CN103184237A - Method for improving plant heavy metal tolerance and regulating heavy metal oriented distribution - Google Patents
Method for improving plant heavy metal tolerance and regulating heavy metal oriented distribution Download PDFInfo
- Publication number
- CN103184237A CN103184237A CN2011104541760A CN201110454176A CN103184237A CN 103184237 A CN103184237 A CN 103184237A CN 2011104541760 A CN2011104541760 A CN 2011104541760A CN 201110454176 A CN201110454176 A CN 201110454176A CN 103184237 A CN103184237 A CN 103184237A
- Authority
- CN
- China
- Prior art keywords
- plant
- heavy metal
- hmt1
- translocator
- sphmt1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention relates to a method for improving plant heavy metal tolerance and regulating heavy metal oriented distribution. According to the invention, for a first time, vacuolar membrane transporter protein HMT1 gene is expressed in plant, such that plant heavy metal tolerance is improved. Through tissue-specific expression of the gene, heavy metal oriented distribution in plant is realized. The gene provided by the invention can be used in plant variety improvement. With the gene, plant heavy metal resistance can be improved, heavy metal contents in different tissues and organs of plant can be regulated, heavy metal content in plant edible part can be reduced, plant reparation can be promoted, plant chlorophyll content under stresses of heavy metals such as cadmium can be increased, and the like. The invention provides a valuable gene oriented expression operation method for culturing plant novel varieties by using molecular breeding technologies such as genetic modification.
Description
Technical field
The invention belongs to biological technical field; More specifically, the present invention relates to utilize vacuole skin translocator HMT1, improve heavy metal patience and regulate mechanism of action of heavy metal fixed direction allocation and uses thereof.
Background technology
In recent years, because development of modern industry, increasing heavy metal is discharged in the biosphere as cadmium, arsenic, lead etc.The pollution of heavy metal cadmium etc. not only causes crop failure, especially food safety is threatened.Cadmium is one of the strongest heavy metal of bio-toxicity, is the easiest known IA level carcinogens of accumulating in vivo.Cadmium excessive in food and the water causes many-sided harm by food chain in tissue and intraorganic accumulation, comprises illnesss such as the infringement of kidney, liver even cancers.
Therefore the reparation of contaminated soil such as heavy metal cadmium is the environmental problem that needs to be resolved hurrily, because traditional method costs dearly, phytoremediation has been subjected to great attention and application widely as a kind of emerging green environment improvement technology.But, pollute comparatively serious country at some, such as China, to last century end, heavy metals in farmland cadmium pollution area has reached 20,000 hectares, and the annual cadmium content of the producing agricultural-food that exceed standard reach 14.6 hundred million kilograms.Recently, surpass 10% rice by cadmium pollution according to having on Agricultural University Of Nanjing's research report Chinese market, human beings'health has been constituted huge potential threat.Therefore, when carrying out phytoremediation, toxic heavy metals such as minimizing cadmium may be more real a kind of selections for having the country that pollutes in a big way to the migration of edible position.
The method of utilizing molecular breeding to reduce cadmium element content in the edible position such as crop kernels has good and vast potential for future development, but also there are a lot of problems in plant to absorption and transport and the Resistance Mechanism of heavy metal cadmium, and is especially also very unclear to the molecule mechanism of edible positions such as seed migration.
Therefore, this area also needs to carry out deep research, to develop the plant good to the heavy metal tolerance; Further, develop method and the product of toxic heavy metal content in the edible positions such as effective reduction crop kernels.
Summary of the invention
The object of the present invention is to provide a kind of vacuole skin translocator HMT1 in plant, to become merits and demerits to express also and can improve plant to heavy metal tolerance and accumulation ability.
The present invention also aims to provide the method for heavy metal (particularly cadmium) constituent content in the edible positions such as a kind of reduction crop kernels.
In a first aspect of the present invention, the purposes of a kind of vacuole skin translocator HMT1 is provided, be used for improving plant to the tolerance of heavy metal, regulate the fixed direction allocation of heavy metal or improve the chlorophyll content of plant under the heavy metal stress.
In a preference, described vacuole skin translocator HMT1 is used for transporting heavy metal in the vacuole of vegetable cell.
In another preference, described heavy metal comprises: cadmium (Cd), arsenic (As), copper (Cu) or zinc (Zn).
In another preference, described HMT1 is:
(a) albumen of aminoacid sequence shown in GenBank accession number CAA78419; Or
(b) process of aminoacid sequence shown in the GenBank accession number CAA78419 is one or more (as 1-30; Preferably 1-20; More preferably 1-10; 1-5 more preferably) replacement, disappearance or the interpolation of amino-acid residue form, and have the albumen of the protein function that (a) limit;
(c) the sequence homogeny of albumen with aminoacid sequence shown in the GenBank accession number CAA78419 is higher than 70%, and has the albumen of the protein function that (a) limit.
In another aspect of this invention, provide a kind of improve plant for the tolerance of heavy metal, regulate heavy metal accumulation degree in the plant tissue or improve the method for the chlorophyll content of plant under the heavy metal stress, described method comprises: the vacuole skin translocator HMT1 that expresses external source in plant.
In a preference, described method comprises: the expression cassette of vacuole skin translocator HMT1 is changed in the plant, thus the vacuole skin translocator HMT1 that in plant, expresses external source.
In another preference, described method comprises:
(1) provide the Agrobacterium of carrying expression vector, described expression vector contains the expression cassette of vacuole skin translocator HMT1;
(2) vegetable cell or tissue or organ are contacted with Agrobacterium in the step (1), thereby make the expression cassette of vacuole skin translocator HMT1 change vegetable cell over to, and be incorporated on the karyomit(e) of vegetable cell;
(3) select vegetable cell or tissue or the organ of the expression cassette that has changed vacuole skin translocator HMT1 over to; With
(4) vegetable cell in the step (3) or tissue or neomorph are become plant.
In another aspect of this invention, provide a kind of different plant of heavy metal accumulation degree in heavy metal or the tissue that tolerates, include the expression cassette of vacuole skin translocator HMT1 in its genome.
In another aspect of this invention, provide heavy metal accumulation degree methods in a kind of adjusting plant tissue, described method comprises:
The expression cassette of vacuole skin translocator HMT1 is changed in the plant, and the expression cassette of this vacuole skin translocator HMT1 comprises the promotor of operability connection, the polynucleotide of coding vacuole skin translocator HMT1;
Wherein, described promotor is plant particular organization specific expressing promoter, express in plant particular organization thereby drive vacuole skin translocator HMT1, promote heavy metal to transport into this plant particular organization (preferably, reducing the content of heavy metal in other tissue of plant).
In a preference, in the described expression cassette, 3 ' end of the polynucleotide of coding vacuole skin translocator HMT1 also comprises terminator.
In another preference, described plant particular organization is selected from (but being not limited to): root, stem, leaf, seed, plant skin.
In another preference, described plant is the plant that comprises edible tissues, described promotor is the non-edible tissue specific expressing promoter of plant, thereby heavy metal is transported non-edible tissue into plant (preferably, reducing the content of heavy metal in the plant edible tissues).
In another preference, described non-edible tissue specific expressing promoter is the roots of plants specific expressing promoter.Described root-specific expression promotor is selected from but is not limited to: Adh promotor, NT1 promotor, ZmGLU1 promotor etc.
In another preference, described promotor is the specificity promoter that plant shoot divides tissue.
In another preference, it is the CAB2 promotor that described plant shoot divides the specificity promoter of tissue.
In another preference, described method comprises:
(1) provide the Agrobacterium of carrying expression vector, described expression vector contains the expression cassette of described vacuole skin translocator HMT1;
(2) vegetable cell or tissue or organ are contacted with Agrobacterium in the step (1), thereby make the expression cassette of vacuole skin translocator HMT1 change vegetable cell over to, and be incorporated on the karyomit(e) of vegetable cell;
(3) select vegetable cell or tissue or the organ of the expression cassette that has changed vacuole skin translocator HMT1 over to; With
(4) vegetable cell in the step (3) or tissue or neomorph are become plant.
In another aspect of this invention, provide the expression cassette of a kind of vacuole skin translocator HMT1, it comprises the promotor of operability connection, the polynucleotide of coding vacuole skin translocator HMT1; Wherein, described promotor is plant particular organization specific expressing promoter.
In another aspect of this invention, the purposes of the expression cassette of described vacuole skin translocator HMT1 is provided, be used for regulating plant tissue heavy metal accumulation degree, promote heavy metal to transport into this plant particular organization, reduce the content of heavy metal in other tissue of plant.
In another aspect of this invention, the different plant of heavy metal accumulation degree in a kind of tissue is provided, include the expression cassette of vacuole skin translocator HMT1 in its genome, the expression cassette of this vacuole skin translocator HMT1 comprises the promotor of operability connection, the polynucleotide of coding vacuole skin translocator HMT1; Wherein, described promotor is plant particular organization specific expressing promoter, this promoters driven vacuole skin translocator HMT1 expresses in plant particular organization, promotes heavy metal to transport into this plant particular organization (preferably, reducing the content of heavy metal in other tissue of plant).
Other side of the present invention is because the disclosure of this paper is apparent to those skilled in the art.
Description of drawings
Fig. 1, improved SpHMT1 can complementary yeast mutants Δ hmt1 the responsive phenotype of cadmium.
