CN103205378B - Oil-degradation oil-and-salt tolerance bacterial strain, and screening method and application thereof - Google Patents
Oil-degradation oil-and-salt tolerance bacterial strain, and screening method and application thereof Download PDFInfo
- Publication number
- CN103205378B CN103205378B CN201310095318.8A CN201310095318A CN103205378B CN 103205378 B CN103205378 B CN 103205378B CN 201310095318 A CN201310095318 A CN 201310095318A CN 103205378 B CN103205378 B CN 103205378B
- Authority
- CN
- China
- Prior art keywords
- oil
- bacterial strain
- degradation
- degraded
- salt tolerance
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The invention relates to an oil-degradation oil-and-salt tolerance bacterial strain which is named as SY-1. The systematic name of the SY-1 is Escherichia coli, the file number is CGMCC (China General Microbiological Culture Collection Center No.7075, the file date is December 31, 2012, the file address is the Micro-organism Study of Chinese Academy of Sciences, No.3, No.1 Beichen west road, Chaoyang district, Beijing city, and the file unit is China General Microbiological Culture Collection Center. The oil-degradation oil-and-salt tolerance bacterial strain is good in oil and salt tolerance, is Gram-negative bacterium shaped in short rhabditiform and with flagellum and no spores and active, is in citrate and glucose ammonium salt positive property and can generate catalase without gelatinase. The bacterial strain is fast in growth, can grow in oil used as unique carbon source, and has the advantages of oil degradation.
Description
Technical field
The invention belongs to Microbial Breeding and ecosphere, especially a kind of oil resistant salt tolerant bacterial strain of degraded oil and screening method and application.
Background technology
Oil has played vital effect as main energy substance to the development of human society, but inevitably can be to environment in oil production, transportation, handling, processing and use procedure.According to incompletely statistics, the whole world approximately has 1.0 × 10 every year
10kg oil enters soil or water body by all means, and polluted underground water, inflow ocean, change aquatic environment, and water body animals and plants and marine organisms are all on the hazard.Along with the continuous deterioration of global environment, the safety of ecotope more and more receives people's concern.
Oil mainly concentrates on ocean and soil to the harm of environment.Oil is across the sea floating, diffuses to form rapidly oil film, can be moved, be transformed by diffusion, evaporation, dissolving, emulsification, photodegradation and biological degradation and absorption etc.Oils can attach on the fish gill, and fish is suffocated; Suppress aquatic bird and lay eggs and hatch, destroy the water-permeable of its feather, reduce aquatic product quality.The oil film forming hinders the reoxygenation effect of water body, affects marine plankton growth, destroys marine ecology balance, in addition, also can destroy beachscape, affects its tourist environment etc.Oil enters the organic the Nomenclature Composition and Structure of Complexes that changes soil after soil, affects growth and breeding and the changes in distribution of Soil Microorganism; A large amount of oil can stop up soil pores, and the activity of enzyme in soil is also had to restraining effect; In addition, oil some composition after a series of effects of soil ecosystem forms accumulation in crop, thereby affects grain quality, goes forward side by side into food chain, jeopardizes human health.
The treatment process of petroleum pollution mainly contains the combination of Physical, chemical method, biological process and different methods.The feature of physical treatment process is relatively simple, safety, and the oil recovery control the diffusion of oil spilling of overflowing is applicable to happen suddenly.Chemical process is instant effect, even if also can process at short notice large-area oil spilling under atrocious weather, but shortcoming is to use the chemical agents such as oil spill dispersant to waste energy, and may produce secondary pollution; Solidifying oiliness can be lower, complex manufacturing, and high expensive, expensive, be difficult to be applied in practice.Biological treatment, occurring in nature exists in a large number microorganism that can degraded oil, by artificial screening, cultivation, even improves these microorganisms, is then rendered to contaminated district.The biological degradation of petroleum hydrocarbon, has that cost is low, an instant effect, free of contamination feature.Bioremediation technology is the environmental pollution treatment technology in the world with development potentiality.
By retrieval, find the following several pieces of patent publication us relevant to present patent application:
1. low temperature resistant oil degradation bacterial strain, cultural method, substratum and application (CN102021128A) thereof, the present invention relates to low temperature resistant oil degradation bacterial strain, cultural method, substratum and application thereof, low temperature resistant oil degradation bacterial strain of the present invention is Paracoccus sp.D17 and Paracoccus sp.D24; Screen above-mentioned two kinds of bacterium liquid nutrient mediums, this substratum by every 1000 mL medium liquids by 0.5 g NaCl, 0.1 g K
2hPO
4, 0.1 g NH
4h
2pO
4, 0.1 g (NH
4)
2sO
4, 0.02 g MgSO
47H
2o, 0.3 g KNO
3, the ultrapure water composition of 700-900 mL oil field waste and surplus; Screen above-mentioned two kinds of solid mediums that bacterium is used, it adds 15～20 g agar in addition by every 1000 mL of liquid nutrient medium, is more evenly coated with 20～30 μ L sterilizing crude oil formation in media surface; Above-mentioned two kinds of bacterium are applied in the biological restoration of petroleum hydrocarbon degradation and soil or petroleum polluting water body.Two kinds of psychrophiles of the present invention can be applicable in low temperature environment, and the improvement of soil petroleum pollution in low temperature environment is had to great value.
