CN103173455A

CN103173455A - Goose-origin gene RIG-I (retinoic acid-inducible gene-I) with anti-Newcastle disease virus activities and application thereof

Info

Publication number: CN103173455A
Application number: CN2012102818951A
Authority: CN
Inventors: 丁铲
Original assignee: Shanghai Veterinary Research Institute CAAS
Current assignee: Shanghai Veterinary Research Institute CAAS
Priority date: 2012-08-09
Filing date: 2012-08-09
Publication date: 2013-06-26
Anticipated expiration: 2032-08-09
Also published as: CN103173455B

Abstract

The invention provides a goose-origin gene RIG-I (retinoic acid-inducible gene-I) with anti-Newcastle disease virus activities and an application thereof. According to the goose-origin gene RIG-I and the application of the goose-origin gene RIG-I, mRNA (Messenger Ribonucleic Acid) sequences of the goose-origin gene RIG-I are amplified based on a duck-origin gene RIG-I, and the homology of the goose-origin gene RIG-I and the duck-origin gene RIG-I is found to reach 93.8%; heterogenously-expressed gRIG-I is proved to be capable of expressing an anti-NDV (Newcastle disease virus) effect after over-expressing transfection cells of the full-length gRIG-I (gRIG-I full) and a gRIG-I CARD structural domain (gRIG-I CARD); the gRIG-ImRNA levels are detected by respectively infecting primary-culture geese embryo fibroblasts (GEF) and 2-week Yangzhou geese by utilizing three NDV viruses; the gRIG-ImRNA levels are found to averagely rise after the GEFs are infected by the NDV; and after being infected by the NDV, the gRIG-ImRNA levels in tissues of lungs and air sacs of the geese averagely rise, and the virus growths in in-vitro and in-vivo experiments are all restrained.

Description

A kind of goose source gene RIG-I and application thereof with anti-new castle disease virus activity

Technical field

The invention belongs to biological technical field, be specifically related to a kind ofly have the active goose source gene order of anti-new castle disease virus (Newcastle disease virus, NDV), and the application of this gene.

Background technology

Newcastle disease is a kind of transmissible disease that bird is had hyperinfection and lethality, is the birds of susceptible due to chicken, so should disease often cause huge loss to aviculture.This disease causes by Avian pneumo-encephalitis virus (Newcastle disease virus, NDV), and NDV is the member of paramyxovirus section Rubulavirus, for sub-thread minus strand non-segmented negative has the cyst membrane RNA viruses.

Pattern recognition receptors (pattern recognition receptors, PRR) be the radical natural immune system in place, can identify the multiple-microorganism composition, as nucleic acid of virus etc., start rapidly the multi-signal cascade reaction, synthetic a series of cytokine comprises I type Interferon, rabbit and inflammatory cytokine, plays an important role in antiviral innate immunity.Wherein, RIG-I sample acceptor (RIG-I like receptor, RLR) is that a class exists the PRR (comprise RIG-I, MDA5, LGP2) interior with born of the same parents, the main identification RNA viruses of being responsible for, and the activation signal path produces I type IFNs and inflammatory cytokine.

Goose as a kind of important economic animal, all has raising in China various places in China.Although goose constantly has the report that newcastle disease occurs in recent years as aquatic bird, with respect to the Lu Sheng bird, it has stronger resistibility to NDV, but also less to its antiviral geneogenous immune Research.Goose whether exist RLR with and whether bring into play biological function and unclear.

The present invention increases to the RIG-I gene of goose first, and pass through goose RIG-I transfection 293T and DF1 cell, the impact that observation copies NDV, and the variation that NDV infects the goose endogenous RIG-I cause is detected, find that goose RIG-I has certain effect in anti-NDV innate immunity.

Summary of the invention

The object of the present invention is to provide a kind of goose source anti-new castle disease virus gene RIG-I that has.

A further object of the present invention is the application of anti-new castle disease virus gene RIG-I.

In order to realize the object of the invention, a kind of goose source anti-new castle disease virus gene RIG-I that has of the present invention, the sequence of its goose source gene RIG-I mRNA as shown in SEQ ID No.1, total length 2805bp.

Wherein, the present invention is by the albumen of described gene RIG-I coding, and its aminoacid sequence is as shown in SEQ ID No.2.

Has the nucleotide sequence of goose source anti-new castle disease virus gene gRIG-I structural domain (gRIG-I CARD) as shown in SEQ ID No.3.

By the albumen of described gene gRIG-I structural domain (gRIG-I CARD) coding, its aminoacid sequence is as shown in SEQ ID No.4.

The RIG-I nucleotide sequence, as shown in SEQ ID No.1:

atgacggcggacgagaagcggagcctgcagtgctaccggcggtacatcgagcggagcctcaaccccgtctacgtgctgggcaacatggcggactggctgcccgacgagctgcgggagaggatccgcaaggaggaggagaggggggtgagcggcgccgccgcgctctttctggacgccgtcctgcagctggaggcccgcggctggttccgagggatgctggacgcaatgctggccgcaggtcacacaggactggcagaagcaattgagaactgggacttcagcaaactggaaaaactggagttacacagacagctgttgaagcggatagaggcaacaatgttagaagtcgacccagtagtgctcattccctacataaacacctgcctgatagacagggagtgcgaagagattcagcagattagtgaaagcagaagcaaagcagcaggcataactaaactcattgaatgtctctgtcggtcggataaggagcactggccaaaaagccttcagctggcactagataacacaggatattaccgtgcaagtgaactgtgggatatgagagaagataatgccaaagatgttgacagtgaaatgacagatgcctctgaggactgccttgaaacaagtatgacatattctgaagaagcagaacctgatgataatctcagtgaaaatcttggttcagctgcagaaggaattgacaagcctccacctgtctatgaagcaaagaaggcccggagctaccagattgaacttgcacagcctgctatcaatgggaaaaatgccttaatatgtgcccctactggatctggaaaaactttcatcgcgcttctggtttgtgaacaccatttccaaaacatgcctgcaggacgaaaggggaaagttgtatttcttgcaacaaaagtcccagtgtatgaacaacagaaaaatgtcttcaagcaacattttgaaagacaaggatattccattcaaggagttagtggtgaaaatttttcaaatgtctctgtagaaaatgttatagaggacaatgacatcatcgtactgacaccccagatcctggtgaatagcttcgaggatgggacccttacctccctctctgttttcactctgatgatattcgatgagtgccacaacactacaggcaaccacccttacaatgtgttaatgaccaggtatctggagcagaaatttaactcccctgcaagtcagctgccacagattttaggtttgactgcttctgttggagttggtaatgccaagaacattgaggaaacaatagagcacatctgtagtctctgctcctaccttgatatacaggccatatccactgtcagagagaacatacaagacctgcaaaggttcatgaacaagccagaaatagatgtcagattggttaagaggcgagttcacaatcactttgcagtcattatctcagatttgatgtccgagacagaggcactgatgaggaagatttactcagtgggtactgtctcccaaaacagcaggaaagattttggaacacagaaatatgaacactggatagttgtcactcagaggaaatgcagactgttgcaactagaagacaaggaggaggagagcaggatatgtagagcccttttcatttgcactgaacacctgcggaaatacaatgatgccctcatcatcagtgaagatgcccgcatcatagatgctctatcctacctgaccgagtttttcacaaatgtcaagaatggaccatacacagaattagaacagcacctgacagccaaatttcaagagaaagaaccagaactgactgccctttcaaaagacgaaacaaatgagaatcctaaactggaagagcttgcctgcatcctggatgatgcatactgctataacccacagactcgcactcttctctttgctaagacaagagccttagtagctgctttgaagaagtgtatggaggaaaaccctatccttagctacataaagccagatgttttgatggggcgcggaagaagagatcaaaaaacaggtatgaccctcccaagccagaagggtgtactggatgcgttcaaaaccagcaaggacagcaggctgctcatagctacatccgttgctgatgaaggcattgatattgcccagtgcaaccttgttgtgctctatgaatactccggtaatgtgaccaaaatgatccaagtcagaggtcgtggaagggcagcaggcagcaagtgcatccttgtgacaagcaaaacagaagtggttgagaatgaaaaatgcaaccgttataaggaagaaatgatgaataaagctattgaaaagctccaggaatgggatgaagaaacatttgcaaaaaagatacataacctgcaaatgaaggaaaaggtgttacgagattccaggaagaaagaaataaaacctaaagtagtggaaggccagaagaacctcctgtgtggaaaatgcaaagcatatgcctgcagtacagatgacatcagaattataaaggaatctcatcacgttgtcctaggagaagcattcaaggagcgttatataacaaagcctcataagaaaccaatgcagtttgatggttttgagaaaaaaagcaagatgcattgccgaaataataattgccagcatgactggggaatcacagtgaagtacctgacatttgacaatctacccgtgatcaaaatcaaaagcttcgtagtgcagagtgctgcaaccgggacacaaatggactttcagagatggaaaagtattaattcttctttgaagaattttgatgttgaagaaatgtccaacttgtacccaccattttag

The RIG-I aminoacid sequence is as shown in SEQ ID No.2:

MTADEKRSLQCYRRYIERSLNPVYVLGNMADWLPDELRERIRKEEERGVSGAAALFLDAVLQLEARGWFRGMLDAMLAAGHTGLAEAIENWDFSKLEKLELHRQLLKRIEATMLEVDPVVLIPYINTCLIDRECEEIQQISESRSKAAGITKLIECLCRSDKEHWPKSLQLALDNTGYYRASELWDMREDNAKDVDSEMTDASEDCLETSMTYSEEAEPDDNLSENLGSAAEGIDKPPPVYEAKKARSYQIELAQPAINGKNALICAPTGSGKTFIALLVCEHHFQNMPAGRKGKVVFLATKVPVYEQQKNVFKQHFERQGYSIQGVSGENFSNVSVENVIEDNDIIVLTPQILVNSFEDGTLTSLSVFTLMIFDECHNTTGNHPYNVLMTRYLEQKFNSPASQLPQILGLTASVGVGNAKNIEETIEHICSLCSYLDIQAISTVRENIQDLQRFMNKPEIDVRLVKRRVHNHFAVIISDLMSETEALMRKIYSVGTVSQNSRKDFGTQKYEHWIVVTQRKCRLLQLEDKEEESRICRALFICTEHLRKYNDALIISEDARIIDALSYLTEFFTNVKNGPYTELEQHLTAKFQEKEPELTALSKDETNENPKLEELACILDDAYCYNPQTRTLLFAKTRALVAALKKCMEENPILSYIKPDVLMGRGRRDQKTGMTLPSQKGVLDAFKTSKDSRLLIATSVADEGIDIAQCNLVVLYEYSGNVTKMIQVRGRGRAAGSKCILVTSKTEVVENEKCNRYKEEMMNKAIEKLQEWDEETFAKKIHNLQMKEKVLRDSRKKEIKPKVVEGQKNLLCGKCKAYACSTDDIRIIKESHHVVLGEAFKERYITKPHKKPMQFDGFEKKSKMHCRNNNCQHDWGITVKYLTFDNLPVIKIKSFVVQSAATGTQMDFQRWKSINSSLKNFDVEEMSNLYPPF

The present invention further comprises the transfer vector plasmid of described gene RIG-I.

The present invention also comprises the host of containing above-mentioned transfer vector plasmid.Described host is intestinal bacteria.

Of the present invention have goose source anti-new castle disease virus gene RIG-I for the preparation of the application in anti-NDV product.This gene plays an important role in congenital immunologic process as a species specific antiviral gene, therefore, it can be utilized reverse Genetics Technique to insert and build the RIG-I recombinant virus in the NDV genome, perhaps utilize differential stimulus thing 21-mer 5 ' ppp RNA of RIG-I as the vaccine adjuvant of immune NDV, perhaps goose source RIG-I is imported the chicken genome and cultivate transgenic chicken.

