CN103194480A - High-efficiency expression method of human interleukin-10 (hIL-10) - Google Patents

Abstract

The invention relates to a high-efficiency expression method of hIL-10, and concretely provides a method for expressing a foreign protein in yeast. The method comprises the following steps: 1, constructing an expression vector, wherein the expression vector includes an rDNA non-coding region, an antibiotic resistance gene, and a coding sequence secreting a signal peptide and the foreign protein; 2, gradually increasing the concentration of an antibiotic to amplify the copy number of the expression vector and construct a clone database containing different copy numbers; and 3, selecting expression cloning, expressing, and recovering the foreign protein, wherein the foreign protein is hIL-10 preferably. The invention also relates to the expression vector used for the method, and uses of the expression vector and yeast strains, wherein the expression vector includes yeast strains of the expression vector. High-efficiency strains of hIL-10, having industrialized values, can be easily obtained through the method, so hIL-10 is expressed and recovered.

Description

The high-efficiency expression method of human interleukin-10

Technical field

The invention belongs to technical field of bioengineering.Particularly, the present invention relates to a kind ofly prepare the method for human interleukin-10 (hIL-10) by biotechnology, particularly a kind of pichia spp efficiently expresses the construction of carrier of hIL-10 and efficiently expresses screening and the foundation of hIL-10 bacterial strain.

Background technology

The immune inflammation that hIL-10 energy suppressor T cell mediates reacts and participates in the humoral immunization adjusting by stimulating bone-marrow-derived lymphocyte to react, and has good potential applicability in clinical practice.At present be applied to comprise the clinical and experimental study of panimmunity diseases such as type i diabetes, psoriatic, rheumatoid arthritis, multiple sclerosis, hepatitis C.Natural hIL-10 is 18.5KD by the molecular weight that scavenger cell produces mainly, and sugar based is modified, and activity form is the few dimer of homology that is formed by non covalent bond two monomers of connection.

Extensive and deep research has been carried out in the application of hIL-10 mechanism of action and clinical treating disease both at home and abroad, confirmed the hIL-10 biological function on the one hand, also expanded its clinical application range on the other hand; Therefore, market will more be come bigger to the needs of hIL-10.At present reported that the recombinant expression system of hIL-10 mainly contains Ecoli both at home and abroad, CHO-K1 also has some researchists to use plant leaf to express; Use the related work of yeast expression hIL-10 also seldom, key is the few dimer of homology that is difficult to obtain in a large number having natural radioactivity.Reorganization hIL-10 is very expensive on the world market, and does not domesticly still have enterprise and produce.Commercialization reorganization hIL-10 mainly is the intestinal bacteria sources in the world, has 161 amino acid, Duo an amino acid than normal hIL-10, has potential harm treating.And intestinal bacteria are the albumen compositions of abiology activity mainly with the formal representation hIL-10 of inclusion body, and become the renaturation process complexity, and the rate of recovery is low, has had a strong impact on research and the application of hIL-10.

Before the present invention, the yeast expression vector commonly used that some researchists buy with invitrogen company, as pPIC9K (Liu Lizang, Ma Huiwen etc. the expression of human interleukin 10 (hIL10) in pichia spp. Wuhan University's journal, 2004,50 (2) and the honor of well Shen, Zou Quanming etc. expression and the Determination of biological activity of recombination human interleukins-11 0 in pichia spp. Chinese microbiology and Journal of Immunology, 2005,25 (9)), pPICZ α A (Chen Fuchao, Sun Wanbang etc. reorganization hIL-10 identifies in expression and the biological activity thereof of pichia spp X-33. Chinese Journal of Immunology, 2011,27 (8)) etc., transform Pichiapastoris expression strain (as GS115, X-33 etc.), the conventional screening method of the Pichiapastoris expression strain of recommending with reference to invitrogen company.Since these routines yeast expression vector to obtain the probability of high copy bacterial strain very low, and with (the well Shen honor of pAO815 carrier, Zou Quanming etc. the structure of interleukin 10 gene multiple copy expression cassette and the expression in pichia spp. the Chinese biological goods are learned magazine, 2007,20 (2)) though method also can obtain high copy bacterial strain, but this method extremely wastes time and energy, and result badly is realized with being not easy.Simultaneously, conventional screening efficient expression strain is to carry out under 28-30 ℃ in temperature, and having ignored yeast secretary mechanism may cause heterogenous expression albumen to store up in cell and stay and cause the influence of yeast cell viability the disadvantageous effect of expression of recombinant proteins.Therefore, utilize conventional screening method to fail to obtain the efficient expression strain of hIL-10.

Summary of the invention

1. technical scheme of the present invention

One aspect of the present invention provides a kind of yeast that is applicable to efficiently express the method for external source recombinant protein, and the construction process that is used for the expression vector of this method.

The present invention provides the yeast expression method of a kind of hIL-10 on the other hand, and the construction of carrier that is used for described method.