2. the bacterium of a strain degraded oil and application thereof (CN1580241), discloses bacterium and the application thereof of a strain degraded oil.The bacterium of degraded oil provided by the present invention is bacillus cereus (Bacillus cereus) HP CGMCC № 1141.Experiment showed, that this bacterial strain can improve former oil properties effectively, acid value for crude oil improves more than 8 times, and light component increases, and the content of wax is containing glue reduced rate 30%-50%, and rheological characteristic of crude oil improves, interfacial tension lowering between profit, and in fermented liquid, the substances content such as organic acid increases; Its metabolism crude oil approach is time end oxidation, has produced a kind of novel lipid tensio-active agent.This bacterial strain can be widely used in particularly microbial enhanced oil recovery field, petroleum production engineering field.
3. the bacterial strain of a strain decomposing petroleum hydrocarbon and application thereof (CN101691552A), discloses bacterial strain and the application thereof of a strain decomposing petroleum hydrocarbon.This bacterial strain is citric acid bacillus (Citrobacter sp.) WTS, and its deposit number is CGMCC No.3253.Bacterial strain of the present invention has the ability of very strong decomposing petroleum hydrocarbon.Bacterial strain of the present invention, microbial inoculum and application method thereof provide theoretical foundation for the biological restoration work that China carries out oil-polluted soils; the repair polluting because of leakage in China's field area environmental protection work and oil transportation is significant; the progress of accelerating the work of petroleum pollution biological restoration, has important economic implications.
By contrast, there are the different of essence from above-mentioned patent publication us in patent application of the present invention.
Summary of the invention
The object of the invention is to overcome the deficiencies in the prior art part, a kind of bacterial strain of oil resistant good salt tolerance of degraded oil is provided, this bacterial strain is a kind of fast growth, and bacterial strain that can be take oil as sole carbon source can be used for the biological restoration on petroleum pollution ground.Meanwhile, also provide a kind of screening method of oil resistant salt tolerant bacterial strain of degraded oil, the method can filter out the bacterial classification take oil as sole carbon source, easy and simple to handle, quick, can significantly shorten the bacterial strain screening time.
The object of the invention is to be achieved through the following technical solutions:
A kind of oil resistant salt tolerant bacterial strain of degraded oil, name is called SY-1, specific name: colon bacillus Escherichia coli, deposit number is: CGMCC No.7075, preservation date: on December 31st, 2012, preservation address is: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, depositary institution: China Committee for Culture Collection of Microorganisms's common micro-organisms center.
And described bacterial strain is 40%-50% to the degradation rate of oil.
And, the culture medium prescription that described bacterial strain is used: KH
2pO
43.4 g, Na
2hPO
41.5 g, (NH
4)
2sO
44.0 g, MgSO
40.7 g, NaCl 1.6 g, yeast powder 0.01g, Tween-80 0.6 mL, oil 5.0g ~ 25.0 g, tap water 1000 mL, pH 7.2～7.6, different steps is added different content oil.
And described bacterial strain is take oil as sole carbon source.
And the salt tolerance of described bacterial strain is that NaCl mass concentration is 7%.
And described bacterial strain is that oil mass concentration is 10% to the patience of oil.
The screening method of the oil resistant salt tolerant bacterial strain of degraded oil as above, screening step is as follows:
(1) sampling: choose the soil of certain oil field oil storage tank and the 2-10 cm of producing well place, remove foreign material and packed in aseptic valve bag standby;
(2) bacterial strain primary dcreening operation: take pedotheque and make soil supension, for 1:8 ~ 12 join oil mass concentration by soil supension, be in 0.5% inorganic mineral salt nutrient solution by volume, cultivate the strain domestication that carries out 4 cycles after 3 d, domestication step is: for 1:8 ~ 12, get last nutrient solution by volume and join in the aseptic inorganic mineral salt nutrient solution that contains oil that (petroleum concentration is from 0.5-2.5 g/100mL, each 0.5 g oil that increases), get last domestication bacterium liquid, gradient dilution becomes 10
-1, 10
-2, 10
-3, 10
-4, 10
-5, 10
-6, 10
-7, get respectively 10
-5, 10
-6, 10
-7dilution bacterium liquid 0.5mL joins respectively on beef extract-peptone, PDA substratum, No. 1 solid medium flat board of Gao Shi, and evenly, in 30 ℃ of cultivation 2-3 d, the bacterial strain of the different colonial morphologies of picking, saves backup in coating;
(3) bacterial strain sieves again; Picking step is the middle bacterial strain of preserving that separates (2), be inoculated into respectively and contain on 0.5 g oil/100mL inorganic mineral salt culture medium solid plate, respectively at 30 ℃ of cultivation 2-3 d, picking forms the bacterial strain of biting oil mark in periphery of bacterial colonies, line is separated into single strain, and preservation is standby;
(4) bacterial strain oil resistant characteristic: by step seed liquor after bacterial strain activation to be determined in (3), by 3% inoculum size, accessing every 100 mL is respectively in the inorganic salt minerals nutrient solution of 0.5 g, 1 g, 2 g, 4 g, 6 g, 8 g, 10 g, 12 g containing oil, 30 ℃, 160 ~ 200 r/min are cultivated 6 ~ 8 d, get nutrient solution color change and become muddy bacterial strain and enter next step;
(5) bacterial strain salt-tolerant trait: step is accessed in the beef-protein medium of every 100 mL NaCl as 1%, 3%, 5%, 7% and 9% containing massfraction take 3% inoculum size respectively after bacterial strain activation to be determined in (4), 30 ℃, 160 ~ 200 r/min, cultivate 10 ~ 14 h, the bacterial strain that can grow in the NaCl that is 7% in mass concentration is the oil resistant salt tolerant bacterial strain of degraded oil.
The oil resistant salt tolerant bacterial strain of degraded oil as above to petroleum pollution carry out the application in restoration of the ecosystem.
The application of the oil resistant salt tolerant bacterial strain of degraded oil as above in the bacteria leaven of preparation petroleum pollution ground restoration of the ecosystem.