The present invention is based on duck source RIG-I gene, the goose source RIG-I gene mRNA sequence that increased finds that both reach 93.8% at homology.Simultaneously with total length gRIG-I(gRIG-Ifull) and gRIG-I CARD structural domain (gRIG-I CARD), transfectional cell carried out expression, confirmed that the gRIG-I of heterogenous expression can bring into play anti-NDV effect.The researchist also infects respectively GEF with 3 kinds of NDV viruses and the Yangzhou goose in 2 ages in week detects gRIG-I mRNA level.After finding GEF infection NDV, rise has all appearred in gRIG-I mRNA level.Infect that in the gentle lens capsule tissue of lung of goose after NDV, rise has all appearred in gRIG-I mRNA level, and in the in vitro and in vivo experiment, viral growth all has been subject to inhibition.The present invention is the goose source RIG-I gene of determining first both at home and abroad, and the present invention has determined the anti-NDV effect of goose RIG-I by cell and animal experiment.

Description of drawings

Fig. 1 is the impact that after gRIG-I transfection HEK-293T cell, 5 ' pppRNA is stimulated;

Fig. 2 is on the impact of associated protein after gRIG-I transfection HEK-293T cell;

Fig. 3 is on the impact of NDV titre after gRIG-I transfection HEK-293T cell;

Fig. 4 is on the impact of IFN-β after gRIG-I transfection DF-1 cell;

Fig. 5 is on the impact of virus titer after gRIG-I transfection DF-1 cell;

Fig. 6 is the impact of the expression of gRIG-I mRNA after GEF infection NDV;

Fig. 7 is that GEF infects after NDV the impact on virus titer;

Fig. 8 is the expression of RIG-I mRNA in each tissue of normal goose;

Fig. 9-1, Fig. 9-2, Fig. 9-3 are respectively goose and infect after Herts/33, ZJ1, three kinds of NDV of La Sota impact on the gRIG-I mrna expression in the gentle lens capsule tissue of lung;

Figure 10-1,10-2,10-3 are respectively goose and infect after Herts/33, ZJ1, three kinds of NDV of La Sota impact on the virus titer in lung and air bag;

Figure 11 is goose (goose), duck (duck), poephila castanotis (finch) and people (human) RIG-I sequence comparative result.

Embodiment

Following embodiment further describes the present invention, but described embodiment only is used for explanation the present invention rather than restriction the present invention.

If do not specialize, the conventional means that in embodiment, technique means used is well known to those skilled in the art.

Embodiment 1

1. goose RIG-I gene order determines and construction of eukaryon expression plasmid for expressing

1.1 design of primers

RIG-I sequence according to upper existing people, duck and poephila castanotis of GenBank, design overlap pcr amplification primer P1, P2, P3, P4 is by the RIG-I gene of the method amplification goose of fusion PCR, wherein P1, P2 is the upstream and downstream primer of first round PCR, P3, P4 second take turns the upstream and downstream primer of PCR, utilize P1 and P4 to carry out third round PCR after two-wheeled PCR product mixes and obtain whole audience sequence.And according to conserved regions design primers designed P5, P6, CARD zone amplication primer P7, P8.

Table 1 RIG-I gene-correlation pcr amplification primer sequence used

Primer	Sequence
		P1L
	5′- CGGCCGGCAGAGCCCAGCC -3′
		P2R	5′-GTCTTAGCAAAGAGAAGAGTGCGAGTCTGTGGGTTATAGC-3′
P3L	5′-GCTATAACCCACAGACTCGCACTCTTCTCTTTGCTAAGAC-3′
		P4R	5′-GTGTAGGAGAGTAATAGATGCACT-3′
P5L	5′-GATCCCAGCAATGAGAATCCTAAACT-3′
		P6R	5′-CAATGTCAATGCCTTCATCAGC-3′
P7L	5′-ATTTGCGGCCGCTTTAATGACGGCGGACGAGAAGCGGAGC-3′
		P8R	5′-GCTCTAGAGCTTACCCCTTTCGTCCTGCAGGCAT-3′

1.2 the preliminary evaluation of RIG-I in GEF

By following system preparation PCR system

System component volume (ul)

Upstream primer 1

Downstream primer 1

Template 2

PCRmix 10

Distilled water 6

Cumulative volume 20

Response procedures is: 94 ℃ of denaturation 5min, and 94 ℃ of sex change 40s, 55 ℃ of annealing 45s(annealing temperatures are determined by primer Tm value), 68 ℃ of extensions (length of extension time by amplified production determines), after 30 circulations, 72 ℃ are extended 10min.

Take GEF cDNA as template, with P5, P6 is that primer increases, after utilizing a day root gel to reclaim test kit recovery purifying after 10% agarose gel electrophoresis, fragment is connected into pGEM-T easy carrier (available from promega company), transform DH5 α, blue hickie screening, the picking hickie is cut dual evaluation through PCR and enzyme and is obtained positive colony, serves the order-checking of Hai Shenggong company.Positive colony called after GEF-RIG-I-PCR.

1.3 the structure of goose RIG-I gene amplification and eukaryon expression plasmid

By following system preparation PCR system, a minute two-wheeled carries out the overlapping PCR of overlap PCR()

System component volume (ul)

10 * AccuPrime PCR Buffer II (the prompt basic high-fidelity enzyme in the English Weihe River) 2.5

Upstream primer 0.5

Downstream primer 0.5

Template 2

AccuPrime Taq DNA Polymerase(polysaccharase) 0.5

Sterile purified water 9

Cumulative volume 25

Response procedures is: 94 ℃ of denaturation 2min, and 94 ℃ of sex change 20s, 55 ℃ of annealing 30s(annealing temperatures are determined by primer Tm value), 68 ℃ of extensions (length of extension time by amplified production determines), 30 rear 72 ℃ of extension 10min of circulation.

First round amplification: take GEF cDNA as template, use P1, P2 is 2000bp left and right, primer amplification RIG-I gene front portion fragment, use P3, P4 is the fragment of primer amplification RIG-I gene rear portion 1000bp left and right, the fragment of amplification is carried out agarose gel electrophoresis respectively at 10% gel, utilizes a day root gel to reclaim test kit and reclaims purifying.

Second takes turns amplification: two bar segment that reclaim take first round amplification use P1 as template, and P4 is primer, and the full length sequence of the RIG-I gene that increases is the band of 2805bp by agarose gel electrophoresis Separation and Recovery size, and carries out purifying.

With the RIG-I fragment that obtains through Not I/Xba I(available from takara company) after enzyme cuts, be connected into p3XFLAG-CMV-7.1 carrier (available from sigma company), transform DH5 α (intestinal bacteria), 12 clones of picking cut dual evaluation with PCR and Not I/Xba I enzyme and obtain positive colony, serve the order-checking of Hai Shenggong company.Positive colony called after gRIG-I full(gRIG-I), nucleotide sequence is as shown in SEQ ID No.1; Aminoacid sequence is as shown in SEQ ID No.2.

