-circular DNA intermediary, has target sequence at stem.Again by outer primer, form ring texture at the end of stem, the go round and begin again stem-circular DNA mixture of the Cauliflower structure that is formed with a lot of rings of result's complementary sequence on same chain.
The RT-LAMP method is a kind of gene amplification method of easy, quick, high degree of specificity.And do not need special reagent and plant and instrument, therefore definitely can set up the cheap detection architecture of total cost.This method is applicable to on-the-spot the detection and a large amount of sample high throughput testing, and at clinical disease diagnosis, fields such as gene chip exploitation and food hygiene quality check have broad application prospects.By constant temperature gene amplification technology and round pcr (comprising the fluorescence real-time quantitative PCR technology) are compared, can find that this technology is equivalent to or is better than round pcr in methodology indexs such as sensitivity, specificity and sensing ranges, and do not rely on any special plant and instrument and realize on-the-spot high-throughput rapid detection, and detect cost far below fluorescent quantitative PCR technique.
Summary of the invention
One object of the present invention is to provide a kind of RT-LAMP of viral hemorrhagic septicemia, VHS virus to detect primer sets.
Another object of the present invention is to provide a kind of RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus.
Another object of the present invention is to provide the RT-LAMP detection method of viral hemorrhagic septicemia, VHS virus.
The technical solution adopted in the present invention is as follows:
The RT-LAMP of a kind of viral hemorrhagic septicemia, VHS virus (VHSV) detects primer sets, comprise a pair of outer primer VHSV-F3 and VHSV-B3, a pair of inner primer VHSV-FIP and VHSV-BIP, a pair of ring primer VHSV-LF and VHSV-LB, its nucleotide sequence is as follows respectively:
VHSV-F3：TTATCTCAACCATCTCATCACC（SEQ?ID?NO:1）；
VHSV-B3：TGATGCTGACTACTGCCT（SEQ?ID?NO:2）；
VHSV-FIP：GGATATTTTCCCAGAAGCGGTGCATGGCTCAAAGAACCG（SEQ?ID?NO:3）；
VHSV-BIP：TCTCAAAGTTTCGTCCCAGCCCAGTCACCTCGCATGATT（SEQ?ID?NO:4）；
VHSV-LF：CACTATGGGCATCTAGGCAC（SEQ?ID?NO:5）；
VHSV-LB：CACACTATCTTCTCAACGGTCA（SEQ?ID?NO:6）。
The RT-LAMP detection kit of a kind of viral hemorrhagic septicemia, VHS virus (VHSV), it comprises that the described RT-LAMP of claim 1 detects primer sets.
The RT-LAMP detection kit of a kind of viral hemorrhagic septicemia, VHS virus (VHSV) comprises following composition: described RT-LAMP detects primer sets, reversed transcriptive enzyme, archaeal dna polymerase, RT-LAMP reaction solution, positive control and negative control.
Preferably, in the described detection kit, the mol ratio of outer primer, inner primer, ring primer is 1 ︰, 8 ︰ 4 in the described primer sets.
Preferably, in the described detection kit, described archaeal dna polymerase is the Bst archaeal dna polymerase; Described reversed transcriptive enzyme is the AMV reversed transcriptive enzyme.
Preferably, in the described detection kit, described RT-LAMP reaction solution contains: 10mM dNTP, 10 * ThermoPol reaction buffer, 150mM MgSO
4The aqueous solution, three's volume ratio are 8 ︰, 5 ︰ 2.
Preferably, in the described detection kit, described positive control is for containing the T carrier cloning of viral hemorrhagic septicemia, VHS virus (VHSV) envelope glycoprotein gene fragment, and negative control is DEPC water.
Can also contain developer in the detection kit of the present invention, described developer is fluorescence dye SYBR Green I.