The bacteria leaven that utilizes the oil resistant salt tolerant bacterial strain of degraded oil as above to prepare.
Advantage of the present invention and positively effect are as follows:
1. the oil resistant good salt tolerance of bacterial strain of the present invention, for Gram-negative bacteria, rod-short, amphitrichous, motion, without gemma, Citrate trianion, the glucose ammonium salt positive, produce catalase, gelatin-free enzyme, this bacteria growing speed is fast, can grow take oil as sole carbon source, and have can degraded oil characteristic.
2. bacterial strain of the present invention, under the suitableeest culture temperature and pH condition, is conducive to enlarged culturing, and can make bacteria leaven, renders to petroleum pollution and carries out restoration of the ecosystem.
Screening method of the present invention utilize oil domestication and dull and stereotyped gradient coating method filter out can be take oil as sole carbon source bacterial classification, the method is easy and simple to handle, quick, can significantly shorten the time of bacterial strain screening.
Accompanying drawing explanation
Fig. 1 is bacterial strain electron-microscope scanning figure of the present invention;
Fig. 2 is the PCR electrophoretogram of bacterial strain 16S rDNA identification and analysis of the present invention;
Fig. 3 is bacterial strain systematic evolution tree of the present invention;
Typical curve used when Fig. 4 is degradation rate mensuration of the present invention;
Fig. 5 is that before and after bacterial strain oil degradation of the present invention, material changes gas chromatogram; Wherein, 1 is petroleum component before degraded; 2 is petroleum component after invention strains for degrading.
Embodiment
Below in conjunction with embodiment, the present invention is further described, and following embodiment is illustrative, is not determinate, can not limit protection scope of the present invention with following embodiment.
Technological line of the present invention is: the soil sample of collection is made to solution by stroke-physiological saline solution, 30 min that vibrate on shaking table make Soil Slurry, Soil Slurry 10 mL after absorption mixes join in the aseptic mineral salt nutrient solution that 100 mL oil mass concentrations are 0.5%, put cultivation (180 r/min, 30 ℃) in shaking table.The strain domestication (getting in the different oil mass concentration mineral salt nutrient solutions that last nutrient solution 10 mL join new configuration sterilizing) that enters 4 cycles after 3 d, during domestication, the concentration of crude oil constantly raises, from each 0.5 g that increases of 0.5-2.5 g/100 mL.By being coated with separation screening after last domestication liquid gradient dilution, isolating, utilize the good bacterial strain of oil effect, measure the tolerance of bacterial strain to oil and salinity, by ultraviolet and visible spectrophotometry, measure degradation rate, obtain good degradation effect.
The present invention has carried out preliminary evaluation to the bacterial strain of screening, by Physiology and biochemistry and the test of identification of strains that some are auxiliary, show that SY-1 bacterial strain has oil resistant, salt tolerance, Gram-negative bacteria, rod-short, amphitrichous, motion, without gemma, Citrate trianion, the glucose ammonium salt positive, produce catalase, gelatin-free enzyme etc., by 16S rDNA, be accredited as colon bacillus, not yet have the report to this bacterium degraded oil at present.Acquired results is that the researchs such as the mechanism of degradation of bacterial strain are laid a good foundation.
No. SY-1, the bacterial strain of the degraded oil that the present invention filters out, fast growth, under the suitableeest culture temperature and pH condition, is conducive to enlarged culturing, makes bacteria leaven, renders to and impurely carries out restoration of the ecosystem.
The SY-1 bacterial strain of the degraded oil filtering out take the present invention carries out oil biodegradation test as starting strain, at 30 ℃, 180 r/min, under shading condition, cultivate after 7 d, extract with sherwood oil, adopt ultraviolet and visible spectrophotometer to measure its absorbance at 225 nm places, according to different concns oil typical curve, calculate remaining oil mass, by test group and control group, calculated the degradation rate of oil.
The substratum using is:
Oil mass concentration is 1% inorganic mineral salt nutrient solution: KH
2pO
40.34 g, Na
2hPO
40.15 g, (NH
4)
2sO
40. 4 g, MgSO
40.07 g, NaCl 0.16 g, yeast powder 0.001 g, Tween-80 0.06 mL, tap water 100 mL, pH 7.2～7.6, oil 1.0 g.
1. the oil resistant salt tolerant bacterial strain of a degraded oil, name is called SY-1, specific name colon bacillus Escherichia coli, deposit number is: CGMCC No.7075, preservation date: on December 31st, 2012, preservation address is: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, depositary institution: China Committee for Culture Collection of Microorganisms's common micro-organisms center.
2. the screening method of the oil resistant salt tolerant bacterial strain of degraded oil as above, step is as follows:
(1) near sampling: select good sampling spot oil field oil storage tank and producing well, first remove the soil of top layer approximately 2 cm, get the soil at 2-10 cm place, remove foreign material and packed in aseptic valve bag, and recorded sampling spot, environment and date etc.