With goose, duck, poephila castanotis and people RIG-I sequence compare, result as shown in figure 11, goose source RIG-I gene and duck source RIG-I gene homology reach 93.8%.

1.4 the structure of goose RIG-I CARD gene amplification and eukaryon expression plasmid

By following system preparation PCR system

System component volume (ul)

LA taq polysaccharase 0.5

10×LA PCR buffer Ⅱ 5

dNTP Mixture 8

Template 2

Upstream primer 1

Downstream primer 1

Sterile purified water 32.5

Cumulative volume 50

Response procedures is: 94 ℃ of denaturation 3min, and 94 ℃ of sex change 30s, 55 ℃ of annealing 30s(annealing temperatures are determined by primer Tm value), 72 ℃ of extensions (length of extension time by amplified production determines), after 30 circulations, 72 ℃ are extended 10min.

Take RIG-I full as template, with P7, P8 is that primer increases, after agarose gel electrophoresis reclaims purifying, fragment after Not I/Xba I enzyme is cut, is connected into the p3XFLAG-CMV-7.1 carrier, transforms DH5 α, 12 clones of picking cut dual evaluation with PCR and Not I/Xba I enzyme and obtain positive colony, serve the order-checking of Hai Shenggong company.Positive colony called after gRIG-I CARD.

RIG-I CARD nucleotide sequence, as shown in SEQ ID No.3:

atgacggcggacgagaagcggagcctgcagtgctaccggcggtacatcgagcggagcctcaaccccgtctacgtgctgggcaacatggcggactggctgcccgacgagctgcgggagaggatccgcaaggaggaggagaggggggtgagcggcgccgccgcgctctttctggacgccgtcctgcagctggaggcccgcggctggttccgagggatgctggacgcaatgctggccgcaggtcacacaggactggcagaagcaattgagaactgggacttcagcaaactggaaaaactggagttacacagacagctgttgaagcggatagaggcaacaatgttagaagtcgacccagtagtgctcattccctacataaacacctgcctgatagacagggagtgcgaagagattcagcagattagtgaaagcagaagcaaagcagcaggcataactaaactcattgaatgtctctgtcggtcggataaggagcactggccaaaaagccttcagctggcactagataacacaggatattaccgtgcaagtgaactgtgggatatgagagaagataatgccaaagatgttgacagtgaaatgacagatgcctctgaggactgccttgaaacaagtatgacatattctgaagaagcagaacctgatgataatctcagtgaaaatcttggttcagctgcagaaggaattgacaagcctccacctgtctatgaagcaaagaaggcccggagctaccagattgaacttgcacagcctgctatcaatgggaaaaatgccttaatatgtgcccctactggatctggaaaaactttcatcgcgcttctggtttgtgaacaccat

RIG-I CARD protein sequence, as shown in SEQ ID No.4:

MTADEKRSLQCYRRYIERSLNPVYVLGNMADWLPDELRERIRKEEERGVSGAAALFLDAVLQLEARGWFRGMLDAMLAAGHTGLAEAIENWDFSKLEKLELHRQLLKRIEATMLEVDPVVLIPYINTCLIDRECEEIQQISESRSKAAGITKLIECLCRSDKEHWPKSLQLALDNTGYYRASELWDMREDNAKDVDSEMTDASEDCLETSMTYSEEAEPDDNLSENLGSAAEGIDKPPPVYEAKKARSYQIELAQPAINGKNALICAPTGSGKTFIALLVCEHH

2. exogenous goose RIG-I transfectional cell impact that NDV is copied

2.1 5 ' ppp-dsRNA stimulates goose RIG-I can raise the expression of IFN-β

Existing studies show that, 5 ' ppp-dsRNA can activate the RIG-I signal path, induces IFN-β to produce.We cross expression goose RIG-I-full and RIG-I-CARD in HEK-293T, then stimulate with 5 ' ppp-dsRNA, detect the impact on the expression of hIFN-β.With extracting the p3XFLAG-CMV-7.1 empty carrier without intracellular toxin plasmid extraction kit (DP117,10 times, day root biochemical technology company limited), recombinant plasmid FLAG-gRIG-I full, FLAG-gRIG-I CARD cuts through enzyme and identifies and be used for transfection after correct.

The HEK-293T cell, after transfection 30h, with 5 ' ppp-dsRNA(available from invivogen company) stimulate, collecting cell sample after 15h extracts RNA, and carries out reverse transcription with promega M-MLV reverse transcription test kit.Mock group (simulation group) is not for stimulating with 5 ' ppp-dsRNA.

With 3 above-mentioned plasmids, by the method transient transfection of liposome (available from U.S. hero (invitrogen) company) transfection.

As shown in Figure 1, Real-time PCR(real-time quantitative PCR) result shows, transfection in the cell of empty carrier hIFN-β mRNA to rise be not clearly, stimulating group is 1.6 times of stimulating group not.Transfection the hIFN-β mRNA of gRIG-I full and gRIG-I CARD obvious rising has been arranged, stimulating group is respectively 2.9 times and 3.5 times of stimulating group not.

Express 2.2 cross the impact that goose RIG-I copies NDV

Existing studies show that, after infecting NDV, the RIG-I of people and mouse can produce the antiviral molecule of function.In order to verify whether goose RIG-I can identify NDV and bring into play antiviral effect, with empty carrier, gRIG-I full, gRIG-I CARD transfection HEK-293T cell, after transfection 30h, infect NDV Herts33/56, collecting cell sample after 15h with 1 infection multiplicity (MOI) respectively, extract RNA, and carry out reverse transcription.

After infecting Herts33/56 15h, we find on the mRNA level except IFN-β, transcription factor IRF3, interferon-induced factor IFIT1(ISG56) and chemokine IP-10 significant rising is all arranged.Wherein IFIT1 and IP-10 in transfection after gRIG-I CARD and gRIG-I full, risen at least 70 times.IRF3 has also risen respectively 24 and 9.4 times, and hIFN-β has risen 3.2 and 3.4 times.As shown in Figure 2.