A, the experiment of yeast cadmium resistant panel.Transform empty carrier pART1 (V/LK100) in the Δ hmt1 mutant yeast (LK100) respectively, the SpHMT1 (HMT1/LK100) and the transformed Kozak-HMT1 (KHMT1/LK100) that contain yeast 5 ' utr itself transform wild-type yeast (V/Sp223) conduct of empty carrier over against photograph.
Yeast growth curve under B, the cadmium concentration gradient.
Fig. 2, RT-PCR analyze the expression of SpHMT1 in transgenic arabidopsis.
The expression of SpHMT1 in A, the 35S:SpHMT1/Col-04 week transgenosis Arabidopis thaliana cauline leaf.W2-11, W3-13 and W7-3 represent respectively 35S/SpHMT1:cmyc-pBI121 are transformed three independent strain systems that obtain behind the Col-0.The expression of SpHMT1 is with this figure in the transgenic arabidopsis root.
The expression of SpHMT1 in B, the 35S:SpHMT1/cad1-34 week transgenosis Arabidopis thaliana cauline leaf.M10-8 and M1-12 represent respectively 35S/SpHMT1:cmyc-pBI121 are transformed two independent strain systems that obtain behind the cad1-3.The expression of SpHMT1 is with this figure in the transgenic arabidopsis root.
The expression of SpHMT1 in C, the Adh:SpHMT1/Col-04 week transgenosis Arabidopis thaliana root.A5-9 and A26-4 represent Adh/SpHMT1:cmyc-pBI121 respectively and transform two independent strain systems that obtain behind the Col-0.
The expression of SpHMT1 in D, the Adh:SpHMT1/Col-04 week transgenosis Arabidopis thaliana cauline leaf.
Fig. 3, SpHMT1 crossing in the wild-type Arabidopis thaliana expressed and can be strengthened plant to the resistance of heavy metal.
Adding 50 μ M CdCl respectively after A-D, the seed-coat sterilization
2(A), 150 μ M KH
2AsO
4(B), 40 μ M CuSO
4(C) or 150 μ M ZnSO
4(D) 4 weeks of vertical-growth on 1/4 * MS flat board.
The fresh weight of plant among E, the A-D figure.Wherein among the Cd50 50 the expression substratum in Cd content 50 μ M, As150 represents As content 150 μ M in the substratum, and the like.
The corresponding heavy metal content of plant among F, the A-D figure (complete stool seedling).Data are the mean+SD of three independent experiments, comprise>100 strain plants in each experiment,
*P<0.01.
W2-11 and W7-3 represent respectively 35S/SpHMT1:cmyc-pBI121 are transformed two independent strain systems that obtain behind the Col-0.
Fig. 4, BSO have suppressed resistance and the accumulation of SpHMT1 transfer-gen plant to heavy metal.
A-B, seed-coat sterilization back are being added 10 μ M CdCl respectively
2With vertical-growth on 1/4 * MS flat board of 0.5mM BSO (A) or 0.5mM BSO (B) 20 days.
The fresh weight of plant among C, A and the B figure.
Cadmium content detects in D, each tissue of transfer-gen plant.Wherein, S represents stem, and L represents the lotus throne leaf, and R represents root.
Data are the mean+SD of three independent experiments, comprise>100 strain plants in each experiment.
W2-11 and W7-3 represent respectively 35S/SpHMT1:cmyc-pBI121 are transformed two independent strain systems that obtain behind the Col-0.
Fig. 5, SpHMT1 crossing in Arabidopis thaliana PCs deletion mutant cad1-3 expressed and can not be strengthened heavy metal resistance and accumulation.
A, seed-coat sterilization back vertical-growth 7 days on 1/4 * MS flat board.
5 μ M CdCl are being added in B, seed-coat sterilization back
21/4 * MS flat board on vertical-growth 20 days.
The fresh weight of plant among C, A and the B figure.
The cadmium concentration of plant among D, A and the B figure.CK represents collating condition (common 1/2 * MS plate is cultivated).
Data are the mean+SD of 3 independent experiments, comprise>100 strain plants in each experiment.
M10-8 and M1-12 represent respectively 35S/SpHMT1:cmyc-pBI121 are transformed two independent strain systems that obtain behind the cad1-3.
Fig. 6, the distribution of cadmium between vacuole and protoplastis.
A, cadmium be at Col-0, the content in cad1-3 and corresponding transgenic plant W2-11 and M10-8 blade protoplastis and the vacuole.The active conversion standard as cadmium content of vegetable acid acid phosphatase (ACP).Data are the mean value ± standard error of three independent experiments.
B, the partition rate of cadmium in kytoplasm and vacuole.Numerical value represents the shared ratio in whole protoplastis of cadmium content in the vacuole.
Fig. 7, the content of phytochelatin (PCs) in vacuole.The active conversion standard as PCs content of vegetable acid acid phosphatase (ACP).Data are the mean value ± standard error of three independent experiments.
PC2, PC3, PC4 represent the PC molecule of different chain length respectively, and numeral is PC molecule common structure (γ-Glu-Cys)
nThe value of n among the-Gly.
Fig. 8, the SpHMT1 specific expressed increase plant in root is to Cd
2+Resistance.
The plant in 4 weeks of water planting is respectively with 10 μ M CdCl
2Handle after 7 days, extract lotus throne leaf chlorophyll content and compare.Data are mean+SD, comprise>8 strain plants in each experiment.Control is normal culture condition.
A5-9 and A26-4 represent Adh/SpHMT1:cmyc-pBI121 respectively and transform two independent strain systems that obtain behind the Col-0.
Fig. 9, the SpHMT1 specific expressed heavy metal content that can reduce in plant shoot branch and the seed in root.
The plant in A-C, 4 weeks of water planting is respectively with 10 μ M CdCl
2(A), 100 μ M KH
2AsO
4(B) or 20 μ M CuSO
4(C) handle after 3 days, draw materials and measure corresponding heavy metal content in root (R) and the lotus throne leaf (L).
The plant in D-F, 2 weeks of water planting is respectively with 5 μ M CdCl
2(D), KH
2AsO
4(E) or CuSO
4(F) handle behind seed maturity, draw materials and measure corresponding heavy metal content in the seed.
Data are the mean+SD of three independent experiments, comprise>8 strain plants in each experiment.
A5-9 and A26-4 represent Adh/SpHMT1:cmyc-pBI121 respectively and transform two independent strain systems that obtain behind the Col-0; The W2-11 representative transforms 35S/SpHMT1:cmyc-pBI121 the strain system that obtains behind the Col-0.
Figure 10, SpHMT1 be the specific expressed distribution that can change heavy metal cadmium of part on the ground.
The plant in A, 4 weeks of water planting is respectively with 10 μ M CdCl
2Handled 3 days, and drew materials and measure corresponding heavy metal content in root (R) and the lotus throne leaf (L).
The plant in B, 2 weeks of water planting is respectively with 5 μ M CdCl
2Processing is drawn materials and is measured corresponding heavy metal content in the seed behind seed maturity.
Data are the mean+SD of three independent experiments, comprise>8 strain plants in each experiment.
C20-2 and C23-1 represent CAB2/SpHMT1:cmyc-pBI121 respectively and transform two independent strain systems that obtain behind the Col-0; The W2-11 representative transforms 35S/SpHMT1:cmyc-pBI121 the strain system that obtains behind the Col-0.
Embodiment
The inventor finds a kind of for improving plant to the tolerance of heavy metal and regulating the useful gene of heavy metal accumulation degree---vacuole skin translocator HMT1 gene (HMT1) in the plant tissue through research widely.Gene of the present invention can be applicable to the improvement of plant variety, comprising: improve plant for the resistibility of heavy metal; Regulate the content of heavy metal in the different tissue of plant, the organ; Reduce the content of heavy metal in the plant edible position; Improve the chlorophyll content in the plant tissue under the heavy metal stress.The present invention provides very valuable genetic resources for using the transgenosis equimolecular breeding technique new variety that cultivate plants.
Among the present invention, for being applicable to that plant of the present invention (or crop) has no particular limits, as long as it is fit to carry out the conversion operation of gene, as various farm crop, flower plant or forestry plant etc.Described plant is such as being (being not limited to): dicotyledons, monocotyledons or gymnosperm.More specifically, described plant includes, but is not limited to: wheat, barley, rye, paddy rice, corn, jowar, beet, apple, pears, Lee, peach, apricot, cherry, strawberry, rasp berry, blackberry, blueberry, beans, French beans, pea, soybean, rape, mustard, opium poppy, olea, Sunflower Receptacle, coconut, the Viscotrol C plant, cocoa beans, peanut, cucurbit, cucumber, watermelon, cotton, flax, hemp, jute, citrus, lemon, natsudaidai, spinach, the piemarker lettuce, asparagus, cabbage, Chinese cabbage, Plantula Brassicae chinensis, Radix Dauci Sativae, onion, potato, tomato, green pepper, avocado, cassia bark, camphor, tobacco leaf, nut, coffee, eggplant, sugarcane, tealeaves, pepper, grapevine, oyster fiber crops grass, banana, natural rubber tree and ornamental plant etc.