Particularly, one aspect of the present invention is provided for expressing the method for foreign protein in yeast, and it comprises the steps:

1) construction of expression vector, described expression vector comprises the rDNA non-coding region, antibiotics resistance gene, the encoding sequence of secreting signal peptide and foreign protein;

2) progressively increase antibiotic concentration, thus the copy number of the described expression vector that increases, and structure contains the clone's of different copy numbers storehouse;

3) foreign protein is expressed and reclaimed to option table Dyclonine.

In one embodiment of the invention, expressed foreign protein human interleukin-10 preferably.

In this one side of the present invention, utilize the multiple copied characteristic of rDNA in the pichia spp genome, design is integration site with the non-coding region of rDNA, can change a plurality of expression vectors in same clone simultaneously over to, thereby is conducive to obtain efficiently expressing of foreign gene; Simultaneously, the contriver finds, by progressively increasing antibiotic concentration, the increase copy number of described expression vector makes up the clone's who contains different copy numbers storehouse, on this basis the option table Dyclonine then, can easily obtain high copy bacterial strain, and then express and reclaim foreign protein.

Preferably, the contriver finds to select to be dispersed in the rDNA non-coding region on 4 karyomit(e)s of yeast, can change a plurality of expression vectors simultaneously in same clone, is conducive to obtain efficiently expressing of foreign gene.

More preferably, the contriver finds to use sequence to be conducive to efficiently a plurality of expression vectors of foreign gene are transferred among the clone simultaneously as the rDNA non-coding region of SEQ ID No:1, and transform the height copy clone good stability that obtains, can easily obtain the bacterial strain that efficiently expresses.

In one embodiment of the invention, described method further comprises methanol induction foreign protein secreting, expressing under the low temperature.

In one embodiment of the invention, described method also comprises the amount of foreign protein in the comparison yeast born of the same parents and the relative proportion relation of the amount that is secreted into the foreign protein in the supernatant, thereby foreign protein is expressed and reclaimed to the option table Dyclonine.

The contriver finds to compare the hIL-10 that is detained in the yeast born of the same parents and the relative proportion relation that is secreted into the amount of hIL-10 in the supernatant down by low temperature (20 ℃), the hIL-10 albumen of having avoided a large amount of false foldings very effectively is detained in the yeast born of the same parents and causes endoplasmic reticulum pressure, guaranteed that the hIL-10 expression strain is in best vigor state under the methanol induction, prevented that real hIL-10 from efficiently expressing the unelected of clone simultaneously effectively.

The contriver finds that methanol induction hIL-10 secreting, expressing under the low temperature can significantly improve the expression ratio of hIL-10 in the supernatant.In one embodiment of the invention, the ratio of last white protein/intracellular protein that methanol induction hIL-10 secreting, expressing obtains under the low temperature is 1.3 times.In one embodiment of the invention, the ratio of last white protein/intracellular protein that methanol induction hIL-10 secreting, expressing obtains under the low temperature is at least 2 times, is preferably at least 3 times, 4 times, and 5 times, 6 times, 7 times, 8 times, 9 times, 10 times etc.In a preferred embodiment of the invention, the ratio of last white protein/intracellular protein that methanol induction hIL-10 secreting, expressing obtains under the low temperature is at least 6 times.

In one embodiment of the invention, the encoding sequence of used foreign protein is without codon optimized sequence.

In another embodiment of the invention, the encoding sequence of used foreign protein is through codon optimized sequence.Encoding sequence is optimized the method that is beneficial to express in host cell be well known to those skilled in the art.

Can use various suitable secreting signal peptide well known to those skilled in the art in the method for the invention, it includes but not limited to α-factor, α-Dian Fenmei, glucoamylase, serum albumin secreting signal peptide.In an embodiment preferred of the present invention, described secreting signal peptide is α-factor secreting signal peptide.

The present invention also relates in one aspect to the expression vector that makes up in method of the present invention.

Further aspect of the present invention relates to the yeast strain that comprises expression vector of the present invention.

Another aspect of the invention relates to the purposes that expression vector of the present invention and yeast strain of the present invention are used for the expressing human interleukin 10.

Technical scheme of the present invention exemplarily is described as follows.

2. the exemplary illustration of technical scheme of the present invention

2.1) be framework with pPICZc α A carrier, be integrated into the rDNA-non-coding region fragment in the pichia spp genome again, construct the pUCZ9K carrier.