(2) bacterial strain primary dcreening operation: take 10 g pedotheques and join 90 mL and gone out in the physiological saline of bacterium, add appropriate sterile glass beads and be placed on 30 min that vibrate on shaking table, make soil supension.Get 10 mL soil supensions and join (KH in the inorganic mineral salt nutrient solution that 100 mL oil mass concentrations are 0.5%
2pO
40.34 g, Na
2hPO
40.15 g, (NH
4)
2sO
40. 4 g, MgSO
40..07 g, NaCl 0.16 g, yeast powder 0.001 g, Tween-80 0.06 mL, tap water 100 mL, pH 7.2～7.6, oil 0.5 g), is placed in shaking table and cultivates (180 r/min, 30 ℃).After 3 d, carrying out the strain domestication in 4 cycles (gets in the aseptic mineral salt nutrient solution of different mass concentration oil that last nutrient solution 10 mL join the new configuration of 100 mL, during domestication, petroleum concentration constantly raises, and from 0.5-2.5 g/100 mL is each, increases by 0.5 g).Get last domestication bacterium liquid 1 mL and join in 9 mL stroke-physiological saline solution, mix, make 1:10 diluent, gradient dilution becomes 10 successively
-2, 10
-3, 10
-4, 10
-5, 10
-6, 10
-7bacterium liquid, gets respectively 10
-5, 10
-6, 10
-7dilution bacterium liquid 0.5 mL, join respectively solid beef-protein medium (extractum carnis 3.0 g that prepare, peptone 10.0 g, NaCl 5.0 g, tap water 1000 mL, pH7.2-7.4, agar 25 g, 121 ℃ of sterilizing 20 min), PDA substratum (takes peeling potato 200 g, is cut into small pieces, add 1 000 mL boiling tap water 30 min, filter into clear liquid with six layers of gauze.Add water to 1 000 mL, add 20 g sucrose to dissolve completely, pH nature, agar 25 g, 121 ℃ of sterilizing 20 min), No. 1 solid medium flat board of Gao Shi (Zulkovsky starch 20 g, KNO
31.0 g, K
2hPO
40.5 g, MgSO
47H
2o 0.5 g, NaCl 0.5 g, FeSO
47H
2o 0.01 g, agar 25 g, pH7.4,121 ℃ of sterilizing 20 min) upper, even with the coating of coated with glass device, three flat boards of each extent of dilution coating, flat board is positioned in 30 ℃ of incubators, cultivates 2-3 d, the bacterial strain of the different colonial morphologies of picking saves backup.
(3) bacterial strain sieves again: in picking (2), separate the bacterial classification of preserving, streak inoculation is to containing (KH on the inorganic mineral salt culture medium solid plate that mass concentration 0.5% oil is sole carbon source respectively
2pO
43.4 g, Na
2hPO
41.5 g, (NH
4)
2sO
44.0 g, MgSO
40.7 g, NaCl 1.6 g, yeast powder 0.01 g, Tween-80 0.6 mL, tap water 1000 mL, pH 7.2～7.6, oil 5.0 g, agar 25 is g) upper, is positioned over respectively in 30 ℃ of incubators, cultivate 2-3 d, the picking bacterial strain (form and obviously bite oil mark in periphery of bacterial colonies, and bite the larger explanation bacterial strain of oil mark and utilize the ability of oil stronger) of growing faster, therefrom filters out the bacterial classification that can grow take oil as sole carbon source, through repeatedly ruling and be separated into single bacterium colony, preservation.
(4) bacterial strain oil resistant characteristic: pack 100 mL inorganic mineral salt nutrient solution (KH in 250mL triangular flask into
2pO
40.34 g, Na
2hPO
40.15 g, (NH
4)
2sO
40. 4 g, MgSO
40.07 g, NaCl 0.16 g, yeast powder 0.001 g, Tween-80 0.06 mL, tap water 100 mL, pH 7.2～7.6, oil addition is respectively 0.5 g, 1 g, 2 g, 4 g, 6 g, 8 g, 10 g, 12 g) access each culturing bottle by seed liquor after bacterial strain activation to be determined by 3% inoculum size after 121 ℃ of sterilizing 20 min, on shaking table (30 ℃, 180 r/min) cultivate and observe each test bottle changing conditions after 7 d (it is muddy that the nutrient solution color that strain growth is good can change and become, otherwise oil will swim in upper strata, nutrient solution is relatively clarified).
(5) bacterial strain salt-tolerant trait: (extractum carnis, 0.3 g press 1% respectively to pack 100 mL beef extract-peptone nutrient solutions in 250 mL triangular flasks into, 3%, 5%, 7%, 9% massfraction adds NaCl, peptone, 1.0 g, tap water, 100 mL, pH is 7.0-7.2), to after bacterial strain activation to be determined, with 3% inoculum size, access in the different beef-protein medium of NaCl massfraction, 30 ℃, 180 r/min, cultivate 12 h, measure OD
600value, the results are shown in Table 1.
Table 1 SY-1 bacterial strain growing state under different salinity
As can be seen from Table 1, bacterial strain SY-1 is well-grown when NaCl concentration is 1%-3%, and when NaCl concentration is 5%, generally, in the time of 9%, growth is suppressed in growth.
3. the characteristic of bacterium
(1) strain morphology is observed
1. colonial morphology is observed: the SY-1 test tube slant bacterial classification that picking preservation is good is seeded in (extractum carnis 3.0 g on bacterium solid culture medium flat board, peptone 10.0 g, NaCl 5.0 g, tap water 1000 mL, pH7.2-7.4, agar 25 g, 121 ℃ of sterilizing 20 min), in constant incubator, (30 ℃) are observed after cultivating 15 h, result is that bacterium colony is rounded, canescence, moistening, glossy.
2. bacterial strain electron-microscope scanning is observed: get bacteria suspension that 0.5 mL activates 10 h in 1.5 mL centrifuge tubes, add respectively again glutaraldehyde solution (25% glutaraldehyde 10 mL of 0.5 mL 2.5%, distilled water 40 mL, 0.2 mol/L phosphoric acid buffer 50 mL, pH7.3-7.4) standing 5 min, centrifugal 10 min under 12000 r/min, precipitation (is got the NaH of 19 mL 0.2 mol/L with the PBS damping fluid of 0.2 mol/L pH7.4
2pO
4solution and 81 mL Na
2hPO
40.2 mol/L solution mixes) clean, centrifugal 10 min under 12000 r/min, abandoning supernatant, precipitation uses 30%, 50% successively, 70%, the spirituous solution gradient of 90% concentration centrifugal 10 min that dewater, finally dewater centrifugal 2 times with ethanol solution, and the thalline after fixing dehydration is uniformly coated on cover glass, after allowing it naturally dry, carry out vacuum metal film plating, carry out electron microscopic observation.Strain morphology is shown in Fig. 1.