Utilize above-mentioned test kit to detect the method for viral hemorrhagic septicemia, VHS virus (VHSV), comprise the steps
(1), the extraction of sample RNA to be checked: adopt viral RNA to extract test kit and extract sample RNA;
(2), constant temperature gene amplification reaction: 25 μ l reaction systems contain: VHSV-F30.2 μ M, VHSV-B30.2 μ M, VHSV-FIP1.6 μ M, VHSV-BIP1.6 μ M, VHSV-LF0.8 μ M, VHSV-LB0.8 μ M, RT-LAMP reaction solution 12.5 μ l, reversed transcriptive enzyme 1U, archaeal dna polymerase 8U, RNA1～100ng to be checked uses DEPC water polishing to 25 μ l; Positive control and negative control are set; With centrifugal behind the PCR pipe mixing for preparing, and in 63～65 ℃ of reaction 60～90min, and at 80 ℃ of lasting 2min;
(3), the result judges: change to judge amplification by the turbidity that precipitates in the observing response pipe.
In test kit, contain under the situation of developer, in reaction tubes, add 10 * SYBR Green I0.5 μ l, with placing ESE-Quant Tube Scanner in the reaction tubes, judge amplification according to the fluorescent signal that instrument read in real time then.
The present invention is according to envelope glycoprotein gene (the gly G gene of viral hemorrhagic septicemia, VHS virus (VHSV), the GenBank accession number is DQ401190.1) designed six Auele Specific Primers, use above-mentioned six primers, 6 zones of amplified target sequence, any zone and primer do not match and all can not carry out nucleic acid amplification in 6 zones, so its specificity is high, and highly stable, it is low to form the primer dimer probability, has guaranteed that successful reaction carries out; Make that the present invention has rapidly and efficiently, easy and simple to handle, high specific, highly sensitive, evaluation are easy, be fit to beneficial effect such as on-the-spot detection:
(1), rapidly and efficiently: whole amplification only can be finished with 60～90min, and amplification output can reach 10
9～10
10Individual copy;
(2), easy and simple to handle: do not need complicated instrument, do not need special reagent, do not need to carry out in advance the loaded down with trivial details steps such as sex change of double-stranded DNA, only need a steady temperature instrument just to react and detect, condition is relatively gentleer;
(3), high specific: to common several fish virus SVCVs (SVCV), infectious hematopoietic necrosis's poison (IHNV), and flounder rhabdovirus (HRV), pike juvenile fish rhabdovirus (PFRV), infectious pancreatic necrosis virus (IPNV) RNA no cross reaction.
(4), highly sensitive: the lowest detection limit can reach the 4.5pg/ reaction;
Whether (5), evaluation is easy: can add SYBR Green I colour-change or exist magnesium pyrophosphate to precipitate whether to judge amplification by observing, need not other any analytical procedures such as electrophoresis, be fit to on-the-spot detection.
Description of drawings
Fig. 1 is the specificity of the SVCV of primer VHSV-2, IHNV among the present invention,
Wherein, 1,2:DEPC handles the water contrast; 3,6:IHNV RNA; 4,7:SVCV RNA; 5,8:VHSV RNA;
Fig. 2 is the specificity of the HRV of primer VHSV-2, PFRV among the present invention,
Wherein, 1,2:DEPC handles the water contrast; 3,4:HRV RNA; 5,6:PFRV RNA; 7,8:VHSV RNA;
Fig. 3 is the specificity of the IPNV of primer VHSV-2 among the present invention,
Wherein, 1,2:DEPC handles the water contrast; 3,4:VHSV RNA; 5,6:IPNV RNA;
Fig. 4 is the sensitivity of RT-LAMP primer VHSV-2 among the present invention.
Wherein, 1:10
0Doubly dilution; 2:10
1Doubly dilution; 3:10
2Doubly dilution; 4:10
3Doubly dilution; 5:10
4Doubly dilution; 6:10
5Doubly dilution; 7:10
6Doubly dilution; The contrast of 8:DEPC water.
Embodiment
The present invention is further illustrated below in conjunction with embodiment, but be not limited thereto.