2.2) respectively the N of α-mating factor-pre-pro sequence and hIL-10 encoding sequence end is merged, introduce His-tag at the C of hIL-10 end simultaneously, and will merge in the good albumen coded sequence insertion pUCZ9K carrier, having made up at last with α-mating factor-pre-pro sequence is the hIL-10-His efficient expression vector of secreting signal peptide.RDNA-non-coding region fragment in the recycling pUCZ9K carrier is integration site, and by progressively increasing the concentration (0.1mg/ml of Zeocin, 0.5mg/ml, 1.0mg/ml, 2.0mg/ml, 3.0mg/ml, 5.0mg/m1) carry out the amplification of expression vector copy number, final monoclonal storehouse of realizing obtaining to contain rapidly different copy numbers.Identify the copy number of the difference clone in the mono-clonal storehouse with the method for Realtime PCR.Use the methanol induction hIL-10 under the low temperature (20 ℃) to express again, and be judgement criteria with the relative quantity of expressing the hIL-10 albumen in the cleer and peaceful thalline born of the same parents, from the clone's of different copy numbers storehouse, filter out the hIL-10 efficient expression strain with industrialization value.

Wherein, barms can adopt conventional Pichi strains such as X-33.The IL-10 gene coded sequence can adopt without the sequence after codon optimized or codon optimized.The secreting signal peptide of IL-10 can adopt α-mating factor the most commonly used, also can select normal signal peptides such as α-Dian Fenmei, glucoamylase, serum albumin.

3. technique effect of the present invention

Adopt the non-coding region of rDNA for inserting the site; With the concentration that progressively increases Zeocin (0.1mg/ml, 0.5mg/ml, 1.0mg/ml, 2.0mg/ml, 3.0mg/ml, 5.0mg/ml) the increase copy number of hIL-10 expression vector in the positive colony; Utilize that methanol induction hIL-10 secreting, expressing carries out the screening of efficient expression strain under the low temperature (20 ℃), these are the distinctive distinguishing characteristicss of the present invention.Compared with the prior art, advantage of the present invention is to utilize the multiple copied characteristic of rDNA in the pichia spp genome, the non-coding region that has designed with rDNA is integration site, increased the probability that changes a plurality of expression vectors among the same clone simultaneously over to greatly, the rDNA non-coding region of this repetition simultaneously is dispersed on 4 karyomit(e)s of pichia spp, and the height copy clone that conversion is obtained has the characteristic of good stability.Simultaneously, these positive colonies with further the increase method of copy number of the pressurization of Zeocin, have been obtained a storehouse of containing the clone of different copy numbers very easily.In addition, adopt the mode of methanol induction hIL-10 protein expression under the low temperature, relatively the hIL-10 that is detained in the yeast born of the same parents concerns with the relative proportion that is secreted into the amount of hIL-10 in the supernatant, the hIL-10 albumen of having avoided a large amount of false foldings very effectively is detained in the yeast born of the same parents and causes endoplasmic reticulum pressure, guaranteed that the hIL-10 expression strain is in best vigor state under the methanol induction, prevented effectively simultaneously that real hIL-10 from efficiently expressing the unelected of clone, making the clone who screens is the real clone with efficient secretory expression hIL-10 potential, for next step fermentation optimization provides good basis.

Description of drawings

The structure schema of Fig. 1 plasmid pUCZ;

The PCR product electrophoresis result figure of Fig. 2 rDNA non-coding region fragment;

The overlapping extension PCR product electrophoresis result figure of Figure 35 ' AOX-MCS-3 ' AOX and rDNA non-coding region fragment;

The structure schema of Fig. 4 pichia spp efficient expression vector pUCZ9K;

The plasmid map of Fig. 5 pichia spp efficient expression vector pUCZ9K;

The structure schema of Fig. 6 hIL-10/pUCZ9K;

The method of Fig. 7 Zeocin pressurization amplification expression vector;

Electrophoresis result figure after the extracting of Fig. 8 yeast genes group;

Western Blot result under Fig. 9 reductive condition behind the polyacrylamide gel electrophoresis, 3 positive transformed clones abduction delivering simultaneously under 20 degree and 30 degree, and detect in the pichia spp born of the same parents simultaneously and secrete hL-10 in the supernatant.

Embodiment

Employed experimental technique is ordinary method if no special instructions among the following embodiment.

Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.

All primers among the following embodiment are synthetic to be finished by the living worker in Shanghai.

The structure of embodiment 1, pichia spp efficient expression vector pUCZ9K, detailed process may further comprise the steps:

1.1, the structure of pUCZ plasmid

Be that template is carried out pcr amplification multiple clone site (MCS) with pUC19 plasmid (available from precious biotechnology), and respectively introduce 1 BglII site at its two ends; PPICZ α A plasmid is reclaimed TEF1-EM7-Zeocin-CYC1TT-pUC ori fragment with BamHI and BglII double digestion, be connected with the MCS fragment after cutting back to close with the BglII enzyme, connect product transformed competence colibacillus bacillus coli DH 5 alpha (available from precious biotechnology), the screening positive recombinant.Positive recombinant plasmid is entrusted the order-checking of handsome company, and the result shows that the MCS fragment correctly is connected with the TEF1-EM7-Zeocin-CYC1TT-pUCori sequence and sequence is correct, and called after pUCZ, makes up flow process and sees Fig. 1.