(2) impact of different initial pH on SY-1 strain growth
In 250 mL triangular flasks, pack 100 mL beef extract-peptone nutrient solution (extractum carnis, 0.3 g, NaCl into, 0.5 g, peptone, 1.0 g, tap water 100 mL, pH is 7.0-7.2), bacterium liquid after SY-1 activation is respectively to 4 by 3% inoculum size access pH, 5,6,7, in 8,9,10 nutrient solution, 30 ℃, 180 r/min cultivate 12 h, measure OD
600value, it the results are shown in Table 2.
Table 2 SY-1 bacterial strain is growing state under the initial pH of difference
As can be seen from Table 2, bacterial strain SY-1 grows the fastest when pH=7, under the acid of certain limit, alkaline condition, also can grow preferably, and subject range is wider.
(3) SY-1 bacterial strain physio-biochemical characteristics
1. gramstaining
Smear: on slide glass, add a small drops of water, with transfering loop with a little lawn of aseptic technique picking in water droplet, natural drying at room temperature.Flame is fixed.
Just dye: ammonium oxalate crystal violet staining fluid 1 min, washing, with the thin current of tap water by slide glass upper end run down into colourless till.
Mordant dyeing: road Ge Shi iodine staining 1 min, the dye liquor that inclines washing.
Dehydration: drip 95% ethanol, slide is rocked to the ethanol that inclines under several a little, repeats 2-3 time, washing immediately, termination is decoloured.
Redye: drip husky yellow staining fluid, dyeing 2-3 min, washing, finally blots gently with thieving paper.
Microscopy: use oily sem observation, distinguish G
+bacterium and
?g
-bacterium and thalli morphology.
2. spore staining
Bacterium solution preparation: add 1-2 and drip tap water in small test tube, encircle lawn with transfering loop picking 2-3 from inclined-plane and also fully beat in test tube, preparation bacterium liquid.
Add staining fluid: add 5% Victoria Green WPB staining fluid 2-3 and drip in small test tube, with transfering loop, stir staining fluid and bacterium liquid are fully mixed.
Heating: this test tube is dipped in boiling water bath (beaker) to heating 15-20 min.
Smear: choose ring of numbers bacterium liquid in clean slide from test tube bottom with transfering loop, and paint film.
Fixing: slide is passed through to low baking temperature 3 times.
Decolouring: wash with water, until flow out water in without Victoria Green WPB color.
Redye: the yellow staining fluid in gaza, dye after 2-3 min, the dye liquor that inclines, does not wash with water, directly with thieving paper, blots.
Microscopy: use oily sem observation.
3. utilization of carbon source
Respectively 0.2% tested substrate (glucose, sucrose, maltose, lactose, N.F,USP MANNITOL) is joined to ((NH in carbon source basic medium
4)
2sO
42.0 g, MgSO
47H
2o 0.2 g, NaH
2pO
4h
2o 0.50g, CaCl
22H
2o 0.1 g, K
2hPO
40.5 g, tap water 1 000 mL, 7.2,121 ℃ of sterilizing 20 min of pH).With seed liquor inoculation after activation, inoculum size is 3%, shifts continuously raw elder of 3 generations positive, and experimental result is in Table 4.
4. mobility viewing test
By test strain percutaneous puncture-inoculation in semisolid medium (extractum carnis 3.0 g, peptone 10.0 g, NaCl 5.0 g, tap water 1000 mL, pH7.2-7.4, agar 10.0 g, 121 ℃ of sterilizing 20 min), after 30 ℃ of cultivation 2 d, take out, by transmitted light, estimate the growing state of bacterium on puncture line, and record result.
5. Starch Hydrolysis test
By Starch Hydrolysis substratum (extractum carnis 5.0 g, peptone 10.0 g, NaCl 5.0 g, Zulkovsky starch 2.0 g, tap water 1000 mL, pH7.2-7.4, agar 25.0 g, 121 ℃ of sterilizing 20 min) dissolve after, be cooled to 50 ℃ of left and right, be down flat plate, after solidifying, picking bacterial classification point is on seed flat board, every ware can be put 3～5 bacterial strains, thermophilic is cultivated 2～4 d, forms after bacterium colony, drips road Ge Shi iodine liquid on flat board, to be paved with periphery of bacterial colonies, be advisable, it is black-and-blue that flat board is, and periphery of bacterial colonies is irised out now if any water white transparency, illustrates that starch is hydrolyzed.The size of the big or small general proxy hydrolyzed starch ability of transparent circle.
6. gelatine liquefication
Get bacterial strain pure growth a little, with inoculating needle respectively percutaneous puncture-inoculation in nutrient gelatin substratum, put 32 ℃ and cultivate 24h.During observations, gelatine culture should be put into gently to 4 ℃ of refrigerator 30 min, now gelatin solidifies again.If be positioned over refrigerator 30 min, still do not solidify person, illustrate that gelatin is tested bacterium and liquefied, positive.
7. catalatic mensuration
Get a clean slide glass, drip 3%～5% hydrogen peroxide on slide glass, under aseptic technique, picking one ring is cultivated the lawn of 18～24 h, adds in superoxol, if there is bubble (O
2) occur, be hydrogen peroxide enzyme positive, otherwise, without bubble person, be catalase feminine gender.