The foundation of viral hemorrhagic septicemia, VHS virus RT-LAMP detection kit
The RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus comprises RT-LAMP primer sets, RT-LAMP reaction solution, Bst archaeal dna polymerase, AMV reversed transcriptive enzyme, positive control and negative control.
(1), RT-LAMP design of primers: with envelope glycoprotein gene (the gly G gene of viral hemorrhagic septicemia, VHS virus (VHSV), the GenBank accession number is DQ401190.1) be target gene, utilize online design software Primer Explorer version4 (http://primerexplorer.jp/e) to carry out the LAMP primer design.Primer sequence sees Table 1.
Table 1 primer sequence table
(2), RT-LAMP reaction solution: contain 10mM dNTP, 10 * ThermoPol reaction buffer, the 150mM MgSO4 aqueous solution, three's volume ratio is 8 ︰, 5 ︰ 2.
(3), positive control is for containing the T carrier cloning of viral hemorrhagic septicemia, VHS virus (VHSV) envelope glycoprotein gene fragment, its preparation method is: the viral hemorrhagic septicemia, VHS virus with isolation identification is template, utilize the outer primer (SEQ ID NO:1 and SEQ ID NO:2) in the table 1 that VHSV RNA is carried out reverse transcription, obtain containing the cDNA of target-gene sequence, after use outer primer SEQ ID NO:1 and SEQ ID NO:2 again) amplification, gained gene fragment length is 221bp, sequence is shown in SEQ ID NO:7, reclaim this amplified fragments, utilize ordinary method to be connected in the T carrier, be positive control.
(4), negative control is DEPC water.
Use turbidimeter to set up viral hemorrhagic septicemia, VHS virus RT-LAMP detection method, utilize the method for the test kit detection viral hemorrhagic septicemia, VHS virus of above-mentioned gained, comprise the steps:
(1), the extraction of sample RNA to be checked: adopt viral RNA to extract test kit and extract sample RNA;
(2), constant temperature gene amplification reaction: 25 μ l reaction systems contain: VHSV-F30.2 μ M, VHSV-B30.2 μ M, VHSV-FIP1.6 μ M, VHSV-BIP1.6 μ M, VHSV-LF0.8 μ M, VHSV-LB0.8 μ M, RT-LAMP reaction solution 12.5 μ l, AMV reversed transcriptive enzyme 1U, Bst archaeal dna polymerase 8U, RNA1～100ng to be checked uses DEPC water polishing to 25 μ l; Positive control and negative control are set; With centrifugal behind the PCR pipe mixing for preparing, and in 63～65 ℃ of reaction 60～90min, and at 80 ℃ of lasting 2min;
(3), the result judges: change to judge amplification by the turbidity that precipitates in the observing response pipe.If precipitation is then positive, it is then negative not have precipitation.
ESE-Quant tube scanner detects
The developer (SYBR Green I) that does not have in increasing embodiment 1 in the test kit, all the other are with embodiment 1.
By the following method viral hemorrhagic septicemia, VHS virus to be measured (VHSV) is detected with above-mentioned test kit:
(1), the extraction of sample RNA to be checked: adopt viral RNA to extract test kit and extract purifying testing sample RNA;
(2), constant temperature gene amplification reaction: 25 μ l reaction systems contain: VHSV-F30.2 μ M, VHSV-B30.2 μ M, VHSV-FIP1.6 μ M, VHSV-BIP1.6 μ M, VHSV-LF0.8 μ M, VHSV-LB0.8 μ M, RT-LAMP reaction solution 12.5 μ l, AMV reversed transcriptive enzyme 1U, Bst archaeal dna polymerase 8U, 10 * SYBRGreen I0.5 μ l, RNA1～100ng to be checked uses DEPC water polishing to 25 μ l; Positive control and negative control are set; With centrifugal behind the PCR pipe mixing for preparing, in 65 ℃ of reaction 60min, and at 80 ℃ of lasting 2min;
(3), the result judges: reaction tubes is placed among the ESE-Quant tube Scanner reacts, observe ESE-Tube Scanner software and judge amplification, if " S " type curve is then positive, it is then negative not have " S " type curve.