1.2, the pUCZ9K construction of recombinant plasmid

Plasmid pPIC9K (available from Invitrogen company) with extraction is that template is carried out pcr amplification 5 ' AOX-MCS-3 ' AOX fragment, genome with GS115 bacterial strain (available from Invitrogen company) is that template is carried out pcr amplification rDNA-non-coding region SEQ ID No:1 (see figure 2) simultaneously, and the primer sequence is:

NTS-rDNA-Fw：5’GTTTCGCTGGAAGGGGAACTTTAGA 3’；

NTS-rDNA-Rv：5’CAAAGACCAACCGAAAGCCGACGA 3’；

RDNA non-coding area sequence SEQ ID No:1 (1153bp):

GTTTCGCTGGAAGGGGAACTTTAGATTACAGGGCAAACATGCAAATC

CCAGGCGGGGAAAGCGCTGATTTCTGCGGTTCAGGCCCTGATCCGG

AGTTTGAGAACCCCAACATCAGAATACACCAAAATGGGTTGAGGTG

GTGAATGCTATGTAGTGAACGCTTATGTAAGTGAGCACTTATGTAAGC

GGTTGACCATTATGTAAGCTTGTGGTTTACGTAAACTGTTATGTAAGC

TTTGACCATTATGTAAGCTTGTGGTTTACGTAAACTGTTATGTAAGCT

TTGACCATTATGTAAGCTTGTGGTTTACGTAAACTGTTATGTAAGCTT

TGACCATTATGTAAGCTTGTGGTTTACGTAAACTGTTATGTAAGCTTT

GGCCATTATGTAAGCTTTAAACACTTATGTAAGCTCGAGCCCAGTATG

TAAGCAGATTGACCCATTATGTAAGCTTTGAACACTTATGTAAGCTCG

AAACCGGTTAGGTAAGCAGCTTTGTAAGCAATCTGGACAATTATGTA

AGCGGGTTACGTAAACAGTTATGTAAGCAGAAAAATTTCAAACGAC

AAAACTTGGGGTCTACAGACACAGTAGCCAGAAGATTGCACTACCA

TTCGACTCCTCATGACCCACTCTTTCGATCCATGTAGTTAGGTTACCG

TTTTTCCTAATATTTAAGGATGTTGAAAATTCATTTTCATTTTTTTCGTT

TTTAAGATTTTCTCACAACTCTTCCAAAGATTACTAGTTGACTTTTCA

AATATTTAGGGTATTTTTCTCACTTTTTCCTAGCAAACTCCAATTGGTG

GGTTCAGTGCAATGGAGTATCACCTTGCAACCACAACGTAATAGCTA

ACTTGTGGCCACCATGTCTGGTTGTAGAGATAATTGGATTCTAATGTG

GATCACATGACTACTCACGTGTCAAAAACCCAACCTGACTTGGCCCA

GCTTAGCAAGAATATTTCGAATCCACTCTTGTGGCCTAGTGGACAAC

TGGGAAAGCTTGCGACGCAGTCGTTTTTGGCGATCCAGGCGTAGTAC

TAGGTTCGAGCCTGGTCATTCAGATGGCTCAGAACTTGAGGTTGACT

GAGTTCCAGGTTCGAGTCCAGGACGGGTTGGTTGGTGTCGTCGGCT

TTCGGTTGGTCTTTG

The method of using overlapping extension PCR again couples together (see figure 3) to 5 ' AOX-MCS-3 ' AOX and rDNA non-coding region fragment, and introduces XbaI and KpnI restriction enzyme site respectively at its two ends.Whole structure flow process is seen Fig. 4, and the primer sequence is:

Ppic9k-5’AOX-Xba1-Fw：5’GCTCTAGAAGATCTAACATCCAAAGACGAAAGG 3’

Ppic9k-3’AOX-Rv： 5’CCCTTCCAGCGAAACAAGCTTGCACAAACGAACTTCTCAC 3’

NTS-rDNA-Fw： 5’CGTTTGTGCAAGCTTGTTTCGCTGGAAGGGGAACTTTAGA 3’

NTS-rDNA-Kpn1-Rv： 5’GGGGTACCCAAAGACCAACCGAAAGCCGACGA 3’

With Kpn I and Xba I double digestion 5 ' AOX-MCS-3 ' AOX-rDNA non-coding region fragment and reclaim, is connected with the recovery product of the pUCZ plasmid of same double digestion again, connect product transformed competence colibacillus bacillus coli DH 5 alpha, screen positive recombinant.Positive recombinant plasmid is entrusted the order-checking of handsome company, and the result shows that 5 ' AOX-MCS-3 ' AOX-rDNA non-coding region fragment is correctly inserted the pUCZ plasmid and sequence is correct, and called after pUCZ9K, and plasmid map is seen Fig. 5.