As a kind of optimal way, described " plant " includes but not limited to: Cruciferae, Gramineae, the Rosaceae.Such as, described " plant " includes but not limited to: Chinese cabbage, Plantula Brassicae chinensis that the Cruciferae rape belongs to, and Cruciferae mouse ear mustard such as Arabidopis thaliana, paddy rice gramineous, wheat, corn etc. comprise tobacco, melon and fruit, vegetables, rape etc. in addition.
As used herein, " separation " refers to that material separates (if natural substance, primal environment namely is natural surroundings) from its primal environment.Do not have separation and purification as the polynucleotide under the native state in the active somatic cell and polypeptide, but same polynucleotide or polypeptide as from native state with in other materials that exist separately, then for separation and purification.
As used herein, " the vacuole skin translocator HMT1 of separation ", " the SpHMT1 albumen of separation " or " the SpHMT1 polypeptide of separation " refer to that SpHMT1 albumen is substantially free of natural relative other albumen, lipid, carbohydrate or other material.Those skilled in the art can use the purified technology of protein purifying SpHMT1 albumen of standard.Basically pure polypeptide can produce single master tape on non-reduced polyacrylamide gel.
As used herein, " edible tissues (organ) " of plant refers to come from plant materials, can directly maybe can be processed into the plant tissue (organ) of food as food.In some farm crop, " edible tissues (organ) " for example: the seed of gramineous crop such as paddy rice, wheat (containing or do not contain kind of a skin), the piece root of potato class plant such as sweet potato, the leaf of cress such as Chinese cabbage.
As used herein, " non-edible tissue (organ) " of plant refers to come from plant materials, is not used as food usually or also is not processed into the plant tissue (organ) of food.In some farm crop, " non-edible tissue (organ) " for example: the stem of gramineous crop such as paddy rice, wheat, leaf, root, the stem of potato class plant such as sweet potato, climing, the root of cress such as Chinese cabbage, Arabidopis thaliana.
As used herein, " expression cassette " refers to recombinant DNA molecules here, and it comprises the nucleic acid coding sequence of expection, this sequence encoding SpHMT1 albumen; This dna molecular also comprises the controlling element that is fit to of transcribing the necessary or expection of in external or body exercisable connection encoding sequence." controlling element " here refers to and can control the nucleotide sequence that nucleotide sequence is expressed.The controlling element that can be used as the model comprises promotor, transcription termination sequence or upstream regulation district, and these controlling elements help the copying of nucleic acid, transcribe, post transcriptional modificaiton etc.In addition, controlling element can also comprise: enhanser, internal ribosome entry site (IRES), replication orgin, polyadenylation signal etc.
As used herein, described " operability links to each other " or " operationally being connected in " refer to a kind of like this situation, and namely the activity of same linear DNA sequence other parts can be regulated or control to some part of linear DNA sequence.For example, if the transcribing of promotor control sequence, it is exactly operationally to be connected in encoding sequence so.
As used herein, described " promotor " or " promoter region (territory) " refers to a kind of nucleotide sequence, and the upstream (5 ' end) that it is present in the goal gene encoding sequence usually can be transcribed into mRNA by the guiding nucleus acid sequence.Usually, promotor or promoter region provide RNA polymerase and correct initial recognition site of transcribing necessary other factor.In this article, described promotor or promoter region comprise the variant of promotor, and it is by inserting or deletion regulation and control zone, carry out at random or the rite-directed mutagenesis promotor waits to obtain.
As used herein, " tissue-specific promoter " claims " organ specific promoters " again, and under this class promoter regulation, gene is often only expressed at some specific organ or tissue position, and shows the characteristic of growing adjusting.Usually, if mRNA is with than at least 10 times of height in other tissue or organ in certain tissue or organ, preferably high at least 100 times, more preferably high at least 1000 times of levels are expressed, and then this promotor is considered to tissue or organ specific.
As used herein, described " containing ", " having " or " comprising " comprised " comprising ", " mainly by ... constitute ", " basically by ... constitute " and " by ... constitute "; " mainly by ... constitute ", " basically by ... constitute " and " by ... formation " belong to the subordinate concept of " containing ", " having " or " comprising ".
Vacuole skin translocator HMT1
Vacuole skin translocator HMT1 albumen is also referred to as: PC-metal composite vacuole skin translocator, vacuole metal translocator, PC-translocator, phytochelatin (element) translocator, the heavy metal tolerance factor.Existing discovering all found the HMT1 gene of coding HMT1 albumen for example to have SpHMT1 (Z14055) in yeast, fruit bat and the nematode respectively, DmHMT1 (EU571211) and CeHMT1 (AF497513) gene in multiple biology.
Polypeptide of the present invention (albumen) can be recombinant polypeptide, natural polypeptides, synthetic polypeptide, preferably recombinant polypeptide.Polypeptide of the present invention can be the product of natural purifying, or the product of chemosynthesis, or uses recombinant technology to produce from protokaryon or eucaryon host (for example, bacterium, yeast, higher plant, insect and mammalian cell).The host used according to the recombinant production scheme, polypeptide of the present invention can be glycosylated, maybe can be nonglycosylated.Polypeptide of the present invention also can comprise or not comprise initial methionine residues.
The present invention also comprises fragment, derivative and the analogue of HMT1 albumen.As used herein, term " fragment ", " derivative " refer to keep basically the identical biological function of HMT1 albumen of the present invention or active polypeptide with " analogue ".Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), and the amino-acid residue of such replacement can be also can not encoded by genetic code, or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) mature polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merges formed polypeptide, or (iv) additional aminoacid sequence is fused to this peptide sequence and the polypeptide that forms (as leader sequence or secretion sequence or be used for sequence or the proteinogen sequence of this polypeptide of purifying or fusion rotein).These fragments of definition, derivative and analogue according to this paper belong to the known scope of those skilled in the art.
In the present invention, term " SpHMT1 albumen " refers to have and improves the GenBank accession number CAA78419 polypeptide of sequence that heavy metal ability such as plant tolerance cadmium maybe can be regulated heavy metal accumulation degree in the plant tissue.This term also comprises the variant forms heavy metal ability, GenBank accession number CAA78419 sequence such as having the plant of raising tolerance cadmium.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best, also better for 1-8 or 1-5) amino acid whose disappearance, insertion and/or replacement, and at C-terminal and/or N-terminal interpolation one or several (being generally in 20, preferably is in 10, more preferably is in 5) amino acid.For example, in the art, when replacing with the close or similar amino acid of performance, can not change the function of protein usually.Again such as, add or reduce the function that or several amino acid also can not change protein usually at C-terminal and/or N-terminal.This term also comprises active fragments and the reactive derivative of SpHMT1 albumen.
The variant form of polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low tight degree condition can with the coded albumen of the DNA of SpHMT1 protein D NA hybridization and the polypeptide or the albumen that utilize the antiserum(antisera) of anti-SpHMT1 albumen to obtain.The present invention also provides other polypeptide, as comprises the fusion rotein of SpHMT1 albumen or its fragment.Except the polypeptide of total length almost, the present invention has also comprised the soluble fragments of SpHMT1 albumen.Usually, this fragment have the SpHMT1 protein sequence at least about 20 continuous amino acids, usually at least about 30 continuous amino acids, preferably at least about 50 continuous amino acids, more preferably at least about 80 continuous amino acids, best at least about 100 continuous amino acids.
The present invention also provides the analogue of SpHMT1 albumen or polypeptide.The difference of these analogues and natural SpHMT1 albumen can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise genetic variant natural or that induce.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and the analogue with that non-natural exists or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modify and also comprise glycosylation.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
In the present invention, " SpHMT1 albumen conservative property variation polypeptide " refers to compare with the aminoacid sequence of GenBank accession number CAA78419, there are 30 at the most, preferably at the most 20, more preferably at the most 10, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to table 1 and produce.
Table 1
Amino-acid residue | Representational replacement | The preferred replacement |
Ala(A) | Val;Leu;Ile | Val |
Arg(R) | Lys;Gln;Asn | Lys |
Asn(N) | Gln;His;Lys;Arg | Gln |
Asp(D) | Glu | Glu |
Cys(C) | Ser | Ser |
Gln(Q) | Asn | Asn |
Glu(E) | Asp | Asp |
Gly(G) | Pro;Ala | Ala |
His(H) | Asn;Gln;Lys;Arg | Arg |
Ile(I) | Leu;Val;Met;Ala;Phe | Leu |
Leu(L) | Ile;Val;Met;Ala;Phe | Ile |
Lys(K) | Arg;Gln;Asn | Arg |
Met(M) | Leu;Phe;Ile | Leu |
Phe(F) | Leu;Val;Ile;Ala;Tyr | Leu |
Pro(P) | Ala | Ala |
Ser(S) | Thr | Thr |
Thr(T) | Ser | Ser |
Trp(W) | Tyr;Phe | Tyr |
Tyr(Y) | Trp;Phe;Thr;Ser | Phe |
Val(V) | Ile;Leu;Met;Phe;Ala | Leu |
Existing discovering all found the homologous gene of SpHMT1 in other multiple biology, for example have homologous gene DmHMT1 (EU571211) and the CeHMT1 (AF497513) of SpHMT1 in fruit bat and the nematode respectively.Obviously, the albumen of the homologous genes encoding of SpHMT1 also has the identical or approaching effect of SpHMT1 albumen, also can mediate Cd
2+Resistance and accumulation.Therefore, the homologous gene of these SpHMT1 and encoded protein thereof also are included in the present invention, are used for improving plant to the tolerance of heavy metal, change heavy metal distribution within plant tissue.