The specificity experiment
Respectively to viral hemorrhagic septicemia, VHS virus (VHSV) RNA, SVCV (SVCV) RNA, infectious hematopoietic necrosis's poison (IHNV) RNA of separation and purification, and flounder rhabdovirus (HRV), pike juvenile fish rhabdovirus (PFRV), infectious pancreatic necrosis virus (IPNV) RNA detect with the method for embodiment 2.
Qualification result shows: be primer with viral hemorrhagic septicemia, VHS virus (VHSV) RT-LAMP primer, VHSV RNA normally increases, and negative water contrast and SVCV, IHNV be amplification not, demonstrates good specificity (see figure 1).VHSV RNA normally increases, and negative water contrast and HRV, PFRV be amplification not, demonstrates good specificity (see figure 2).VHSV RNA normally increases, and amplification does not appear in negative water contrast and IPNV RNA, demonstrates good specificity (see figure 3).
Sensitivity experiment
Viral hemorrhagic septicemia, VHS virus (VHSV) RNA of purifying is made 10 times of gradient dilutions, respectively viral hemorrhagic septicemia, VHS virus (VHSV) RNA after diluting is detected with the working method of embodiment 1.
Qualification result shows: be primer with VHSV LAMP primer, and 10
0～10
6Doubly dilute VHSV RNA and increase 10
4, 10
5, 10
6Doubly not amplification of dilution and negative water contrast.Through the measurement of rna content, obtain viral hemorrhagic septicemia, VHS virus (VHSV) primer and can detect p g level VHSV RNA(and see Fig. 4).
Above embodiment shows, method of the present invention has rapidly and efficiently, easy and simple to handle, high specific, highly sensitive, evaluation are easy, be fit to advantage such as on-the-spot detection, is suitable for applying.
Above-described embodiment is preferred implementation of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under spirit of the present invention and the principle, substitutes, combination, simplify; all should be the substitute mode of equivalence, be included within protection scope of the present invention.
Claims (10)
1. the RT-LAMP of a viral hemorrhagic septicemia, VHS virus detects primer sets, comprise a pair of outer primer VHSV-F3 and VHSV-B3, a pair of inner primer VHSV-FIP and VHSV-BIP, a pair of ring primer VHSV-LF and VHSV-LB, its nucleotide sequence is as follows respectively:
VHSV-F3：TTATCTCAACCATCTCATCACC；
VHSV-B3：TGATGCTGACTACTGCCT；
VHSV-FIP：GGATATTTTCCCAGAAGCGGTGCATGGCTCAAAGAACCG；
VHSV-BIP：TCTCAAAGTTTCGTCCCAGCCCAGTCACCTCGCATGATT；
VHSV-LF：CACTATGGGCATCTAGGCAC；
VHSV-LB：CACACTATCTTCTCAACGGTCA。
2. the RT-LAMP detection kit of a viral hemorrhagic septicemia, VHS virus is characterized in that, detection kit comprises that the described RT-LAMP of claim 1 detects primer sets.
3. the RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus according to claim 2, it is characterized in that, comprise following composition: described RT-LAMP detects primer sets, reversed transcriptive enzyme, archaeal dna polymerase, RT-LAMP reaction solution, positive control and negative control.
4. the RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus according to claim 1, it is characterized in that: the mol ratio between described outer primer, inner primer, the ring primer is 1 ︰, 8 ︰ 4.
5. the RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus according to claim 3, it is characterized in that: described archaeal dna polymerase is the Bst archaeal dna polymerase, described reversed transcriptive enzyme is the AMV reversed transcriptive enzyme.
6. the RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus according to claim 3, it is characterized in that: described RT-LAMP reaction solution contains: 10mM dNTP, 10 * ThermoPol reaction buffer, 150mM MgSO
4The aqueous solution, three's volume ratio are 8 ︰, 5 ︰ 2.