8. Citrate trianion utilization test
The a small amount of tested bacterium streak inoculation of picking to citrate medium test tube slant (Trisodium Citrate 2 .0 g,
?naCl 5.0 g, MgSO
47H
2o 0.2 g, K
2hPO
43H
2o 1.0 g, (NH
4)
2hPO
41.0 g, the 1% thymolsulfonphthalein aqueous solution 10 mL, agar 25 g, distilled water 1 000 mL, pH 7.0, adds indicator, 121 ℃ of sterilizing 20 min after adjusting pH again), cultivate after 24 h observations for 32 ℃.It is positive that substratum deepens blue person.
9. Gluconic Acid Ammonium salt salt test
The tested bacterium that takes a morsel is inoculated into (glucose 2.0 g, (NH on Gluconic Acid Ammonium salt salt culture medium
4)
2sO
42.0 g, Trisodium Citrate 0.5 g, K
2hPO
47.0 g, KH
2pO
42.0 g, MgSO
47H
2o 0.1 g, distilled water 1000 mL, pH7.2,115 ℃ of sterilizing 15 min), cultivate after 24 h for 32 ℃, observations, it is positive that substratum deepens blue person.
The detected result of SY-1 bacterial strain physio-biochemical characteristics is in Table 3 and table 4.
Table 3 SY-1 bacterial strain physiological and biochemical property
The experiment of table 4 SY-1 bacterial strain utilization of carbon source
4. bacterial strain 16S rDNA identification and analysis
(1) DNA of bacteria is extracted and pcr analysis
Adopt SDS method to extract bacteria total DNA, utilize bacterial 16 S rDNA amplification universal primer 27F (AGAGTTTGATCCTGGCTCAG) and 1492R(GGTTACCTTGTTACGACTT) carry out pcr amplification.In 25 μ L reaction systems, contain: 10 × PCR damping fluid, 2.5 μ L, 50 mmolL
-1mgCl
20.8 μ L, 10 mmolL
-1dNTP 0.5 μ L, the each 0.5 μ L of primer, 5 U μ L
-1taq archaeal dna polymerase 0.2 μ L, template DNA 1 μ L, adds aseptic double-distilled water and mends to 25 μ L.PCR reaction conditions is: 94 ℃ of sex change 5 min, and 55 ℃ of annealing 30 s, 72 ℃ are extended 1 min, 30 rear 72 ℃ of insulation 10 min of circulation, 4 ℃ save backup.Amplified production detects by 1.5% agarose gel electrophoresis, on gel imaging instrument, observe and record result, obtain band and after fragment, cut glue clearly, reclaim test kit PCR product is reclaimed to purifying with Axygen gel, PCR electrophoretogram is shown in Fig. 2.
(2) product order-checking and compare of analysis and phylogenetic tree build
The sequence that 16S rDNA after amplification records is submitted to GenBank and carries out sequence homology analysis in International Biotechnology Information Network center (NCBI) database (http://www.ncbi.nlm.nih.gov/), the 16S rDNA sequence obtaining from GenBank database is carried out multisequencing comparison, in Mega5.0 software, NJ method (adjacent method) builds 16S rDNA phylogenetic tree, bootstrap check, repeat 1000 times, determine the classification position of bacterial strain, bacterial strain systematic evolution tree is shown in Fig. 3.
5. the mensuration of biological degradability
(1) inorganic salt minerals nutritive medium: KH
2pO
43.4 g, Na
2hPO
41.5 g, (NH
4)
2sO
44.0 g, MgSO
40.7 g, NaCl 1.6 g, yeast powder 0.01 g, Tween-80 0.6 mL, tap water 1000 mL, pH 7.2～7.6.
(2) preparation of Erlenmeyer flask
Control bottle: 100 mL inorganic salt minerals nutritive medium+1.0 g oil (3 parallel)
Test bottle: 100 mL kind daughter bacteria liquid+1.0, mL inorganic salt minerals nutritive medium+3 g oil (each test bacterium get 3 parallel)
(3) cultivate
By carrying out the biodegradation test of oil after bacterial strain activation to be measured, from seed culture medium, draw respectively 3 mL seed liquor, be linked in step (2) and need to add in the Erlenmeyer flask of bacterium liquid, 30 ℃, in 180 r/min shaking tables, cultivate 7 d.
(4) breakdown of emulsion and breaking cell wall
After incubation period finishes, add 1 mL 1 mol/L HCl and 20 g NaCl in each Erlenmeyer flask, vibration, after NaCl dissolves completely, adopts ultrasonic cell disruption instrument by the microorganism wall fragmentation in substratum, content is discharged and further breakdown of emulsion.Intermittent type ultrasonic disruption condition: 200 W, 2 min, work 2 s, stop 1 s, carry out separating and extracting after fragmentation after solution temperature in triangular flask is cooled to room temperature again.
(5) extraction
Each sample is poured in 250 mL separating funnels, divided and add for three times sherwood oil (60-90 boiling range) to extract, each add-on is 30 mL, acutely shakes 1～2 min, and often opens piston exhaust; Standing to layering, solution in separating funnel is emitted from end opening, upper organic phase solution is poured in the small beaker that anhydrous sodium sulphate (slightly changing 15 g-20 g anhydrous sodium sulphate according to the remaining water yield) is housed and dewatered, three organic phases are mixed to standing 24 h, organic phase after standing is carried out to 100 times of dilutions, measure its absorbance at 225 nm places.