5 ' AOX-MCS-3 ' AOX-rDNA full length sequence:

TCTAGAAGATCTAACATCCAAAGACGAAAGGTTGAATGAAACCTTTT

TGCCATCCGACATCCACAGGTCCATTCTCACACATAAGTGCCAAACG

CAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGAC

CTCCACTCCTCTTCTCCTCAACACCCACTTTTGCCATCGAAAAACCA

GCCCAGTTATTGGGCTTGATTGGAGCTCGCTCATTCCAATTCCTTCTA

TTAGGCTACTAACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCC

CTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCAACAAGCTCCGCAT

TACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCA

AATAGTTTCATGTTCCCCAAATGGCCCAAAACTGACAGTTTAAACGC

TGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAA

CTAAGTTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAA

ACTTCCAAAAGTCGCCATACCGTTTGTCTTGTTTGGTATTGATTGACG

AATGCTCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGC

TTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGGGAAACAC

CCGCTTTTTGGATGATTATGCATTGTCTCCACATTGTATGCTTCCAAGA

TTCTGGTGGGAATACTGCTGATAGCCTAACGTTCATGATCAAAATTTA

ACTGTTCTAACCCCTACTTGACAGCAATATATAAACAGAAGGAAGCT

GCCCTGTCTTAAACCTTTTTTTTTATCATCATTATTAGCTTACTTTCATA

ATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAA

CGACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAGGATCCA

AACGATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATC

CTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACG

GCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGG

GGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGG

GTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGA

AGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTACGTAGAATTC

CCTAGGGCGGCCGCGAATTAATTCGCCTTAGACATGACTGTTCCTCA

GTTCAAGTTGGGCACTTACGAGAAGACCGGTCTTGCTAGATTCTAAT

CAAGAGGATGTCAGAATGCCATTTGCCTGAGAGATGCAGGCTTCATT

TTTGATACTTTTTTATTTGTAACCTATATAGTATAGGATTTTTTTTGTCA

TTTTGTTTCTTCTCGTACGAGCTTGCTCCTGATCAGCCTATCTCGCAG

CTGATGAATATCTTGTGGTAGGGGTTTGGGAAAATCATTCGAGTTTGA

TGTTTTTCTTGGTATTTCCCACTCCTCTTCAGAGTACAGAAGATTAAG

TGAGAAGTTCGTTTGTGCAAGCTTGTTTCGCTGGAAGGGGAACTTTA

GATTACAGGGCAAACATGCAAATCCCAGGCGGGGAAAGCGCTGATT

TCTGCGGTTCAGGCCCTGATCCGGAGTTTGAGAACCCCAACATCAGA

ATACACCAAAATGGGTTGAGGTGGTGAATGCTATGTAGTGAACGCTT

ATGTAAGTGAGCACTTATGTAAGCGGTTGACCATTATGTAAGCTTGTG

GTTTACGTAAACTGTTATGTAAGCTTTGACCATTATGTAAGCTTGTGG

TTTACGTAAACTGTTATGTAAGCTTTGACCATTATGTAAGCTTGTGGT

TTACGTAAACTGTTATGTAAGCTTTGACCATTATGTAAGCTTGTGGTTT

ACGTAAACTGTTATGTAAGCTTTGGCCATTATGTAAGCTTTAAACACT

TATGTAAGCTCGAGCCCAGTATGTAAGCAGATTGACCCATTATGTAAG

CTTTGAACACTTATGTAAGCTCGAAACCGGTTAGGTAAGCAGCTTTG

TAAGCAATCTGGACAATTATGTAAGCGGGTTACGTAAACAGTTATGTA

AGCAGAAAAATTTCAAACGACAAAACTTGGGGTCTACAGACACAGT

AGCCAGAAGATTGCACTACCATTCGACTCCTCATGACCCACTCTTTC

GATCCATGTAGTTAGGTTACCGTTTTTCCTAATATTTAAGGATGTTGAA

AATTCATTTTCATTTTTTTCGTTTTTAAGATTTTCTCACAACTCTTCCA

AAGATTACTAGTTGACTTTTCAAATAATTTAGGGTATTTTTCTCACTTTT

TCCTAGCAAACTCCAATTGGTGGGTTCAGTGCAATGGAGTATCACCT

TGCAACCACAACGTAATAGCTAACTTGTGGCCACCATGTCTGGTTGT

AGAGATAATTGGATTCTAATGTGGATCACATGACTACTCACGTGTCAA

AAACCCAACCTGACTTGGCCCAGCTTAGCAAGAATATTTCGAATCCA

CTCTTGTGGCCTAGTGGACAACTGGGAAAGCTTGCGACGCAGTCGT

TTTTGGCGATCCAGGCGTAGTACTAGGTTCGAGCCTGGTCATTCAGA

TGGCTCAGAACTTGAGGTTGACTGAGTTCCAGGTTCGAGTCCAGGA

CGGGTTGGTTGGTGTCGTCGGCTTTCGGTTGGTCTTTGGGTACC

The screening of the structure of embodiment 2, IL-10-His/pUCZ9K expression vector and yeast efficient expression strain