The present invention also provides the polynucleotide sequence of code book invention SpHMT1 albumen or its conservative property variation polypeptide.
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the GenBank accession number Z14055 or the varient of degeneracy.As used herein, " varient of degeneracy " refers in the present invention encode and has the albumen of GenBank accession number CAA78419 sequence, but with the differentiated nucleotide sequence of coding region sequence shown in the GenBank accession number Z14055.
The polynucleotide of the mature polypeptide of coding GenBank accession number CAA78419 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; The encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
Term " polynucleotide of coded polypeptide " can be the polynucleotide that comprise this polypeptide of encoding, and also can be the polynucleotide that also comprise additional code and/or non-coding sequence.
The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural takes place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from not changing the function of its encoded polypeptides in fact.
The invention still further relates to and above-mentioned sequence hybridization and two sequences between have at least 50%, preferably at least 70%, the polynucleotide of at least 80% homogeny more preferably.The present invention be more particularly directed under stringent condition and the interfertile polynucleotide of polynucleotide of the present invention.In the present invention, " stringent condition " refers to: (1) than the hybridization under low ionic strength and the comparatively high temps and wash-out, as 0.2 * SSC, and 0.1%SDS, 60 ℃; Or (2) hybridization the time is added with denaturing agent, as 50% (v/v) methane amide, 0.1% calf serum/0.1%Ficoll, 42 ℃ etc.; Or (3) only at the homogeny between the two sequences at least more than 80%, better more than at least 90%, be more preferably 95% and just hybridize when above.And the polypeptide of interfertile polynucleotide encoding has identical biological function and activity with the mature polypeptide shown in the GenBank accession number CAA78419.
The invention still further relates to the nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 15 Nucleotide at least, better is at least 30 Nucleotide, is more preferably at least 50 Nucleotide, preferably more than at least 100 Nucleotide.Nucleic acid fragment can be used for the amplification technique (as PCR) of nucleic acid to determine and/or to separate the polynucleotide of coding SPHMT1 albumen.
The purposes of HMT1 and the expression in plant materials thereof
The invention provides the purposes of HMT1, be used for improving plant to the tolerance of heavy metal, or for the preparation of the transgenic plant strong to the heavy metal tolerance, or the degree that is used for regulating the accumulation of plant tissue heavy metal.Described HMT1 can transport heavy metal in the vacuole of vegetable cell, thereby improves plant to the tolerance of heavy metal.
Described HMT1 (as SpHMT1) raising plant realizes by express HMT1 in plant that to the tolerance of heavy metal the inventor has realized the expression (or cross and express) of HMT1 for the first time in plant.
Therefore, the present invention also provides a kind of for the expression cassette at plant interior expression HMT1.Described expression cassette comprises the controlling element of operability connection and the encoding sequence of HMT1, thereby in it is transferred to cell or after being incorporated in the genome, can recombinant expressed HMT1 albumen.
Comprise the promotor that is connected with HMT1 encoding sequence operability in the described expression cassette.Described promotor can be any HMT1 of guidance encoding sequence expression promoter within plant tissue, for example be composing type (for example CaMV35S promotor) or tissue-specific.Under promoters driven, the expression of HMT1 albumen can improve plant to the tolerance of heavy metal, strengthens the viability of plant under the heavy metal environment, regulates the degree of heavy metal accumulation in the plant tissue.
As optimal way of the present invention, described promotor is the plant tissue specific expressing promoter, contains the expression cassette of this promotor when being changed over to plant and starting expression, can regulate the degree of heavy metal accumulation in the plant tissue.Embodiments of the invention are verified, and a kind of plant particular organization specific expressing promoter can drive HMT1 albumen and express in plant particular organization, promote heavy metal to transport into this plant particular organization, reduce the content of heavy metal in other tissue of plant.
As optimal way of the present invention, described plant is farm crop, and it comprises can be by the edible edible tissues of people or non-human mammal and the non-edible tissue that is not eaten.Described promotor is the non-edible tissue specific expressing promoter of plant, expresses in the non-edible tissue of plant thereby can drive HMT1 albumen, and heavy metal is transported non-edible tissue into plant, reduces the content of heavy metal in the plant edible tissues.Defining according to different plants of the edible tissues of plant and non-edible tissue and different, but the grower of persons skilled in the art or plant is easy to judge.
The tissue specificity expression promoter of plant can be various tissue-specific promoter known in the art, for example roots of plants specificity promoter Adh, NT1, ZmGLU1 promotor etc.; Axis specificity promoter CAB2, C4H, RBCS1 promotor etc.; Plant species skin specificity promoter SCSP, SCFP promotor etc.
Among the present invention, the expression cassette of HMT1 albumen can be inserted in the recombinant expression vector.Term " recombinant expression vector " refers to bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus or other carriers.In a word, as long as can copy in host and stablize, any plasmid and carrier can be used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary kantlex or amicillin resistance.
The invention still further relates to a kind of method that improves crop, this method is included in the HMT1 albumen of expressing external source in the plant.This albumen is transported heavy metal in the vacuole in cell, thereby makes described plant have better heavy metal tolerance, or improves the chlorophyll content in the plant tissue under the described heavy metal stress.
The method of HMT1 genetic expression is that this area is known.Usually, can make plant express HMT1 by changing the expression cassette that carries the HMT1 encoding gene over to.
As a kind of optimal way of the present invention, the method for the plant of acquisition expression HMT1 is as follows:
(1) provide the Agrobacterium of carrying expression vector, described expression vector contains the expression cassette of HMT1 albumen;
(2) vegetable cell or tissue or organ are contacted with Agrobacterium in the step (1), thereby make the expression cassette of this HMT1 albumen change vegetable cell over to, and be incorporated on the karyomit(e) of vegetable cell;
(3) select vegetable cell or the tissue that changes described HMT1 protein expression box over to; With
(4) vegetable cell or tissue regeneration in the step (3) are become plant.
Wherein, can adopt any suitable conventional means, comprise that reagent, temperature, pressure condition wait to implement this method.
Major advantage of the present invention is: successfully HMT1 is crossed in plant first and express, and can improve plant to resistance and the accumulation ability of heavy metals such as cadmium.The tissue specific expression of HMT1 gene can be applied to the improvement of plant variety admirably among the present invention, lower the content of heavy metal such as cadmium in the plant edible position,, increase plant shoot divide in the content of heavy metal such as cadmium, improve the chlorophyll content in the plant tissue under the heavy metal stress.The present invention provides very valuable genetic resources and working method for the higher new crop varieties of developing food products security or for exploitation phytoremediation new variety.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example is write according to normal condition such as J. Sa nurse Brooker etc. usually, molecular cloning experiment guide, Science Press, the condition described in 2002, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
Unless otherwise defined, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any method similar or impartial to described content and material all can be applicable among the present invention.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.
Clone and the transformation of embodiment 1, vacuole skin transporter gene SpHMT1
The inventor is template with fission yeast (S.pombe) cDNA, and (SpHMT1 (+)-PCR and SpHMT1 (-)-PCR), the amplification of KOD-plus reaction system obtains comprising the SpHMT1 full-length cDNA of 5 '-UTR by SpHMT1 clone primer.(K-SpHMT1 (+)-PCR and K-SpHMT1 (-)-PCR) clone obtain replacing with Kozak sequence conservative in the higher plant cDNA of yeast 5 '-UTR itself to design primer simultaneously.All design primer with the terminator codon sudden change (TAA becomes TCA by sequence) of cDNA and introduce the SpeI restriction enzyme site.Utilize the SpeI restriction enzyme site that cDNA is built into 35S/TaPCS1:cmyc-pBI121 expression vector (reference Jiming GONG etc., Long-distance root-to-shoot transport of phytochelatins and cadmium in Arabidopsis. (2003); PNAS, vol.100, no.17,10118-10123; Make up as follows: the wheat TaPCS1 that two ends is comprised the BamHI/SpeI site is incorporated among the pBluescript II SK, 3 * myc label also is incorporated in the SpeI/SacI site of this carrier; Above-mentioned plasmid obtains the fusion dna fragment after cutting through BamHI and SacI enzyme, is inserted in the pBI121 carrier, obtains 35S/TaPCS1:cmyc-pBI121) and realize that cymc albumen label is at thereafter amalgamation and expression.
Whether the improved albumen of check still has activity in yeast complementation experiment subsequently.
The gene clone primer sequence:
SpHMT1(+)-PCR:
AGGATCCAAATTAGCAATTGAAGCAGTAACAA(SEQ ID NO:1);
SpHMT1(-)-PCR:
AACTAGTGAATGAGTTTCAGCAGAAGTTTTT(SEQ ID NO:2);
K-SpHMT1(+)-PCR:
AGGATCCACCATGGTTCTACGTTACAACAGCCC(SEQ ID NO:3);
K-SpHMT1(-)-PCR(SEQ ID NO:4):
AACTAGTGAATGAGTTTCAGCAGAAGTTTTT;
The primer of clone SpHMT1 and K-SpHMT1 is to provide synthetic by U.S. English fine horse life technology company limited (Invitrogen).Employing KOD-plus high-fidelity enzyme (Toyobo) system is carried out the RT-RCR reaction and is provided order-checking by Shanghai Sani company.