7. the RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus according to claim 3, it is characterized in that: positive control is the T carrier cloning that contains viral hemorrhagic septicemia, VHS virus envelope glycoprotein gene fragment, and negative control is DEPC water.
8. the RT-LAMP detection kit of viral hemorrhagic septicemia, VHS virus according to claim 3 is characterized in that: also contain developer SYBR Green I.
9. utilize each described test kit of claim 2～8 to detect the method for viral hemorrhagic septicemia, VHS virus, comprise the steps:
(1), the extraction of sample RNA to be checked: adopt viral RNA to extract test kit and extract sample RNA;
(2), constant temperature gene amplification reaction: 25 μ l reaction systems contain: VHSV-F30.2 μ M, VHSV-B30.2 μ M, VHSV-FIP1.6 μ M, VHSV-BIP1.6 μ M, VHSV-LF0.8 μ M, VHSV-LB0.8 μ M, LAMP reaction solution 12.5 μ l, reversed transcriptive enzyme 1U, archaeal dna polymerase 8U, RNA1～100ng to be checked uses DEPC water polishing to 25 μ l; Positive control and negative control are set; With centrifugal behind the PCR pipe mixing for preparing, and in 63～65 ℃ of reaction 60～90min, and at 80 ℃ of lasting 2min;
(3), the result judges: change to judge amplification by the turbidity that precipitates in the observing response pipe.
10. utilize each described test kit of claim 2～8 to detect the method for viral hemorrhagic septicemia, VHS virus, comprise the steps:
(1), the extraction of sample RNA to be checked: adopt viral RNA to extract test kit and extract purification of samples RNA;
(2), constant temperature gene amplification reaction: 25 μ l reaction systems contain: VHSV-F30.2 μ M, VHSV-B30.2 μ M, VHSV-FIP1.6 μ M, VHSV-BIP1.6 μ M, VHSV-LF0.8 μ M, VHSV-LB0.8 μ M, RT-LAMP reaction solution 12.5 μ l, reversed transcriptive enzyme 1U, archaeal dna polymerase 8U, 10 * SYBR Green I0.5 μ l, RNA1～100ng to be checked uses DEPC water polishing to 25 μ l; Positive control and negative control are set; With centrifugal behind the PCR pipe mixing for preparing, and in 63～65 ℃ of reaction 60～90min, and at 80 ℃ of lasting 2min;
(3), the result judges: with placing ESE-Quant Tube Scanner in the above-mentioned reaction tubes, judge amplification according to the fluorescent signal that instrument reads in real time.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310105578.9A CN103205508B (en) | 2013-03-28 | 2013-03-28 | RT-LAMP test kit for viral hemorrhagic septicemia virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310105578.9A CN103205508B (en) | 2013-03-28 | 2013-03-28 | RT-LAMP test kit for viral hemorrhagic septicemia virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103205508A true CN103205508A (en) | 2013-07-17 |
| CN103205508B CN103205508B (en) | 2014-11-26 |
Family
ID=48752911
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310105578.9A Expired - Fee Related CN103205508B (en) | 2013-03-28 | 2013-03-28 | RT-LAMP test kit for viral hemorrhagic septicemia virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103205508B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103952499A (en) * | 2014-05-20 | 2014-07-30 | 吴斌 | LAMP (loop-mediated isothermal amplification) primer composition used for detecting viral haemorrhagic septicaemia viruses and application of primer composition |
| WO2024058300A1 (en) * | 2022-09-16 | 2024-03-21 | 재단법인 대구경북첨단의료산업진흥재단 | Vhsv detection composition using gene scissors and loop-mediated isothermal amplification, kit, and vhsv detection method using same |
-
2013
- 2013-03-28 CN CN201310105578.9A patent/CN103205508B/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| 安元龙 等: "荧光环介导逆转录等温扩增（RT-LAMP)技术在病毒性出血性败血症（VHS）诊断中的应用", 《中国动物检疫》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103952499A (en) * | 2014-05-20 | 2014-07-30 | 吴斌 | LAMP (loop-mediated isothermal amplification) primer composition used for detecting viral haemorrhagic septicaemia viruses and application of primer composition |