We have detected the virus titer (TCID50) of NDV Herts33/56 in the supernatant simultaneously.Find, with transfection comparing of empty carrier, transfection the virus titer of gRIG-I CARD and gRIG-I full obvious reduction has been arranged.As shown in Figure 3.

2.3 the impact that exogenous goose RIG-I transfection DF-1 copies NDV

Can we have known and have lacked RIG-I in chicken, identify NDV and cause antiviral effect in DF-1 in order to verify goose RIG-I, and we are external source transfection gRIG-I/empty carrier in RIG-I null chicken DF-1 cell, then infects NDV Herts/33.15h after infecting detects cIFN-β expression activity, has found that in transfection DF-1 IFN-β after infecting NDV of gRIG-I has had obvious rising, especially transfection the DF-1 cell of gRIG-I-full.As shown in Figure 4.

We have detected the titre of NDV Herts33/56 in the supernatant simultaneously.Find, with transfection comparing of empty carrier, transfection the virus titer of gRIG-I CARD and gRIG-I full all decrease, especially transfection gRIG-I full cause that in supernatant, virus titer has reduced approximately 2 times.As shown in Figure 5.

3. the effect of endogenous goose RIG-I in anti-NDV infects

3.1 after GEF infects NDV, gRIG-I mRNA detects

In order to verify whether endogenous gRIG-I can cause anti-NDV innate immunity, and we infect respectively GEF with 3 kinds of NDV viruses, and detect gRIG-I mrna expression level.In test, the source of 3 strain NDV used and virulence are all not identical, and wherein Herts/33 is standard chicken source property poison by force, can cause the symptom of medium tenacity in goose, available from China Veterinary Drugs Supervisory Inst.; ZJ1 is goose source property poison by force, can be lethal to goose, available from Yangzhou University; La Sota is vaccine strain, can not be lethal to goose, and available from China Veterinary Drugs Supervisory Inst..

We are 12h after infection respectively, 24h, and 36h, 48h has collected cell sample, and has extracted RNA, carries out after reverse transcription detecting gRIG-I mRNA as template with Real-time PCR.We can see by Fig. 6, and the gRIG-I mRNA of GEF each time point after infecting NDV all has rise, and reaches highest level when 24h, and Herts/33, ZJ1, La Sota have raised respectively 14.4,7.8,2 times.

3.2 after GEF infects NDV, virus titer detects

Collect respectively the supernatant that infects rear each time point of each virus, measure its virus titer (TCID50), find the rising along with gRIG-I mRNA level, corresponding virus titer is the trend of reduction.

These data show, after infecting NDV, in GEF, the rise of gRIG-I can affect virus virulence to a certain extent, and the innate immunity reaction peaks when 24h, thereby suppress copying of virus.As shown in Figure 7.

3.3 the distribution of RIG-I in normal goose body

In order to detect RIG-I in each in-house distribution of goose, we have gathered the heart of normal goose, liver, spleen, lung, kidney, the fabricius bursa, air bag and intestinal tissue.After extracting total RNA, with Real-timePCR detection RIG-I mRNA content wherein.Discovery in goose, RIG-I exist with each tissue in, and all hangs down scale reach in overwhelming majority's tissue, but the expression contents in spleen and lung is higher.As shown in Figure 8.

3.4 the gRIG-I mRNA after goose infection NDV in the gentle lens capsule tissue of lung raises

In in vitro tests, we verified after infecting NDV the generation of gRIG-I mRNA can raise, we think further to know, what kind of variation can occur in the gRIG-I in body after infecting NDV.We attack the rear 1d group of poison respectively to not infecting control group, and lung and the air bag of attacking the rear 3d group of poison carry out Real-time PCR, detect the expression amount of its gRIG-I mRNA.In the fabricius bursa of the goose that we will not infect, the expression amount of gRIG-I mRNA as blank value, calculates the relative expression quantity in lung and air bag.

Before attacking poison, the gRIG-I mRNA in lung has just presented high-caliber expression.Attacking poison rear 1 day, the gRIG-I mRNA in the air bag of the goose of infection La Sota and infection Herts/33, ZJ1, the gRIG-I mRNA in the lung of the goose of La Sota has obvious rise.Attacking poison rear 3 days, the level of gRIG-I mRNA was compared with attacking poison in rear 1 day, was generally downward trend.Herts/33 and La Sota attacked poison rear 1 day and 3 days air bags in gRIG-I mrna expression amount all very high, we infer that the goose air bag is organized in innate immunity and play an important role.As Fig. 9-1, Fig. 9-2 are shown in Fig. 9-3.

3.5 in the gentle lens capsule tissue of lung, viral ELD50 detects

Attack that the virus titer in the gentle lens capsule tissue of lung and the expression of gRIG-I are opposite trend after poison.Attacked poison rear 1 day, when gRIG-I mrna expression level is very high, virus titer is very low, is attacking poison rear 3 days, and gRIG-I mrna expression level is the trend of reduction, and virus titer rises to some extent.As Figure 10-1, Figure 10-2 are shown in Figure 10-3.

Although the present invention has been described in detail and has quoted as proof some specific exampless, for a person skilled in the art, only otherwise leave the spirit and scope of the present invention, it is obvious making various changes or revising.

Sequence table

＜110〉China Agriculture Academe Shanghai Veterinary Institute

＜120〉a kind of goose source gene RIG-I and application thereof with anti-new castle disease virus activity