The extracting method of yeast rna:
Culturing yeast is to (1-5) * 10
8The perhaps bacterium liquid of OD600=0.5.The 12000g centrifugal collecting cell is suspended from the 400 μ L AE damping fluids.The 10%SDS that adds 1/10 volume, Vortex adds equal-volume phenol.Vortex, 65 ℃, 5 minutes.Quick-frozen in the liquid nitrogen (crystal that phenol occurs, 3-5 second), centrifugal 2 minutes of 12000g; Supernatant goes in the new pipe, adds 1/2 volume phenol and 1/2 volume chloroform, following 5 minutes of room temperature.12000g, 10 minutes, supernatant went in the new pipe, added 1/10 volume 3M sodium-acetate (pH4-5) and 2.5 volume dehydrated alcohols, and-20 ℃, 1 hour.13000g 15 minutes, abandons supernatant.70% ethanol is washed once, and is air-dry, is dissolved in the 20 μ L DEPC treated waters, stand-by.
High-fidelity PCR reaction and gel reclaim:
The reaction system of KOD-plus (Toyobo) PCR is 50 μ L:10 * KOD-plus buffer 5 μ L, 25mM MgSO4 4 μ L, 2mM dNTPs 5 μ L, 10 μ M Primer (+), 2 μ L, 10 μ M Primer (-), 2 μ L, cDNA 5 μ L, KOD-plus 1 μ L, aseptic deionized water 26 μ L.The reaction conditions of PCR: 95 ℃, 2 minutes (pre-sex change); 95 ℃, 30 seconds; 58 ℃, 30 seconds; 68 ℃, 2 minutes 30 seconds (34 circulations).
The PCR product is through 1% agarose gel electrophoresis, and under the ultraviolet lamp, the scalpel cutting contains the gel of target DNA band, uses gel to reclaim test kit (Axygen), reclaims DNA (recovery method is with reference to Axygen test kit specification sheets).
The evaluation of ligation, heat shock transformed into escherichia coli competence and positive colony:
The DNA that recovery obtains adds the A reaction.System is 10 μ L, DNA 7.9 μ L, 2mM dATP1 μ L, 10 * Ex Taq
TMDamping fluid (contains 2mM MgSO
4) 1 μ L, Ex Taq
TM0.1 μ L.Add the A reaction conditions: 72 ℃, 20 minutes.
Add the recovery product behind the A, be connected with pGEM-T Easy (Promega) carrier.Linked system: add the recovery product 7 μ L behind the A, pGEM T-Easy 1 μ L, 10 * T
4DNA connects damping fluid 1 μ L, T
4Dna ligase 1 μ L.4 ℃, 12 hours.
Connect product heat shock transformed into escherichia coli competent cell TOP10, conversion fluid is coated the LB flat board that contains 100 μ g/mL penbritins, 37 ℃, 12 hours.Mono-clonal on the picking LB flat board is forwarded in the LB nutrient solution that 2mL contains 100 μ g/mL penbritins, and 37 ℃, 200rpm, 12 hours.Get the 1mL cultured products, use the alkaline lysis method of extracting plasmid, use the BamHI enzyme to cut evaluation, the positive colony sample presentation carries out sequencing (Shanghai Sani company), and the SpHMT1 sequence alignment is errorless in order-checking institute's calling sequence and the ncbi database.
Yeast expression structure and the yeast conversion of recombinant vectors:
The reorganization pGEM-T Easy plasmid (Progema) that sequence is correct carries out BamHI and SpeI double digestion, reclaim target DNA, and connect into the plant binary expression vector 35S/TaPCS1:cmyc-pBI121 that cuts and Adh/TaPCS1:cmyc-pBI121 (utilize the promotor 35S among the Adh promotor replacement 35S/TaPCS1:cmyc-pBI121, thereby obtain Adh/TaPCS1:cmyc-pBI121).The 35S/SpHMT1:cmyc-pBI121 that obtains after the evaluation, 35S/Kozak-SpHMT1:cmyc-pBI121 and Adh/SpHMT1:cmyc-pBI121, Adh/Kozak-SpHMT1:cmyc-pBI121 (replace TaPCS 1cDNA in the carrier by utilizing BamHI and SpeI restriction enzyme site with SpHMT1cDNA or Kozak-SpHMT1, thereby realize the amalgamation and expression of cymc) plasmid BamHI and SacI double digestion, and connect into the Yeast expression carrier pART1 (available from South China Botanical Garden, Chinese Academy of Sciences) that cuts.Connect product heat shock transformed into escherichia coli competence TOP10, conversion fluid is coated the LB flat board that contains 100 μ g/mL penbritins, 37 ℃, 12 hours.Therefore, obtain to have respectively SpHMT1 cDNA+5 ' UTR (being abbreviated as HMT1), the reorganization pART1 carrier of SpHMT1 cDNA+kozak (being abbreviated as KHMT1).
Mono-clonal on the picking LB flat board is forwarded in the LB nutrient solution that 2mL contains 100 μ g/mL penbritins, and 37 ℃, 200rpm, 12 hours.Get the 1mL cultured products, use the alkaline lysis method of extracting plasmid, recombinant plasmid is identified through BamHI and SacI double digestion, positive recombinant plasmid, transform Δ hmt1 mutant LK100 (the responsive phenotype of cadmium is referring to document Heavy metal tolerance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter (1992)) and corresponding wild-type Sp223 (referring to above document).Yeast conversion method reference literature A Simple and Efficient Procedure for Transformation of Yeasts.BioTechniques.13 (1992).
Yeast transformant picking mono-clonal carries out liquid culture, and 28 ℃, 200rpm 12 hours, uses spectrophotometric determination OD
600To 1.Use fresh medium to be diluted to OD
600Be 0.5,28 ℃, 200rpm is cultured to OD
600Be 1.Get the 1mL nutrient solution, centrifugal collection thalline uses the 1mL aseptic deionized water to clean thalline and re-uses the resuspended thalline of 1 * TE (pH7.5).Resuspended liquid is made gradient dilution to OD
600=0.1, OD
600=0.01.Respectively get the resuspended liquid point of 10 μ L and be sowed on the yeast culture flat board of different metal concentration, 28 ℃, leave standstill and cultivated 2-4 days.
Experimental result such as Fig. 1 are at 50 μ M CdCl
2On the flat board, the growth that has transformed the Δ hmt1 mutant LK100 (V/LK100) of empty carrier has been subjected to obvious inhibition, and (KHMT1/LK100 is HMT1/LK100) then at 200 μ M CdCl and transformed the Δ hmt1 mutant LK100 of SpHMT1 gene
2Still can growth and growing way on the flat board and transformed the wild-type yeast (V/Sp223) similar (Figure 1A) of empty carrier.Yeast growth curve experiment (Figure 1B) under more responsive concentration gradient cadmium is coerced has also obtained similar result.
Therefore, the inventor thinks the responsive phenotype of cadmium that the SpHMT1 cDNA that has 5 '-UTR and have a kozak sequence all can complementary Δ hmt1 mutant, wherein contains the SpHMT1 gene pairs Cd of yeast 5 '-UTR itself
2+Resistance more near wild-type.Proved that also c-myc albumen label does not influence the function of fusion rotein, laid a good foundation for SpHMT1 crossing in higher plant expressed.
Transgenic plant (35S:SpHMT1/Col-0; 35S:SpHMT1/cad1-3; Adh:SpHMT1/Col-0) preparation method is specific as follows:
Utilize the plasmid 35S/SpHMT1:cmyc-pBI121 of aforementioned structure to transform wild-type C0l-0 and AtPCS1 deletion mutant cad1-3 respectively.The plasmid Adh/SpHMT1:cmyc-pBI121 of aforementioned structure transforms wild-type Col-0.Arabidopis thaliana method for transformation reference literature Floral dip:a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. (1998)
At transgenic arabidopsis plant 35S:SpHMT1/Col-0, in the cauline leaf and root of Adh:SpHMT1/Col-0 and 35S:SpHMT1/cad1-3, adopt the expression of RT-PCR methods analyst SpHMT1.
The RT-PCR primer sequence:
SpHMT1(+)RT-PCR:TATCTTAAGCAAGAGCGGAAGG(SEQ ID NO:5);
SpHMT1(-)RT-PCR:CTTTAAGCCTCTTTCTCCGACA(SEQ ID NO:6);
AtACT1(+)RT-PCR:CCCTGTTCTTCTTACCGAG(SEQ ID NO:7);
AtACT1(-)RT-PCR:CCACATCTGCTGGAATG(SEQ ID NO:8)。
Primer is to provide synthetic by U.S. English fine horse life technology company limited (Invitrogen).The crt gene of a constitutive expression of AtACT1 (AtActin1) is as the homogenization purposes.
The RT-PCR method:
Vegetable material through liquid nitrogen grinding, uses Trizol test kit (Invitrogen) to extract total RNA.Concrete extracting method is with reference to Trizol test kit specification sheets.
Total RNA handles through DNaseI, and 37 ℃, 30 minutes.Through equal-volume phenol chloroform-chloroform extracting, the 3M sodium-acetate (pH5.2) of 0.1 volume and 2 times of volume dehydrated alcohol precipitations ,-20 ℃, 30 minutes.12000g, 4 ℃, 15 minutes.1mL70% ethanol is washed precipitation once, air-dry 5 minutes, with 30 μ L DEPC treated water dissolution precipitations, obtains not having total RNA of DNA.