| CN103952499B (en) * | 2014-05-20 | 2016-07-20 | 吴斌 | For detecting LAMP Primer composition and the application thereof of viral haemorrhagic septicaemia virus |
| WO2024058300A1 (en) * | 2022-09-16 | 2024-03-21 | 재단법인 대구경북첨단의료산업진흥재단 | Vhsv detection composition using gene scissors and loop-mediated isothermal amplification, kit, and vhsv detection method using same |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103205508B (en) | 2014-11-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Soliman et al. | Reverse transcription loop-mediated isothermal amplification (RT-LAMP) for rapid detection of viral hemorrhagic septicaemia virus (VHS) | |
| Hope et al. | Comparison of quantitative RT-PCR with cell culture to detect viral hemorrhagic septicemia virus (VHSV) IVb infections in the Great Lakes | |
| CN101343672B (en) | Detection reagent kit for porcine propagate and breath complex virus and uses thereof | |
| CN102414217A (en) | Probes and primers for detection of chikungunya | |
| CN103045759B (en) | RT-LAMP detection primer group of spring viremia of carp virus (SVCV), kit and detection method | |
| CN107828915A (en) | Shrimp cream head virus（YHV）RAA constant temperature fluorescence detection method and reagent | |
| CN105002298B (en) | A kind of fluorescent quantitative PCR detection method of huichun viremia virus | |
| CN110643745A (en) | Composition and kit for detecting feline calicivirus and feline parvovirus and application thereof | |
| CN103397105A (en) | Kit for detecting GII type norovirus and applications thereof | |
| Pezzoni et al. | Foot‐and‐mouth disease outbreaks due to an exotic virus serotype A lineage (A/AFRICA/G‐IV) in Algeria in 2017 | |
| CN104673934A (en) | Koi herpesvirus RT-LAMP detection primer group, kit and detection method thereof | |
| CN105296669A (en) | RT-LAMP detection primer pairs, kit and detection method for infectious haematopoietic necrosis virus (IHNV) | |
| CN109439801B (en) | Real-time fluorescence RT-PCR detection kit and detection method for israel acute paralysis virus of bees | |
| Louboutin et al. | Comparative analysis of the course of infection and the immune response in rainbow trout (Oncorhynchus mykiss) infected with the 5 genotypes of infectious hematopoietic necrosis virus | |
| CN103205508B (en) | RT-LAMP test kit for viral hemorrhagic septicemia virus | |
| CN106435029A (en) | Primer group for detecting feline infectious peritonitits virus, kit and detecting method thereof | |
| CN106435021A (en) | Kit for detecting Newcastle disease viruses of chicken with different genotypes | |
| CN112048571B (en) | Grass carp reovirus II type nested RT-PCR detection primer group, kit and application thereof | |
| CN106435020B (en) | For detecting the universal kit of different genotype infectious bronchitis virus | |
| CN112322789A (en) | Nested PCR (polymerase chain reaction) kit and method for detecting double RNA (ribonucleic acid) viruses of micropterus salmoides | |
| CN109628640B (en) | RPA-LFD primer, method and kit for rapidly detecting spring viremia of carp virus | |
| CN102108420B (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for detecting dengue virus type 1 | |
| CN116083654A (en) | Double PCR detection method for type 2 and type 3 herpesviruses of carp | |
| CN113234862B (en) | African swine fever virus LAMP detection primer group and kit | |
| Seo et al. | Rapid diagnosis of two marine viruses, red sea bream iridovirus and viral hemorrhagic septicemia virus by PCR combined with lateral flow assay |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141126 Termination date: 20150328 |
|
| EXPY | Termination of patent right or utility model |