<130>

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 2805

<212> DNA

＜213〉artificial sequence

<400> 1

atgacggcgg acgagaagcg gagcctgcag tgctaccggc ggtacatcga gcggagcctc 60

aaccccgtct acgtgctggg caacatggcg gactggctgc ccgacgagct gcgggagagg 120

atccgcaagg aggaggagag gggggtgagc ggcgccgccg cgctctttct ggacgccgtc 180

ctgcagctgg aggcccgcgg ctggttccga gggatgctgg acgcaatgct ggccgcaggt 240

cacacaggac tggcagaagc aattgagaac tgggacttca gcaaactgga aaaactggag 300

ttacacagac agctgttgaa gcggatagag gcaacaatgt tagaagtcga cccagtagtg 360

ctcattccct acataaacac ctgcctgata gacagggagt gcgaagagat tcagcagatt 420

agtgaaagca gaagcaaagc agcaggcata actaaactca ttgaatgtct ctgtcggtcg 480

gataaggagc actggccaaa aagccttcag ctggcactag ataacacagg atattaccgt 540

gcaagtgaac tgtgggatat gagagaagat aatgccaaag atgttgacag tgaaatgaca 600

gatgcctctg aggactgcct tgaaacaagt atgacatatt ctgaagaagc agaacctgat 660

gataatctca gtgaaaatct tggttcagct gcagaaggaa ttgacaagcc tccacctgtc 720

tatgaagcaa agaaggcccg gagctaccag attgaacttg cacagcctgc tatcaatggg 780

aaaaatgcct taatatgtgc ccctactgga tctggaaaaa ctttcatcgc gcttctggtt 840

tgtgaacacc atttccaaaa catgcctgca ggacgaaagg ggaaagttgt atttcttgca 900

acaaaagtcc cagtgtatga acaacagaaa aatgtcttca agcaacattt tgaaagacaa 960

ggatattcca ttcaaggagt tagtggtgaa aatttttcaa atgtctctgt agaaaatgtt 1020

atagaggaca atgacatcat cgtactgaca ccccagatcc tggtgaatag cttcgaggat 1080

gggaccctta cctccctctc tgttttcact ctgatgatat tcgatgagtg ccacaacact 1140

acaggcaacc acccttacaa tgtgttaatg accaggtatc tggagcagaa atttaactcc 1200

cctgcaagtc agctgccaca gattttaggt ttgactgctt ctgttggagt tggtaatgcc 1260

aagaacattg aggaaacaat agagcacatc tgtagtctct gctcctacct tgatatacag 1320

gccatatcca ctgtcagaga gaacatacaa gacctgcaaa ggttcatgaa caagccagaa 1380

atagatgtca gattggttaa gaggcgagtt cacaatcact ttgcagtcat tatctcagat 1440

ttgatgtccg agacagaggc actgatgagg aagatttact cagtgggtac tgtctcccaa 1500

aacagcagga aagattttgg aacacagaaa tatgaacact ggatagttgt cactcagagg 1560

aaatgcagac tgttgcaact agaagacaag gaggaggaga gcaggatatg tagagccctt 1620

ttcatttgca ctgaacacct gcggaaatac aatgatgccc tcatcatcag tgaagatgcc 1680

cgcatcatag atgctctatc ctacctgacc gagtttttca caaatgtcaa gaatggacca 1740

tacacagaat tagaacagca cctgacagcc aaatttcaag agaaagaacc agaactgact 1800

gccctttcaa aagacgaaac aaatgagaat cctaaactgg aagagcttgc ctgcatcctg 1860

gatgatgcat actgctataa cccacagact cgcactcttc tctttgctaa gacaagagcc 1920

ttagtagctg ctttgaagaa gtgtatggag gaaaacccta tccttagcta cataaagcca 1980

gatgttttga tggggcgcgg aagaagagat caaaaaacag gtatgaccct cccaagccag 2040

aagggtgtac tggatgcgtt caaaaccagc aaggacagca ggctgctcat agctacatcc 2100

gttgctgatg aaggcattga tattgcccag tgcaaccttg ttgtgctcta tgaatactcc 2160

ggtaatgtga ccaaaatgat ccaagtcaga ggtcgtggaa gggcagcagg cagcaagtgc 2220

atccttgtga caagcaaaac agaagtggtt gagaatgaaa aatgcaaccg ttataaggaa 2280

gaaatgatga ataaagctat tgaaaagctc caggaatggg atgaagaaac atttgcaaaa 2340

aagatacata acctgcaaat gaaggaaaag gtgttacgag attccaggaa gaaagaaata 2400

aaacctaaag tagtggaagg ccagaagaac ctcctgtgtg gaaaatgcaa agcatatgcc 2460

tgcagtacag atgacatcag aattataaag gaatctcatc acgttgtcct aggagaagca 2520

ttcaaggagc gttatataac aaagcctcat aagaaaccaa tgcagtttga tggttttgag 2580

aaaaaaagca agatgcattg ccgaaataat aattgccagc atgactgggg aatcacagtg 2640

aagtacctga catttgacaa tctacccgtg atcaaaatca aaagcttcgt agtgcagagt 2700

gctgcaaccg ggacacaaat ggactttcag agatggaaaa gtattaattc ttctttgaag 2760

aattttgatg ttgaagaaat gtccaacttg tacccaccat tttag 2805

<210> 2

<211> 934

<212> PRT

＜213〉artificial sequence

<400> 2

Met Thr Ala Asp Glu Lys Arg Ser Leu Gln Cys Tyr Arg Arg Tyr Ile

1 5 10 15

Glu Arg Ser Leu Asn Pro Val Tyr Val Leu Gly Asn Met Ala Asp Trp

20 25 30

Leu Pro Asp Glu Leu Arg Glu Arg Ile Arg Lys Glu Glu Glu Arg Gly

35 40 45

Val Ser Gly Ala Ala Ala Leu Phe Leu Asp Ala Val Leu Gln Leu Glu

50 55 60

Ala Arg Gly Trp Phe Arg Gly Met Leu Asp Ala Met Leu Ala Ala Gly

65 70 75 80

His Thr Gly Leu Ala Glu Ala Ile Glu Asn Trp Asp Phe Ser Lys Leu

85 90 95

Glu Lys Leu Glu Leu His Arg Gln Leu Leu Lys Arg Ile Glu Ala Thr

100 105 110

Met Leu Glu Val Asp Pro Val Val Leu Ile Pro Tyr Ile Asn Thr Cys

115 120 125