2.1, the structure of hIL-10-His/pUCZ9K recombinant expression plasmid

2.1.1, the amplification of hIL-10 gene

With TRIzol (available from invitrogen company, article No. 15596-018) and by its specification sheets extract the stripped monocytic total RNA of healthy human peripheral blood (available from the blood station, Hefei), at Turbo Reverse Transcriptase (available from the white company in Yuanping City, Beijing, article No. PC108) under the effect, (give birth to the worker available from Shanghai with oligo dT, article No. B0181) is the synthetic people cDNA of primer, be template with synthetic cDNA, carry out PCR with forward primer 5 '-ATGCACAGCTCAGCACTGCTCTG-3 ' and reverse primer 5 '-GTTTCGTATCTTCATTGTCATG-3 ', the PCR product is inserted into TA carrier pMD18-T (available from precious biotechnology), plasmid is entrusted the order-checking of handsome company, and the result is consistent with expection.

Be template with plasmid pMD18T-IL-10, carry out PCR with forward primer 5 '-TCTCTCGAGAAAAGAAGCCCAGGCCAGGGCACCCA-3 ' and reverse primer 5 '-TTAATGGTGATGGTGATGATGACCGGTGTTTCGTATCTTCATTGTCA-3 ', the PCR reaction conditions is: earlier 94 ℃ 2 minutes; Then 94 ℃ 30 seconds, 55 ℃ 40 seconds, 72 ℃ 1 minute, totally 30 circulations; Last 72 ℃ 10 minutes.After reaction finishes, the PCR product that obtains is carried out 1% agarose gel electrophoresis detect, obtain the band of an about 520bp of size, conform to expected results.Reclaiming test kit (giving birth to the worker available from Shanghai) with the PCR product reclaims the PCR fragment.

2.1.2, the amplification secreting signal peptide (α-factor)

(available from invitrogen company) is template with the pPIC9k plasmid, carry out pcr amplification with forward primer 5 '-CGGGATCCATGAGATTTCCTTCAATTTTTAC-3 ' and reverse primer 5 '-GGGTATCTCTCGAGAAAAGAAGCCCAGGCCAGGGC-3 ', the PCR reaction conditions is: earlier 94 ℃ 2 minutes; Then 94 ℃ 30 seconds, 55 ℃ 40 seconds, 72 ℃ 30 seconds, totally 32 circulations; Last 72 ℃ 10 minutes.After reaction finishes, the PCR product is carried out 1% agarose gel electrophoresis detect, obtain the band of an about 255bp of size, conform to expected results.Reclaiming test kit (giving birth to the worker available from Shanghai) with the PCR product reclaims the PCR fragment.

2.1.3, overlapping extension PCR amplification α-factor-IL-10

PCR product with the first two steps recovery, be that IL-10 fragment and α-factor fragment is template, carry out overlapping extension PCR amplification with forward primer 5 ' CGGGATCCATGAGATTTCCTTCAATTTTTAC 3 ' and reverse primer 5 ' ATTTGCGGCCGCTTAATGGTGATGGTGATGAT 3 ', introduce BamH I and Not I restriction enzyme site respectively at the fragment two ends of amplification.The PCR reaction conditions is: 94 ℃ 2 minutes; 94 ℃ 45 seconds, 55 ℃ 45 seconds, 72 ℃ 1 minute, circulate 32 times; Last 72 ℃ 10 minutes.After reaction finishes, the PCR product is carried out 1% agarose gel electrophoresis detect, obtain the band that a size is about 770bp, conform to expected results.Reclaiming test kit (giving birth to the worker available from Shanghai) with the PCR product reclaims the PCR fragment.

2.1.4, α-factor-IL-10 is connected with the pUCZ9K plasmid

With BamH I and Not I difference double digestion pUCZ9K plasmid and α-factor-IL-10 fragment, purifying reclaims α-factor-IL-10 fragment and pUCZ9K plasmid respectively, connect with the T4DNA ligase enzyme again, and the transformed competence colibacillus bacillus coli DH 5 alpha, screen positive recombinant.Positive recombinant plasmid is entrusted the order-checking of handsome company, and the result shows that α-factor-IL-10 fragment correctly is connected with the pUCZ9K plasmid, and α-factor-IL-10 sequence is consistent with report, and whole structure flow process is seen Fig. 6.