Total RNA sample is got 3 μ g, uses the reverse transcription system of M_MLV (Promega) to carry out reverse transcription respectively, and concrete grammar is with reference to the M_MLV of Promega company test kit specification sheets.
The RT-PCR reaction system is 20 μ L:Ex Taq
TMBuffer (10 *) is 2 μ L (Takara), 25mM dNTPs1.6 μ L, Ex Taq
TMEn 0.1 μ L, 20 μ M Primer (+), 0.5 μ L, 20 μ M Primer (-), 0.5 μ L, cDNA template 0.5 μ L, aseptic deionized water 14.8 μ L.
The reaction conditions of RT-PCR: 95 ℃, 2 minutes (pre-sex change); 95 ℃, 15 seconds; 58 ℃, 30 seconds; 72 ℃, 40 seconds (Atactin25 circulation, 30 circulations of SpHMT1 gene).
PCR instrument: GeneAmp
@PCR System 9700 (Applied Biosystems).
The result is as shown in Figure 2: all detect the gene less than SpHMT1 in the cauline leaf of contrast wild-type Col-0 and root.The SpHMT1 gene in the cauline leafs of 35S:SpHMT1/Col-0 and 35S:SpHMT1/cad1-3 transgenic plant and root, all express (Fig. 2 A, B); In the root of Adh:SpHMT1/Col-0 transgenic plant, express and do not express in the cauline leaf (Fig. 2 C, D).Whether whether the interpolation of Kozak sequence expressed irrelevant with gene.
Therefore, the inventor has successfully expressed yeast genes SpHMT1 in Arabidopis thaliana, and this also is this vacuole skin translocator HMT1 gene expressing in higher plant of success for the first time.Utilize CaMV 35S promoter and Adh promotor to realize that respectively of overall importance the and root-specific of gene crosses expression, for the application of this gene in higher plant laid a good foundation.
The dull and stereotyped experiment of heavy metal resistance:
Transgenic plant T3 generation and corresponding contrast vertically are incubated on the 1/4 * MS flat board that adds the different concns heavy metal after the seed-coat sterilization, grow about 4 week the back it is taken pictures and observe and add up fresh weight.
The mensuration of heavy metal content:
After heavy metal was handled, vegetable material washed twice with deionized water earlier, and each 4min uses 25mMCaCl then
2(PH4-5) wash twice, each 4min cleans up in the water of Milli-Q at last.80 ℃, 48 hours.The weighing dry weight adds 1mL 70% nitric acid (MOS level), leaves standstill 12 hours.99 ℃, nitre solution 2 hours is cooled to room temperature, and Milli-Q water is diluted to 14mL.ICP-MS (Perkin-Elmer ELAN DRC-e) working sample heavy metal content.
Can express SpHMT1 strengthen it to the resistance of heavy metal excessively in plant in order to study, and vertically is incubated at after the 35S:SpHMT1/Col-0 transgenic plant seed surface sterilization that evaluation obtains to add 50 μ M CdCl
2Flat board on, about 4 week backs are observed and found that transgenic plant are than better (Fig. 3 A) of wild-type Col-0 growth: their leaf is bigger greener, and root also longer and fresh weight is significantly higher than contrast (Fig. 3 E).In addition to the seedling in 4 weeks of water planting with 10 μ M CdCl
2After handling 7d, find that the chlorophyll content of transfer-gen plant is significantly higher than contrast.And at the seedling of common 1/2 * MS plate growth 7d, the phenotype of transgenic plant and fresh weight all with contrast no marked difference.Expressing SpHMT1 can strengthen it to the resistance of heavy metal cadmium to proof really excessively in Arabidopis thaliana.Use the same method and detected the resistance of transfer-gen plant to other heavy metals, find adding 150 μ MKH
2AsO
4(Fig. 3 B), 40 μ M CuSO
4(Fig. 3 C) or 150 μ M ZnSO
4On the heavy metal flat board of (Fig. 3 D), the growing way of transfer-gen plant and fresh weight (Fig. 3 E) all are better than contrast.Therefore as seen, mistake is expressed yeast genes SpHMT1 and can be strengthened plant to the resistance of some heavy metals of comprising cadmium in the wild-type Arabidopis thaliana.
In order to study the mechanism of action of SpHMT1 in plant, the inventor detects the content of the heavy metal of plant in Fig. 3 resistant panel.After being converted to fresh weight, the cadmium concentration in the 35S:SpHMT1/Col-0 transgenosis seedling is significantly higher than contrast.In 2 transgenic lines that detect, Cd
2+Concentration be respectively the contrast 139% and 142% (Fig. 3 F).And because shown in Fig. 3 E, Cd
2+The fresh weight of coercing down transgenic plant is higher than contrast, so the Cd in the transgenic plant seedling
2+Content also is significantly higher than contrast, approximately is 1.7-1.9 times of contrast.Similar with the situation of cadmium, the arsenic in the 35S:SpHMT1/Col-0 transgenosis seedling, copper and zinc concentration and content also are significantly higher than contrast (Fig. 3 F).Therefore as seen, SpHMT1 can strengthen resistance and the accumulation of heavy metal in plant, by heavy metal is effluxed may not be to realize by heavy metal or its mixture are transported into the storage of organs such as vacuole.
For the detoxifcation mechanism of further research SpHMT1 whether with gsh (Glutataione, be called for short GSH) or phytochelatin (Phytochelatins, be called for short PCs) relevant, the inventor handles transgenic plant with GSH inhibitor fourth methyllanthionine-sulphoxide imine (L-buthionine sulfoximine is called for short BSO).With the 35S:SpHMT1/Col-0 transfer-gen plant on the 1/4 * MS flat board that has added 0.5mM BSO vertical cultivate 20 days after, find that plant-growth is subjected to some inhibition, but transfer-gen plant and contrast (Col-0) do not have marked difference (Fig. 4 B, C).And add 10 μ M CdCl at the same time
2On 1/4 * MS flat board of 0.5mM BSO, also similar (Fig. 4 A, C), namely transgenic plant are lost the resistance of heavy metal cadmium with contrast for the phenotype of transgenic plant and fresh weight.In addition, the inventor also detects the ripening stage seedling: water planting 4 all seedlings, and with 10 μ M CdCl
2After handling 3 days with 0.25mM BSO, measure its root respectively, the content of cadmium in stem and the lotus throne leaf.Be converted to after the dry weight, transgenic plant the cadmium concentration of each several part all with contrast no significant difference (Fig. 4 D).These results have illustrated that ability that SpHMT1 strengthens the resistance of heavy metal cadmium and accumulation all is subjected to the inhibition of BSO, the effect of prompting SpHMT1 and GSH or rely on that it is relevant for the PCs that substrate synthesizes.
Because BSO has suppressed the synthetic of GSH and PCs simultaneously, for the effect of further studying SpHMT1 depends on GSH or PCs actually, perhaps Zhuan Yun substrate is based on which, and the inventor crosses expression SpHMT1 at PCs deletion mutant cad1-3.According to reference Cadmium-sensitive, cad1mutants of Arabidopsis thaliana are phytochelatin deficient (1995) report, the cad1-3 mutant is the afunction mutant of an Arabidopis thaliana AtPCS1 gene, wherein detects the content less than PCs.As the method for describing in the preamble, the inventor has observed resistance and the accumulation of 35S:SpHMT1/cad1-3 transfer-gen plant to heavy metal cadmium.Find no matter be at the seedling of common 1/2 * MS plate growth 7d, still adding 5 μ M CdCl
2Resistant panel on the growth 20d seedling, the phenotype of transgenic plant 35S:SpHMT1/cad1-3 (Fig. 5 A, B) and fresh weight (Fig. 5 C) all do not have significant difference with adjoining tree cad1-3, illustrate that SpHMT1 cross expressing in Arabidopis thaliana PCs deletion mutant cad1-3 can not strengthen heavy metal resistance.Cadmium content to the dull and stereotyped seedling among Fig. 5 A and the B is measured, and finds cadmium content and adjoining tree (PCs deletion mutant cad1-3) the no significant difference (Fig. 5 D) of 35S:SpHMT1/cad1-3 transfer-gen plant in the cadmium flat board.
In sum, the expression of SpHMT1 in the wild-type Arabidopis thaliana can strengthen plant to resistance and the accumulation of heavy metal cadmium, copper, zinc and arsenic etc., and it is then inoperative to cross expression SpHMT1 in cad1-3, therefore points out the effect of SpHMT1 to depend on PCs.
Embodiment 4, PCs stride in the vacuole skin transport process at heavy metal cadmium and play a part core
In the present embodiment, determine that for further whether the heavy metal resistance enhancing of SpHMT1 mediation is owing to change over to and be stored in more PCs-Cd mixture in the vacuole, and whether the cadmium transporting pathway of research PCs mediation accounts for the principal status of public economy in the detoxifcation mechanism of Arabidopis thaliana Cadmium resistance, the inventor has separated Col-0 and cad1-3, and their corresponding SpHMT1 cross the protoplastis of expressing plant and vacuole and to wherein concentration and the existence of cadmium detect.