Leu Ile Asp Arg Glu Cys Glu Glu Ile Gln Gln Ile Ser Glu Ser Arg

130 135 140

Ser Lys Ala Ala Gly Ile Thr Lys Leu Ile Glu Cys Leu Cys Arg Ser

145 150 155 160

Asp Lys Glu His Trp Pro Lys Ser Leu Gln Leu Ala Leu Asp Asn Thr

165 170 175

Gly Tyr Tyr Arg Ala Ser Glu Leu Trp Asp Met Arg Glu Asp Asn Ala

180 185 190

Lys Asp Val Asp Ser Glu Met Thr Asp Ala Ser Glu Asp Cys Leu Glu

195 200 205

Thr Ser Met Thr Tyr Ser Glu Glu Ala Glu Pro Asp Asp Asn Leu Ser

210 215 220

Glu Asn Leu Gly Ser Ala Ala Glu Gly Ile Asp Lys Pro Pro Pro Val

225 230 235 240

Tyr Glu Ala Lys Lys Ala Arg Ser Tyr Gln Ile Glu Leu Ala Gln Pro

245 250 255

Ala Ile Asn Gly Lys Asn Ala Leu Ile Cys Ala Pro Thr Gly Ser Gly

260 265 270

Lys Thr Phe Ile Ala Leu Leu Val Cys Glu His His Phe Gln Asn Met

275 280 285

Pro Ala Gly Arg Lys Gly Lys Val Val Phe Leu Ala Thr Lys Val Pro

290 295 300

Val Tyr Glu Gln Gln Lys Asn Val Phe Lys Gln His Phe Glu Arg Gln

305 310 315 320

Gly Tyr Ser Ile Gln Gly Val Ser Gly Glu Asn Phe Ser Asn Val Ser

325 330 335

Val Glu Asn Val Ile Glu Asp Asn Asp Ile Ile Val Leu Thr Pro Gln

340 345 350

Ile Leu Val Asn Ser Phe Glu Asp Gly Thr Leu Thr Ser Leu Ser Val

355 360 365

Phe Thr Leu Met Ile Phe Asp Glu Cys His Asn Thr Thr Gly Asn His

370 375 380

Pro Tyr Asn Val Leu Met Thr Arg Tyr Leu Glu Gln Lys Phe Asn Ser

385 390 395 400

Pro Ala Ser Gln Leu Pro Gln Ile Leu Gly Leu Thr Ala Ser Val Gly

405 410 415

Val Gly Asn Ala Lys Asn Ile Glu Glu Thr Ile Glu His Ile Cys Ser

420 425 430

Leu Cys Ser Tyr Leu Asp Ile Gln Ala Ile Ser Thr Val Arg Glu Asn

435 440 445

Ile Gln Asp Leu Gln Arg Phe Met Asn Lys Pro Glu Ile Asp Val Arg

450 455 460

Leu Val Lys Arg Arg Val His Asn His Phe Ala Val Ile Ile Ser Asp

465 470 475 480

Leu Met Ser Glu Thr Glu Ala Leu Met Arg Lys Ile Tyr Ser Val Gly

485 490 495

Thr Val Ser Gln Asn Ser Arg Lys Asp Phe Gly Thr Gln Lys Tyr Glu

500 505 510

His Trp Ile Val Val Thr Gln Arg Lys Cys Arg Leu Leu Gln Leu Glu

515 520 525

Asp Lys Glu Glu Glu Ser Arg Ile Cys Arg Ala Leu Phe Ile Cys Thr

530 535 540

Glu His Leu Arg Lys Tyr Asn Asp Ala Leu Ile Ile Ser Glu Asp Ala

545 550 555 560

Arg Ile Ile Asp Ala Leu Ser Tyr Leu Thr Glu Phe Phe Thr Asn Val

565 570 575

Lys Asn Gly Pro Tyr Thr Glu Leu Glu Gln His Leu Thr Ala Lys Phe

580 585 590

Gln Glu Lys Glu Pro Glu Leu Thr Ala Leu Ser Lys Asp Glu Thr Asn

595 600 605

Glu Asn Pro Lys Leu Glu Glu Leu Ala Cys Ile Leu Asp Asp Ala Tyr

610 615 620

Cys Tyr Asn Pro Gln Thr Arg Thr Leu Leu Phe Ala Lys Thr Arg Ala

625 630 635 640

Leu Val Ala Ala Leu Lys Lys Cys Met Glu Glu Asn Pro Ile Leu Ser

645 650 655

Tyr Ile Lys Pro Asp Val Leu Met Gly Arg Gly Arg Arg Asp Gln Lys

660 665 670

Thr Gly Met Thr Leu Pro Ser Gln Lys Gly Val Leu Asp Ala Phe Lys

675 680 685

Thr Ser Lys Asp Ser Arg Leu Leu Ile Ala Thr Ser Val Ala Asp Glu

690 695 700

Gly Ile Asp Ile Ala Gln Cys Asn Leu Val Val Leu Tyr Glu Tyr Ser

705 710 715 720

Gly Asn Val Thr Lys Met Ile Gln Val Arg Gly Arg Gly Arg Ala Ala

725 730 735

Gly Ser Lys Cys Ile Leu Val Thr Ser Lys Thr Glu Val Val Glu Asn

740 745 750

Glu Lys Cys Asn Arg Tyr Lys Glu Glu Met Met Asn Lys Ala Ile Glu

755 760 765

Lys Leu Gln Glu Trp Asp Glu Glu Thr Phe Ala Lys Lys Ile His Asn

770 775 780

Leu Gln Met Lys Glu Lys Val Leu Arg Asp Ser Arg Lys Lys Glu Ile

785 790 795 800

Lys Pro Lys Val Val Glu Gly Gln Lys Asn Leu Leu Cys Gly Lys Cys

805 810 815

Lys Ala Tyr Ala Cys Ser Thr Asp Asp Ile Arg Ile Ile Lys Glu Ser

820 825 830

His His Val Val Leu Gly Glu Ala Phe Lys Glu Arg Tyr Ile Thr Lys

835 840 845

Pro His Lys Lys Pro Met Gln Phe Asp Gly Phe Glu Lys Lys Ser Lys

850 855 860

Met His Cys Arg Asn Asn Asn Cys Gln His Asp Trp Gly Ile Thr Val

865 870 875 880

Lys Tyr Leu Thr Phe Asp Asn Leu Pro Val Ile Lys Ile Lys Ser Phe

885 890 895

Val Val Gln Ser Ala Ala Thr Gly Thr Gln Met Asp Phe Gln Arg Trp

900 905 910

Lys Ser Ile Asn Ser Ser Leu Lys Asn Phe Asp Val Glu Glu Met Ser

915 920 925

Asn Leu Tyr Pro Pro Phe

930

<210> 3

<211> 852

<212> DNA

＜213〉artificial sequence

<400> 3

atgacggcgg acgagaagcg gagcctgcag tgctaccggc ggtacatcga gcggagcctc 60

aaccccgtct acgtgctggg caacatggcg gactggctgc ccgacgagct gcgggagagg 120