(ATGAGATTTCCTTCAATTTTTACTGCAGTTTTATTCGCAGCATCCTCC

GCATTAGCTGCTCCAGTCAACACTACAACAGAAGATGAAACGGCAC

AAATTCCGGCTGAAGCTGTCATCGGTTACTCAGATTTAGAAGGGGAT

TTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACAAATAACGGGTTA

TTGTTTATAAATACTACTATTGCCAGCATTGCTGCTAAAGAAGAAGGG

GTATCTCTCGAGAAAAGA)[AGCCCAGGCCAGGGCACCCAGTCTGAG

AACAGCTGCACCCACTTCCCAGGCAACCTGCCTAACATGCTTCGAGA

TCTCCGAGATGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGG

ATCAGCTGGACAACTTGTTGTTAAAGGAGTCCTTGCTGGAGGACTTT

AAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGATCCAGTTTTA

CCTGGAGGAGGTGATGCCCCAAGCTGAGAACCAAGACCCAGACATC

AAGGCGCATGTGAACTCCCTGGGGGAGAACCTGAAGACCCTCAGGC

TGAGGCTACGGCGCTGTCATCGATTTCTTCCCTGTGAAAACAAGAGC

AAGGCCGTGGAGCAGGTGAAGAATGCCTTTAATAAGCTCCAAGAGA

AAGGCATCTACAAAGCCATGAGTGAGTTTGACATCTTCATCAACTAC

ATAGAAGCCTACATGACAATGAAGATACGAAAC]ACCGGT<CATCATC

ACCATCACCATTAA>

Annotate: be signal peptide α-factor in (); Be IL-10 in [];＜in be His-tag.

2.2, hIL-10-His/pUCZ9K recombinant expression plasmid electricity transforms pichia spp

With Spe I linearizing hIL-10-His/pUCZ9K recombinant expression plasmid, after ethanol sedimentation reclaims, transform cup with 0.2cm electricity and carry out electricity conversion (parameter setting: voltage 1500V, electric capacity 25uF, 200 ohm of resistance, discharge time 4-5ms) Pichi strain X-33, coated plate is containing the YPD plate of 0.1mg/mlZeocin, is positioned in 28 ℃ of biochemical incubators to cultivate 3-5 days.

2.3, increase the amplification that Zeocin concentration realizes the hIL-10 expression vector

Zeocin concentration is provided with 6 gradients, is respectively: 0.1mg/ml, 0.5mg/ml, 1.0mg/ml, 2.0mg/ml, 3.0mg/ml, 5.0mg/ml.The flow process of whole screening is seen Fig. 7, is that example elaborates below with 0.1mg/ml: 8 mono-clonals of picking at random from the Zeocin plate of 0.1mg/ml at first, insert in the YPD substratum of 4ml, and be put in to shake in 28 ℃ of shaking tables and spend the night; When reaching 10 left and right sides Deng the OD600 value of bacterium liquid, 60% the glycerine that takes out the fresh bacterium liquid of 1ml and 1ml respectively mixes, and is frozen in-80 ℃ of refrigerators; From 8 remaining pipe bacterium liquid, dip in respectively with aseptic toothpick again and get a little, be scoring to respectively on the 0.5mg/ml Zeocin plate, be placed in 28 ℃ of biochemical incubators and cultivated 3-5 days.Deng the new clone on the 0.5mg/ml plate is long when being the 1-2mm size to diameter, be scoring to the Zeocin plate of greater concn by as above steps in sequence again, and protect the clone under each concentration of kind respectively, finally obtain one from the clone bank under the different Zeocin concentration.

2.4, identify the copy number of expression vector with the method for Realtime PCR

2.4.1 the separation of yeast genes group

Preparation pastoris genomic dna in method reference " yeast genetics method experiment guide " second edition of extracting yeast genes group: glass bead method.In the actually operating whole method for extracting is slightly changed, extraction rate was acquired is seen Fig. 8, and is specific as follows:

1) choose mono-clonal from fresh YPD plate and go into the YPD substratum of 5ml, 30 ℃ are shaken and spend the night, and make about thalline OD600=5～10;

2) draw 1ml bacterium liquid with pipettor and go in the EP pipe of 1.5ml, centrifugal 10 minutes of 1500g room temperature is abandoned supernatant;

3) wash 2 times with 1 * PBS (pH 7.2), and abandon supernatant;

4) with the STES damping fluid of 0.1ml (0.2M Tris-Cl, 0.5M NaCl, 0.01M EDTA, 0.1%SDS) resuspended thalline adds the phenol of 0.1ml: chloroform: the granulated glass sphere (0.5-0.6mm) of the pickling of primary isoamyl alcohol (25: 24: 1) and 0.1g again;

5) the whirlpool concussion is 3-4 minute, and the TE damping fluid of adding 0.2ml (10mM Tris, 1mMEDTA, pH8.0), 5 seconds mixings of whirlpool concussion;

6) 12000g, centrifugal 5 minutes of room temperature in clean 1.5ml EP pipe, adds the dehydrated alcohol of 2 times of volumes with the upper water phase transition, puts upside down mixing;

7) 12000g, centrifugal 3 minutes of room temperature is abandoned supernatant.The resuspended DNA precipitation of RNAse A mixed solution with the 10mg/ml of the TE damping fluid of 0.2ml and 2ul.Be put in 37 ℃ of incubator incubations after 5 minutes, add the 3M sodium-acetate of 20 μ l and the ice dehydrated alcohol of 550 μ l again, put upside down mixing, placed-20 ℃ of refrigerators 10 minutes;