The vacuole extracting method:
The seedling in 2 weeks of earth culture is with CdCl
2Handle a week, namely use 500ml 40 μ M CdCl
2Solution waters seedling twice.Getting not, the lotus throne leaf of bolting seedling extracts protoplastis.The gained protoplastis is divided into two five equilibriums, one is used for the detection of cadmium and PCs content, and another part is used according to the method for reference Isolation of intact vacuoles from Arabidopsis rosette leaf-derived protoplasts (2007) and extracted vacuole.Under light microscopic, observe to extract the vacuole that obtains, find purity>95% and do not have the pollution of protoplastis.The enzyme that detects chlorophyll content and cytopigment enzyme C oxydase (COX) and acid phosphatase (ACP) in protoplastis and vacuole is lived (enzyme of GenMed Sci Inc company assay kit alive) to identify the purity of vacuole.
The PCs Determination on content:
The content of PCs and GSH is measured with fluorescence HPLC (Agilent 1200 series) in the Cd processing plant vacuole, use used anti-phase C18 post (Agilent 300Extend-C18 4.6 * 150mm, 3.5 μ m particle size) among the reference Separation and quantification of monothiols and phytochelatins from a wide variety of cell cultures and tissues of trees and other plants using high performance liquid chromatography (2008).Thiol group carries out fluorescent mark according to the method for reference Long-distance root-to-shoot transport of phytochelatins and cadmium in Arabidopsis (2003) with monobromobimane.The standard substance PC2 of PCs, PC3 and PC4 are synthetic from AnaSpec company.The GSH standard substance are available from sigma company.Cadmium in the vacuole, PCs and GSH content are the stdn index with the enzyme work of vegetable acid acid phosphatase (ACP) all.
The result as shown in Figure 6, no matter be the 35S:SpHMT1/Col-0 transgenic plant or in wild-type Col-0, the cadmium of the overwhelming majority all is stored in the vacuole, and the ratio of cadmium content in vacuole and the protoplastis (V/P ratio) is respectively 101.39% ± 1.02% and 97.49% ± 1.53%.Yet cadmium content all is significantly higher than Col-0 in the protoplastiss of 35S:SpHMT1/Col-0 transgenic plant and vacuole.
On the other hand, the PCs in the 35S:SpHMT1/Col-0 transgenic plant vacuole (comprising PC2, PC3 and PC4) content all is higher than the wild-type plant, as Fig. 7.Therefore, though the expression of SpHMT1 does not almost increase the V/P ratio, strengthened the ability to vacuole transhipment and accumulation cadmium of PCs mediation, thereby strengthened plant to resistance and the accumulation of heavy metal.
On the other hand, the cadmium content in cad1-3 mutant and transgenic plant protoplastis and the vacuole does not have significant difference, as Fig. 6.Although Cd is similar and well below wild-type Col-0 in cad1-3 and 35S::SpHMT1/cad1-3 transgenic plant at the partition rate inside and outside the vacuole, but still having 35.09% ± 0.21% and 35.14% ± 0.41% cadmium to be stored in the vacuole respectively, may be with forms such as GSH-Cd or Cd-S.Though plant still can be transported cadmium into the vacuole storage after this ratio had also hinted disappearance PCs, ratio is lower, and this may also be the reason of the cadmium hypersensitization of cad1-3.
Therefore, the inventor thinks in Arabidopis thaliana cadmium detoxifcation mechanism, the approach that cadmium is mediated in the vacuole with the form of PCs-Cd in the highest flight, i.e. the effect of PCs not only is confined to chelating, more is transhipment and the storage to vacuole with Cd.Though and the expression of SpHMT1 does not almost increase the V/P ratio, strengthened to the ability of vacuole transhipment and accumulation cadmium, thereby strengthened plant to resistance and the accumulation of heavy metal cadmium.
The root-specific of embodiment 5, SpHMT1 is expressed the cadmium content that can reduce in over-ground part and the seed
Because the expression of overall importance of 35S promoter has limited the practicality of transgenic plant, the carrier under the inventor regulates and control the gene constructed root specific expression promoter Adh of going into of SpHMT1 also transforms Col-0 (Adh:SpHMT1/Col-0).As shown in Figure 8, CdCl
2Handle down, Adh:SpHMT1/Col-0 transgenic plant lotus throne leaf content of chlorophyll is higher than Col-0, i.e. the transgenosis of the different expression of Gent has also strengthened plant to Cd
2+Tolerance.As shown in Figure 9,4 all water planting seedlings are with 10 μ M CdCl
2After handling 3d, compared with the control, the Adh:SpHMT1/Col-0 transgenic plant accumulate more cadmium in root, and the over-ground part cadmium is then far below contrast (Fig. 9 A).In order to detect cadmium content in the seed, the inventor with the water planting seedling of firm bolting with 5 μ M CdCl
2Long-term disposal is measured and is found that cadmium content is higher than contrast Col-0 in the 35S:SpHMT1/Col-0 transgenic plant seed until seed maturity, and cadmium content then significantly reduces (Fig. 9 D) in the Adh:SpHMT1/Col-0 transgenic plant seed.Use the same method and transgenic seedling carried out the processing of copper and arsenic, find copper in transgenic seedling over-ground part and the seed and arsenic content also significantly be lower than wild-type (Fig. 9 B, C, E, F).These presentation of results, the root-specific express transgenic plant of SpHMT1 can be limited in root with heavy metals such as more cadmium, copper and arsenic, thereby has reduced the heavy metal content in over-ground part and the seed.
As shown in Figure 8,10 μ M CdCl
2Handle after 7 days, plant lotus throne leaf content of chlorophyll all reduces, and the chlorophyll content of the transfer-gen plant that root-specific is expressed is significantly higher than wild-type (Control, Col-0), illustrate that the result who expresses with mistake of overall importance is consistent, the root-specific of SpHMT1 is expressed the tolerance that also can strengthen the heavy metal cadmium of Col-0.Can reduce chlorophyll content because Cd coerces, so chlorophyll content is acknowledged as the detection plant to an important indicator (reference: Van Assche F and ClijstersC. (1990) Effects of metals on enzyme activity in plants.Plant Cell Environ.13:195-206 of Cd tolerance; Somashekaraiah, B.V., Padmaja, K., Prasad, A.R.K. (1992) Phytotoxicity of cadmium ions on germinating seedlings of mung bean (Phaseolus vulgaris): involvement of lipid peroxides in chlorophyll degradation.Plant Physiol.85:85-89.).
On the other hand, specific expressed under the driving of CAB2 promotor (preparation of transgenic plant is the same in the Arabidopis thaliana over-ground part with SpHMT1 for the inventor, difference is the promotor 35S in the 35S/SpHMT1:cmyc-pBI121 plasmid is replaced with the CAB2 promotor, CAB2 promotor reference An improved grafting technique for mature Arabidopsis plants demonstrates long-distance shoot-to-root transport of phytochelatins in Arabidopsis.Plant Physiol (2006)), obtain the CAB2:SpHMT1/Col-0 transgenic arabidopsis.As shown in figure 10,4 all water planting seedlings are with 10 μ M CdCl
2After handling 3d, compared with the control, the CAB2:SpHMT1/Col-0 transgenic plant accumulate more cadmium in the lotus throne leaf, and cadmium then significantly is lower than contrast (Figure 10 A) in the root.In order to detect cadmium content in the seed, the inventor with the water planting seedling of firm bolting with 5 μ M CdCl
2Long-term disposal measures and find that cadmium content all is higher than contrast Col-0 in CAB2:SpHMT1/Col-0 and the 35S:SpHMT1/Col-0 transgenic plant seed, and cadmium content does not have marked difference (Figure 10 B) in these two kinds of transgenic plant seeds until seed maturity.The specific over-ground part that is expressed in of SpHMT1 may be worked in phytoremediation.
Wish in the phytoremediation to obtain to the heavy metal tolerance by force and multi-metal more can be accumulated plant in over-ground part, then wishing during food crop etc. produce can be with more heavy metal control at root, thereby reduces its content in part fruit and the seed on the ground.Therefore, the root-specific of SpHMT1 gene is expressed has actual application value, can be applicable to the improvement of plant variety, lower the content of heavy metal such as cadmium in the plant edible position, for the higher new crop varieties of exploitation security has improved new genetic resources and working method.The over-ground part of SpHMT1 gene is specific expressed also to have actual application value, can be used for phytoremediation etc.
In sum, the inventor crosses expression yeast juice vacuolar membrane translocator SpHMT1 gene by dystopy in Arabidopis thaliana, the function of research SpHMT1 in plant, and explore status and the effect of PCs transporting pathway in cadmium detoxification mechanism.Transgenic plant obviously strengthen resistance and the accumulation ability of various heavy such as cadmium, zinc, copper, arsenic, and this effect is subjected to the inhibition of BSO.And it is inoperative to cross expression SpHMT1 in the mutant cad1-3 of PCs disappearance, illustrate that the effect of SpHMT1 in plant depends on the synthetic of PCs, and namely mainly to transport substrate under the situation that the PCs approach is arranged should be PCs-Cd but not GS to SpHMT1
2-Cd.