(6) irreducible oil component analysis and biological degradation rate calculate
The drafting of crude oil typical curve: get 0.01g oil and be dissolved in sherwood oil (60-90 boiling range) and be made into 100 mL solution, be the former oil solution of 100 ㎎/L, pipette respectively 0,1,2,4,6,8,10 mL in 10 mL volumetric flasks, with first determining that with ultraviolet and visible full wavelength scanner its charateristic avsorption band is 225 nm and 257 nm after sherwood oil (60-90 boiling range) constant volume, maximum absorption band is 225 nm, fixed wave length is 225 nm, measure the absorbance of different crude oils concentration solution, drawing standard curve, is shown in Fig. 4.
The calculating of biological degradation rate: the former oil concentration I that the absorbance of sample cultivation bottle sample liquid at 225nm place is corresponding
cultivate; The former oil concentration I that sample control bottle sample liquid absorption value is corresponding
contrast, degradation rate calculation formula is:
Wherein, I
contrastfor petroleum concentration corresponding to the absorbance of sample bottle, I
cultivatefor petroleum concentration corresponding to the absorbance of control bottle.
The results are shown in Table 5.
Table 5 strains for degrading rate is calculated
Microorganism is a very complicated process to the degraded of petroleum hydrocarbon, and degradation process is slow.During 7d, in nutrient solution, viable count has started to reduce, and degradation rate increases not obvious.Ultraviolet and visible spectrophotometry have the oil of fixing charateristic avsorption band and different concns in the absorbance difference at charateristic avsorption band place according to oil.The advantages such as after degrading by mensuration, in nutrient solution, remaining oil characterizes remaining oil mass at charateristic avsorption band absorbance, then relatively calculates degradation rate with control group, and it is relatively simple that the method has operation, and precision is good, sensitivity height.
6. product analysis before and after degraded
Oil composition mutation analysis adopts GC-MS analytical procedure to carry out.
(1) used medium, in Erlenmeyer flask, each material addition and cultural method are shown in (1) (2) (3) in biological degradability mensuration.
(2) sample pretreatment
Get the nutrient solution of cultivating after finishing, centrifugal 10 min of 10000 r/min, precipitation is removed cell, gets centrifuged supernatant, do extraction agent coextraction 3 times with normal hexane, each consumption 30 mL, play 2 min that shake, stratification, collect extraction liquid upper organic phase, put into triangular flask, add anhydrous Na SO
4approximately 10 g, carry out GC/MS analysis.
(3) GC-MS analyzes
GC-MS condition: sample size: 1 μ L; Injector temperature: 320 ℃; Splitting ratio: 20; Carrier gas He, 99.999% temperature programming: 80 ℃ of initial temperatures, are raised to 320 ℃ with 8 ℃/min; Retention time: 10 min; Column flow rate: 1 mL/min; Pillar: VF-5 ms (30 mm × 0.15, m × 0.25 μ m), 4 000 MS; Scanning of the mass spectrum scope: 50～500 m/z; Ion source: EI; Mass analyzer: ion trap; Ionizing energy 70ev transmission line temperature: 280 ℃; Ion trap temperature: 220 ℃, 3Min retrieval time of lag spectrum storehouse: NIST05.
(4) material composition is determined
GC-MS analyzes and detects altogether 25 kinds of materials, uses C
10-C
20normal paraffin mixed sample determines that the component of the front oil of degraded is mainly C
14-C
3219 kinds of normal paraffins, all the other are aromatic hydrocarbon.C in oil
14-C
20relative content is 5.12%, C
21-C
32content is higher, reaches 95.88%, there is no C in oil
14following component may be because weathering of these components or be biodegradable.Before and after degraded, accompanying drawing 5 is shown in by contrast collection of illustrative plates.
What in the remaining sample after SY-1 degradation bacteria degraded, detect only has C
17and C
18two kinds of normal paraffins, reason may be bacterial strain by long chain alkane be degraded to short chain alkane and at the process C of test
17following short chain alkanes is cultivated at shaking table again, and the form with gas in the processes such as sample extraction processing is scattered and disappeared, thereby only has C when detecting
17and C
18and there is no other short chain alkanes.
To sum up, can find out, the bacterial strain of the oil resistant salt tolerant of degraded oil of the present invention can be made bacteria leaven, renders to petroleum pollution and carries out restoration of the ecosystem.
Claims (4)
1. the oil resistant salt tolerant bacterial strain of a degraded oil, it is characterized in that: it is colon bacillus (Escherichiacoli) SY-1, deposit number is: CGMCCNo.7075, preservation date: on December 31st, 2012, preservation address is: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, depositary institution: China Committee for Culture Collection of Microorganisms's common micro-organisms center.
The oil resistant salt tolerant bacterial strain of degraded oil as claimed in claim 1 to petroleum pollution carry out the application in restoration of the ecosystem.
3. the application of the oil resistant salt tolerant bacterial strain of degraded oil as claimed in claim 1 in the bacteria leaven of preparation petroleum pollution ground restoration of the ecosystem.