atccgcaagg aggaggagag gggggtgagc ggcgccgccg cgctctttct ggacgccgtc 180

ctgcagctgg aggcccgcgg ctggttccga gggatgctgg acgcaatgct ggccgcaggt 240

cacacaggac tggcagaagc aattgagaac tgggacttca gcaaactgga aaaactggag 300

ttacacagac agctgttgaa gcggatagag gcaacaatgt tagaagtcga cccagtagtg 360

ctcattccct acataaacac ctgcctgata gacagggagt gcgaagagat tcagcagatt 420

agtgaaagca gaagcaaagc agcaggcata actaaactca ttgaatgtct ctgtcggtcg 480

gataaggagc actggccaaa aagccttcag ctggcactag ataacacagg atattaccgt 540

gcaagtgaac tgtgggatat gagagaagat aatgccaaag atgttgacag tgaaatgaca 600

gatgcctctg aggactgcct tgaaacaagt atgacatatt ctgaagaagc agaacctgat 660

gataatctca gtgaaaatct tggttcagct gcagaaggaa ttgacaagcc tccacctgtc 720

tatgaagcaa agaaggcccg gagctaccag attgaacttg cacagcctgc tatcaatggg 780

aaaaatgcct taatatgtgc ccctactgga tctggaaaaa ctttcatcgc gcttctggtt 840

tgtgaacacc at 852

<210> 4

<211> 284

<212> PRT

＜213〉artificial sequence

<400> 4

Met Thr Ala Asp Glu Lys Arg Ser Leu Gln Cys Tyr Arg Arg Tyr Ile

1 5 10 15

Glu Arg Ser Leu Asn Pro Val Tyr Val Leu Gly Asn Met Ala Asp Trp

20 25 30

Leu Pro Asp Glu Leu Arg Glu Arg Ile Arg Lys Glu Glu Glu Arg Gly

35 40 45

Val Ser Gly Ala Ala Ala Leu Phe Leu Asp Ala Val Leu Gln Leu Glu

50 55 60

Ala Arg Gly Trp Phe Arg Gly Met Leu Asp Ala Met Leu Ala Ala Gly

65 70 75 80

His Thr Gly Leu Ala Glu Ala Ile Glu Asn Trp Asp Phe Ser Lys Leu

85 90 95

Glu Lys Leu Glu Leu His Arg Gln Leu Leu Lys Arg Ile Glu Ala Thr

100 105 110

Met Leu Glu Val Asp Pro Val Val Leu Ile Pro Tyr Ile Asn Thr Cys

115 120 125

Leu Ile Asp Arg Glu Cys Glu Glu Ile Gln Gln Ile Ser Glu Ser Arg

130 135 140

Ser Lys Ala Ala Gly Ile Thr Lys Leu Ile Glu Cys Leu Cys Arg Ser

145 150 155 160

Asp Lys Glu His Trp Pro Lys Ser Leu Gln Leu Ala Leu Asp Asn Thr

165 170 175

Gly Tyr Tyr Arg Ala Ser Glu Leu Trp Asp Met Arg Glu Asp Asn Ala

180 185 190

Lys Asp Val Asp Ser Glu Met Thr Asp Ala Ser Glu Asp Cys Leu Glu

195 200 205

Thr Ser Met Thr Tyr Ser Glu Glu Ala Glu Pro Asp Asp Asn Leu Ser

210 215 220

Glu Asn Leu Gly Ser Ala Ala Glu Gly Ile Asp Lys Pro Pro Pro Val

225 230 235 240

Tyr Glu Ala Lys Lys Ala Arg Ser Tyr Gln Ile Glu Leu Ala Gln Pro

245 250 255

Ala Ile Asn Gly Lys Asn Ala Leu Ile Cys Ala Pro Thr Gly Ser Gly

260 265 270

Lys Thr Phe Ile Ala Leu Leu Val Cys Glu His His

275 280

<210> 5

<211> 19

<212> DNA

＜213〉artificial sequence

<400> 5

cggccggcag agcccagcc 19

<210> 6

<211> 40

<212> DNA

＜213〉artificial sequence

<400> 6

gtcttagcaa agagaagagt gcgagtctgt gggttatagc 40

<210> 7

<211> 40

<212> DNA

＜213〉artificial sequence

<400> 7

gctataaccc acagactcgc actcttctct ttgctaagac 40

<210> 8

<211> 24

<212> DNA

＜213〉artificial sequence

<400> 8

gtgtaggaga gtaatagatg cact 24

<210> 9

<211> 26

<212> DNA

＜213〉artificial sequence

<400> 9

gatcccagca atgagaatcc taaact 26

<210> 10

<211> 22

<212> DNA

＜213〉artificial sequence

<400> 10

caatgtcaat gccttcatca gc 22

<210> 11

<211> 40

<212> DNA

＜213〉artificial sequence

<400> 11

atttgcggcc gctttaatga cggcggacga gaagcggagc 40

<210> 12

<211> 34

<212> DNA

＜213〉artificial sequence

<400> 12

gctctagagc ttaccccttt cgtcctgcag gcat 34

Claims

1. the goose source gene RIG-I with anti-new castle disease virus activity, is characterized in that, the sequence of goose source gene RIG-I mRNA is as shown in SEQ ID No.1.

2. the albumen of gene RIG-I coding according to claim 1.

3. albumen according to claim 2, its aminoacid sequence is as shown in SEQ ID No.2.

4. according to claim 1 have a goose source anti-new castle disease virus gene RIG-I, it is characterized in that, the nucleotide sequence of described gene gRIG-I structural domain is as shown in SEQ ID No.3.

5. the albumen of gene RIG-I coding according to claim 4.

6. albumen according to claim 2, its aminoacid sequence is as shown in SEQ ID No.4.

7. the transfer vector plasmid that contains claim 1 or 4 described gene.

8. contain the host cell that transfer vector plasmid claimed in claim 7 transforms.

9. according to claim 1-6 any one are described has goose source anti-new castle disease virus gene RIG-I for the preparation of the application in anti-NDV product.