8) 12000g, 4 ℃ centrifugal 3 minutes, abandon supernatant after, drying at room temperature 10 minutes, and be resuspended in the TE damping fluid of 50 μ l;

9) purity of usefulness Nano2000 monitoring of DNA, the integrity of running DNA glue identification of dna simultaneously;

2.4.2Realtime PCR method

The detection method of gene copy number is with reference to Abad in the pichia spp, S., et al. (2010) .Biotechnol J.The test kit of Realtime PCR is the precious biological company limited in Dalian

Premix Ex TaqTM, article No. are DRR041A, and the step that concrete operation steps is recommended according to this test kit does not fully explain at this.The detection expression vector copy number of Realtime PCR the results are shown in Table 1.

Table 1Realtime PCR detects the table as a result of expression vector copy number.

Clone's numbering	1.1	0.58	0.51	5.1	2.4	2.6	3.8	2.1	3.1	5.8
											Copy number	1	4	5	6	10	10	11	11	12	16

2.5 the screening of efficient hIL-10 protein expression bacterial strain

Result according to Realtime PCR detection copy number arranges from low to high according to copy number, draws YPD plate activation bacterial strain successively, when mono-clonal length is 1-2mm to diameter, the picking mono-clonal is gone in the BMGY substratum of 4ml, 28 ℃ of overnight incubation (the OD600 value is about 10-16), the centrifugal supernatant of abandoning.Resuspended thalline is in the BMMY substratum, and the initial OD600 of the inducing value of thalline is 1, places 20 ℃ of shaking tables, and rotating speed was that 250rpm shook 36 hours, added 0.5% methyl alcohol every 24 hours.Behind the methanol induction 36 hours, collect respectively and go up cleer and peaceful thalline.Supernatant with 2 * loading buffer (containing beta-mercaptoethanol) with equal-volume mixing sample preparation in 1: 1; The extracting of albumen and method for making sample are with reference to Kushnirov V.V. (2000) .Rapid and reliable protein extraction from yeast. in the thalline YeastThe antibody of sealing usefulness be respectively anti-His primary antibodie (available from Abmart, article No.: M20001) or the primary antibodie of anti-IL-10 (available from Santa Cruz, article No.: sc8438) and anti-mouse lgG-HRP (available from Bio Legend, article No. 405306) two anti-.Fig. 9 has shown 3 clones' of picking western blot result at random.

By analysis, upward the concrete quantization scale of cleer and peaceful thalline content is as follows:

The analysis software that Western result's numerical analysis uses UVI Alliance4.7 chemoluminescence and fluorescence series gel imaging system to carry is finished.

The expression ratio that the contriver finds to adopt low-temp methanol to induce and can significantly improve hIL-10 in the supernatant (is 1.32 times for clone 1, for clone 2, it is 6.07 times, for clone 3, be 6.42 times), this is very favourable for selecting activated hIL-10 efficient expression strain.For the protein expression in improving supernatant, low-temp methanol is induced the expression that is specially adapted to hIL-10, and this discovery has very important meaning for obtaining activated human interleukin-10.

Claims (10)

1. be used for expressing at yeast the method for foreign protein, it comprises the steps:

1) construction of expression vector, described expression vector comprises the rDNA non-coding region, antibiotics resistance gene, the encoding sequence of secreting signal peptide and foreign protein;

2) progressively increase antibiotic concentration, thus the copy number of the described expression vector that increases, and structure contains the clone's of different copy numbers storehouse;

3) foreign protein is expressed and reclaimed to option table Dyclonine.

2. the described method of claim 1, wherein said rDNA non-coding region has the multiple copied characteristic in the yeast genes group, be dispersed on 4 karyomit(e)s of yeast.

3. claim 1 or 2 described methods, wherein said rDNA non-coding area sequence is SEQ ID No:1.

4. each described method among the claim 1-3, it further comprises methanol induction foreign protein secreting, expressing under the low temperature.

5. each described method among the claim 1-4, it also comprises the amount of foreign protein in the comparison yeast born of the same parents and the relative proportion relation of the amount that is secreted into the foreign protein in the supernatant, thus the option table Dyclonine is expressed and is also reclaimed foreign protein.

6. any described method among the claim 1-5, the encoding sequence of wherein said foreign protein is that preferably described foreign protein is human interleukin-10 without codon optimized sequence or through codon optimized sequence.

7. any described method among the claim 1-6, wherein said secreting signal peptide comprises α-factor, α-Dian Fenmei, glucoamylase, serum albumin secreting signal peptide.

8. the expression vector that makes up in any described method among the claim 1-7.

9. the yeast strain that comprises the described expression vector of claim 8.

10. the described expression vector of claim 8 and the described yeast strain of claim 9 are used for the purposes of expressing human interleukin 10.

Images