4. a bacteria leaven that utilizes the oil resistant salt tolerant bacterial strain of degraded oil as claimed in claim 1 to prepare.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310095318.8A CN103205378B (en) | 2013-03-25 | 2013-03-25 | Oil-degradation oil-and-salt tolerance bacterial strain, and screening method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310095318.8A CN103205378B (en) | 2013-03-25 | 2013-03-25 | Oil-degradation oil-and-salt tolerance bacterial strain, and screening method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103205378A CN103205378A (en) | 2013-07-17 |
| CN103205378B true CN103205378B (en) | 2014-04-23 |
Family
ID=48752787
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310095318.8A Active CN103205378B (en) | 2013-03-25 | 2013-03-25 | Oil-degradation oil-and-salt tolerance bacterial strain, and screening method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103205378B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109055256A (en) * | 2018-07-16 | 2018-12-21 | 广州舒国生物科技有限公司 | One plant of Escherichia coli and its application in preparation microbial detergent |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104120101B (en) * | 2014-07-17 | 2017-03-08 | 杭州临安冰峰科技有限公司 | A kind of E. coli mutant strain and the method producing chiral aspartic acid using this bacterium |
| CN104388312B (en) * | 2014-12-10 | 2020-07-07 | 青岛农业大学 | Method for screening petroleum degrading bacteria, method for preparing petroleum degrading bacteria microbial inoculum from screened bacteria and application of microbial inoculum |
| CN104450597B (en) * | 2014-12-10 | 2020-07-28 | 青岛农业大学 | Preparation method of petroleum degrading bacteria solid microbial inoculum and method for repairing petroleum-polluted soil by using solid microbial inoculum prepared by preparation method |
| CN104877930A (en) * | 2015-04-24 | 2015-09-02 | 南开大学 | Separating and screening method for saline-alkaline-resistant bacteria degrading petroleum hydrocarbon |
| CN105316268B (en) * | 2015-12-08 | 2018-11-13 | 山东宝源生物科技股份有限公司 | One plant of bacillus pumilus for producing gibberellin and its application in degraded oil |
| CN110643339B (en) * | 2019-10-22 | 2022-01-28 | 中国石油化工股份有限公司 | Biological enzyme composite preparation for oil extraction and preparation method and application thereof |
| CN114989998B (en) * | 2021-04-30 | 2023-03-24 | 山东省科学院生态研究所(山东省科学院中日友好生物技术研究中心) | Halophilic petroleum hydrocarbon degrading bacterium and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102174452A (en) * | 2011-03-18 | 2011-09-07 | 大连理工大学 | Screening transformation method for crude oil degradation marine microorganism |
| CN102703348B (en) * | 2012-05-25 | 2013-08-21 | 武汉科技大学 | Alkane degrading bacteria and application thereof |
| CN102925390A (en) * | 2012-11-05 | 2013-02-13 | 上海交通大学 | Pseudomonas fluorescens capable of decomposing petroleum substances and preparation method and application thereof |
-
2013
- 2013-03-25 CN CN201310095318.8A patent/CN103205378B/en active Active
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109055256A (en) * | 2018-07-16 | 2018-12-21 | 广州舒国生物科技有限公司 | One plant of Escherichia coli and its application in preparation microbial detergent |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103205378A (en) | 2013-07-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103205378B (en) | Oil-degradation oil-and-salt tolerance bacterial strain, and screening method and application thereof | |
| CN105132323B (en) | One plant of salt tolerant bacillus and its application in high-salt wastewater processing | |
| CN104745511B (en) | Composite bacteria agent for repairing heavy oil pollution coastline and preparation method and application | |
| CN103436464A (en) | Low temperature-resistant petroleum-degrading bacillus sp. strain, culture method and application thereof | |
| CN102994428B (en) | One strain ocean surfactant producing bacteria strain LHOD-1 and application thereof | |
| CN102676424B (en) | Obligate halophile for processing high-salt oily waste liquor in petroleum industry | |
| CN102864102B (en) | Phthalate degrading strain and application thereof | |
| CN104745506A (en) | Petroleum hydrocarbon degrading bacteria and application thereof | |
| Nrior et al. | Comparative bioremediation potential of Mucor racemosus and Paecilomyces variotii on crude oil spill site in Gio Tai, Ogoni land | |
| CN110669700A (en) | Efficient petroleum hydrocarbon degrading bacterium PA16_9 and screening method and application thereof | |
| CN108676763B (en) | High-antimony-resistance proteus cassiicola DSHN0704 and separation and screening method and application thereof | |
| CN106082447A (en) | A kind of new method utilizing Thermophilic Bacteria complex biological strengthening microbial inoculum to process high temperature oil extraction-generated waste water | |
| CN101935631A (en) | Ralstoniasp. and application thereof in bioremediation of petroleum-contaminated saline-alkali soil | |
| CN101654661B (en) | Bioremediation method for petroleum contamination and its special strains | |
| CN101654662B (en) | Method for decomposing petroleum hydrocarbon and special bacterial strain thereof | |
| CN105624064A (en) | Microbial strain for water quality purification and fungicide | |
| CN104694439B (en) | A kind of degrading crude oil bacterium and its application | |
| CN107841477A (en) | Application of one plant of arsenic oxidizing bacteria in rice trivalent arsenic pollution is reduced | |
| CN107974415A (en) | Application of one plant of arsenic oxidizing bacteria in terms of rice field trivalent arsenic pollution is repaired | |
| CN102766580B (en) | Yeast strain for producing biosurfactant and application thereof | |
| CN103695332B (en) | A kind of contaminated by diesel oil type place microbiological deterioration bacterium | |
| CN107629976A (en) | A kind of microorganism and its microbial inoculum and application | |
| CN105132332A (en) | Acetobacter gluconicum and application of acetobacter gluconicum as plant growth-promoting rhizobacteria | |
| CN102206605B (en) | Exiguobacterium sp. with alga-lysing activity and application thereof in cyanobacterial bloom control | |
| CN108102943A (en) | A kind of efficient denitrification microorganism and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200709 Address after: 315, 3rd floor, building 35, Erlizhuang, Haidian District, Beijing 100083 Patentee after: AEROSPACE SHENGNUO (BEIJING) (BEIJING) ENVIRONMENTAL PROTECTION TECHNOLOGY Co.,Ltd. Address before: 300457 No. thirteen, No. 29, economic and Technological Development Zone, Binhai New Area, Tianjin Patentee before: Tianjin University of Science and Technology |