In addition, in wild-type, the cadmium in the protoplastis almost 100% accumulates in vacuole, and this ratio has only about 35% among the cad1-3, and the hypersensitization phenotype that the cadmium of cad1-3 is described mainly is because the cadmium mixture can not effectively be transported in the vacuole.Illustrate also simultaneously at higher plant body weight metal and stride in the vacuole skin transhipment that PCs and GSH all work, but PCs accounts for core status.The inventor shows by gene engineering method simultaneously, utilize the orientation expression of SpHMT1, heavy metals such as more cadmium can be deposited in root, thereby can effectively reduce heavy metal lowers content from heavy metal such as cadmium in the plant edible position to the migration at edible position, for the higher new crop varieties of exploitation security provides new genetic resources and working method.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Claims (12)
1. the purposes of a vacuole skin translocator HMT1 is used for improving plant to the chlorophyll content of plant under the tolerance of heavy metal, the fixed direction allocation of regulating heavy metal or the raising heavy metal stress.
2. purposes as claimed in claim 1 is characterized in that, described vacuole skin translocator HMT1 is used for transporting heavy metal in the vacuole of vegetable cell.
3. purposes as claimed in claim 1 is characterized in that, described heavy metal comprises: cadmium, arsenic, copper or zinc.
One kind improve plant for the tolerance of heavy metal, regulate heavy metal accumulation degree in the plant tissue or improve the method for the chlorophyll content of plant under the heavy metal stress, it is characterized in that described method comprises: in plant, express vacuole skin translocator HMT1.
5. method as claimed in claim 4 is characterized in that, described method comprises: the expression cassette of vacuole skin translocator HMT1 is changed in the plant, thereby express vacuole skin translocator HMT1 in plant.
6. method as claimed in claim 5 is characterized in that, described method comprises:
(1) provide the Agrobacterium of carrying expression vector, described expression vector contains the expression cassette of vacuole skin translocator HMT1;
(2) vegetable cell or tissue or organ are contacted with Agrobacterium in the step (1), thereby make the expression cassette of vacuole skin translocator HMT1 change vegetable cell over to, and be incorporated on the karyomit(e) of vegetable cell;
(3) select vegetable cell or tissue or the organ of the expression cassette that has changed vacuole skin translocator HMT1 over to; With
(4) vegetable cell in the step (3) or tissue or neomorph are become plant.
7. method as claimed in claim 4 is characterized in that, heavy metal accumulation degree methods comprises in the described adjusting plant tissue:
The expression cassette of vacuole skin translocator HMT1 is changed in the plant, and the expression cassette of this vacuole skin translocator HMT1 comprises the promotor of operability connection, the polynucleotide of coding vacuole skin translocator HMT1;
Wherein, described promotor is plant particular organization specific expressing promoter, expresses in plant particular organization thereby drive vacuole skin translocator HMT1, promotes heavy metal to transport into this plant particular organization.
8. method as claimed in claim 7 is characterized in that, described plant is the plant that comprises edible tissues, and described promotor is the non-edible tissue specific expressing promoter of plant, thereby heavy metal is transported non-edible tissue into plant.
9. method as claimed in claim 8 is characterized in that, described non-edible tissue specific expressing promoter is the roots of plants specific expressing promoter;
Preferably, described root-specific expression promotor comprises: Adh promotor, NT1 promotor, ZmGLU1 promotor.
10. method as claimed in claim 7 is characterized in that, described promotor is the specificity promoter that plant shoot divides tissue.
11. the expression cassette of a vacuole skin translocator HMT1, it comprises the promotor of operability connection, the polynucleotide of coding vacuole skin translocator HMT1; Wherein, described promotor is plant particular organization specific expressing promoter.
12. the purposes of the expression cassette of the described vacuole skin translocator of claim 11 HMT1 is used for regulating plant tissue heavy metal accumulation degree, promotes heavy metal to transport into this plant particular organization.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2011104541760A CN103184237A (en) | 2011-12-29 | 2011-12-29 | Method for improving plant heavy metal tolerance and regulating heavy metal oriented distribution |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2011104541760A CN103184237A (en) | 2011-12-29 | 2011-12-29 | Method for improving plant heavy metal tolerance and regulating heavy metal oriented distribution |
Publications (1)
Publication Number | Publication Date |
---|---|
CN103184237A true CN103184237A (en) | 2013-07-03 |
Family
ID=48675683
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2011104541760A Pending CN103184237A (en) | 2011-12-29 | 2011-12-29 | Method for improving plant heavy metal tolerance and regulating heavy metal oriented distribution |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103184237A (en) |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105274121A (en) * | 2015-12-04 | 2016-01-27 | 中国林业科学研究院亚热带林业研究所 | Gene capable of promoting cadmium accumulation and application of gene |
CN106939037A (en) * | 2016-01-05 | 2017-07-11 | 中国科学院植物研究所 | Cadmium resistance GAP-associated protein GAP is in the Cadmium resistance of regulation and control plant and to the application in Cadmium accumulation |
CN114246080A (en) * | 2021-12-16 | 2022-03-29 | 桂林理工大学 | Method for regulating and controlling influence of heavy metal absorption and transportation by plants through mineral elements |
-
2011
- 2011-12-29 CN CN2011104541760A patent/CN103184237A/en active Pending
Non-Patent Citations (8)
Title |
---|
D F ORTIZ ET.AL.: "Heavy metal tolerance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter", 《EMBO J.》 * |
JUNKO KYOZUKA ET.A: "Anaerobic induction and tissue-specific expression of maize Adh1 promoter in transgenic rice plants and their progeny", 《MOLECULAR AND GENERAL GENETICS》 * |
RILIANG GU ET.AL.: "Isolation of a maize beta-glucosidase gene promoter and characterization of its activity in transgenic tobacco", 《PLANT CELL REPORTS》 * |
唐亚雄: "利用裂殖酵母体系,拟南芥盐胁迫应答相关基因的克隆、鉴定及转基因分析", 《中国优秀博硕士学位论文全文数据库(博士)基础科学辑》 * |
张军 等: "植物对重金属镉的耐受机制", 《植物生理与分子生物学学报》 * |
张玉秀 等: "植物对重金属镉的吸收转运和累积机制", 《中国生态农业学报》 * |
曲波: "烟草根特异性启动子TobRB7的分离及克隆", 《吉林农业科技学院学报》 * |
杨明峰 等: "植物盐胁迫相应基因表达的器官组织特异性", 《植物生理学通讯》 * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN105274121A (en) * | 2015-12-04 | 2016-01-27 | 中国林业科学研究院亚热带林业研究所 | Gene capable of promoting cadmium accumulation and application of gene |
CN106939037A (en) * | 2016-01-05 | 2017-07-11 | 中国科学院植物研究所 | Cadmium resistance GAP-associated protein GAP is in the Cadmium resistance of regulation and control plant and to the application in Cadmium accumulation |
CN106939037B (en) * | 2016-01-05 | 2020-06-23 | 中国科学院植物研究所 | Application of cadmium-resistant related protein in regulation and control of cadmium resistance of plant and accumulation of cadmium |
CN114246080A (en) * | 2021-12-16 | 2022-03-29 | 桂林理工大学 | Method for regulating and controlling influence of heavy metal absorption and transportation by plants through mineral elements |
CN114246080B (en) * | 2021-12-16 | 2022-12-06 | 桂林理工大学 | Method for regulating and controlling influence of heavy metal absorption and transportation by plants through mineral elements |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104204208B (en) | Improve the pectinesterase of plant drought resistance | |
US9738900B2 (en) | Transgenic plants expressing a pH-sensitive nitrate transporter | |
US9745596B2 (en) | Identification and use of KRP mutants in wheat | |
CA2861032C (en) | Improving drought resistance in plants: upl3 | |
US10961545B2 (en) | Drought resistance in plants: UPL4 | |
WO2017107983A1 (en) | Method for increasing nitrogen-use efficiency in plants | |
CN102498125A (en) | Regulation of zinc deficiency and tolerance in plants | |
WO2023065966A1 (en) | Application of bfne gene in tomato plant type improvement and biological yield increase | |
CN103966254A (en) | Transcription factor capable of being used to adjust plant traits | |
CN103184237A (en) | Method for improving plant heavy metal tolerance and regulating heavy metal oriented distribution | |
CN103374062B (en) | OsVIT1 and OsVIT2 gene and improve the application of iron Zn content in rice paddy seed | |
CN107663232B (en) | Plant anti-adversity associated protein OsIAA18 and its encoding gene and application | |
CN103172716A (en) | Heat-resistant plant gene and application thereof | |
KR102127184B1 (en) | Use of AK102606 gene from Oryza sativa as regulator of antioxidant activity, environmental stresses and crop yield | |
CN102732553A (en) | Gene engineering method and material for increasing plant yield | |
CN114457096A (en) | Improved plants containing combinations of apyrase genes and methods for making the same | |
CN103254293B (en) | Tonoplast localization sequence and its application | |
CN104561040A (en) | Plant heat-resistant gene HTT3 and application thereof | |
US20120185976A1 (en) | Aluminium tolerant barley | |
WO2024008763A2 (en) | Orobanche resistant plants | |
CN115772536A (en) | Application of SsRMT4 gene in regulation and control of plant drought resistance | |
CN117327719A (en) | Isolated polynucleotide, liCIIN 2 protein encoded by same and application thereof | |
AU2005259842B2 (en) | Aluminium tolerant barley | |
Wegener | Inheritance of a pectate lyase mediated soft rot resistance in crosses between transgenic potato lines of cv. désirée and S. tuberosum cultivars |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C12 | Rejection of a patent application after its publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130703 |