CN103173443A

CN103173443A - CYP2C9 gene fragment containing 1300A>T mutation, protein fragment encoded through same and application thereof

Info

Publication number: CN103173443A
Application number: CN2013100938031A
Authority: CN
Inventors: 蔡剑平; 李传保; 胡国新; 戴大鹏; 王双虎; 耿培武
Original assignee: Beijing Hospital
Current assignee: Beijing Hospital
Priority date: 2013-03-22
Filing date: 2013-03-22
Publication date: 2013-06-26
Anticipated expiration: 2033-03-22
Also published as: CN103173443B

Abstract

The invention belongs to the field of biology, relates to single-base mutation and particularly relates to a 1300th bit mutation site of a CYP2C9 gene corresponding to SEQ ID NO.2. The 1300th bit mutation site is mutated from wild type A into T. The invention relates to a nucleic acid fragment containing the 1300th bit mutation site, a protein fragment encoded through the same and application thereof. The invention also provides allelomorphic gene specific oligonucleotide for detecting the 1300th bit mutation site, a kit and a detection method.

Description

Comprise the 1300A＞CYP2C9 gene fragment of T sudden change, coded protein fragments and application thereof

Technical field

The invention belongs to field of biology, relate to single base mutation.More specifically, the present invention relates to the CYP2C9 gene with respect to the 1001st or the mutational site of the 1300th of SEQ ID NO.2 of SEQ ID NO.1, comprise the nucleic acid fragment in this mutational site and the protein fragments of corresponding encoded thereof.The invention still further relates to reagent and the detection method of identifying described mutational site, and identify the application of this site in direction of medication usage.

Background technology

CYP2C9 is most important a member in cytochrome P 450 enzymes extended familys CYP2C subfamily, accounts for 20% of people's hepatomicrosome CYP enzyme total amount.About 10～16% clinical commonly used drugs are arranged via the CYP2C9 oxidative metabolism, comprise mainly that wherein tolbutamide, S-warfarin, Phenytoin Sodium Salt, Glipizide, U26452, holder draw the medicines (referring to reference 1-5) such as thiophene miaow, losartan, irbesartan and many non-steroidal anti-inflammatory drugs (as: Ibuprofen BP/EP, lornoxicam, diclofenac and Naproxen Base).

The CYP2C9 gene has the height polymorphism.So far, named allelotrope has 57 kinds (http://www.cypalleles.ki.se) in the world, remove outside wild-type (CYP2C9*1), have 56 kinds of mutation types and can cause that CYP2C9 Argine Monohydrochloride composition changes, and also has multiple newfound sudden change not yet to be named in addition.Study mutation type more and that clinical meaning is larger and mainly comprise following 10 kinds: CYP2C9*2, * 3, * 5, * 6, * 8, * 11, * 12, * 13, * 14, * 16, wherein ethnic group distribute the widest, most study, Chinese population research data relatively the abundantest mutant be CYP2C9*2(430C T), CYP2C9*3(1075A C), and CYP2C9*13(269T C) (referring to reference 6-17,20).

According to present clinical studies show, this polymorphism of CYP2C9 gene is to cause CYP2C9 enzymic activity very big different major cause between individuality, therefore carrying the very big difference that can cause curative effect of medication between the genotypic individuality of different CYP2C9, even producing serious poisonous side effect of medicine or treat insufficient.Therefore, research CYP2C9 gene pleiomorphism will provide important scientific basis (referring to reference 18,19,21,22) to clinical rational drug use to the impact of curative effect of medication.

Summary of the invention

The new single base mutation site that the purpose of this invention is to provide the CYP2C9 gene, comprise this mutational site nucleic acid fragment, its coding protein fragments and identify the application of this mutational site in medication guide.

First aspect of the present invention is to provide nucleic acid fragment, described nucleic acid fragment comprises the mutational site of the 1001st corresponding to SEQ IDNO.1, and be at least 10 continuous nucleotides in the nucleotide sequence shown in SEQ ID NO.1, wherein the Nucleotide of the 1001st is T; Perhaps described nucleic acid fragment comprises the mutational site of the 1300th corresponding to SEQ ID NO.2, and is at least 10 continuous nucleotides in the nucleotide sequence shown in SEQ ID NO.2, and wherein the Nucleotide of the 1300th is T; It is perhaps the complementary sequence of above-mentioned nucleic acid fragment.

Second aspect of the present invention is to provide and contains corresponding to the 1001st of SEQ ID NO.1 or corresponding to the allelotrope fragment in the mutational site of the 1300th of SEQ ID NO.2 or the allele specific oligonucleotide of all or part of hybridization of its complementary sequence, and wherein the Nucleotide in the mutational site of the 1300th of the 1001st of SEQ ID NO.1 the or SEQ ID NO.2 is T; Described allelotrope fragment is at least 10 continuous nucleotides or its complementary sequence in the nucleotide sequence shown in SEQID NO.1 or SEQ ID NO.2.

The 3rd aspect of the present invention be to provide for detection of and/or the test kit of analysis list base mutation, described test kit comprises nucleic acid fragment of the present invention or allele specific oligonucleotide, or comprises the sequence fragment shown in SEQ IDNO.14 and/or SEQ ID NO.15 and/or SEQ ID NO.23.

The 4th aspect of the present invention is to provide nucleic acid fragment of the present invention or the application of oligonucleotide in detecting the CYP2C9 transgenation, and wherein said nucleic acid fragment or oligonucleotide are as probe or primer.

The 5th aspect of the present invention is to provide a kind of medication guide, comprises the 1001st or the single base mutation of the 1300th of SEQ ID NO.2 corresponding to the SEQ ID NO.1 that detect CYP2C9 gene in testing sample; According to the sudden change that detects, adjust the dosage by the medicine of CYP2C9 metabolism.

The 6th aspect of the present invention is to provide the method for analysis of nucleic acids, described method comprise analyze in testing sample comprise corresponding in the nucleic acid of the sequence of SEQ ID NO.1 corresponding to the Nucleotide of the 1001st or analyze in testing sample comprise corresponding in the nucleic acid of the sequence of SEQ ID NO.2 corresponding to the Nucleotide of the 1300th.

The 7th aspect of the present invention is to provide CYP2C9 albumen or its fragment or varient, and described protein sequence is the sequence shown in SEQ ID NO.3; Described fragment or varient comprise the phenylalanine of the 434th corresponding to SEQ ID NO.3, and are at least 10 continuous amino acids of the aminoacid sequence shown in SEQ ID NO.3.

The invention provides the CYP2C9 gene and the encoding sequence that comprise new single base mutation.This gene sports T(1300A at the 1300th Nucleotide corresponding to SEQ ID NO.2 by A〉T), thereby the amino acid that causes its coding is phenylalanine by isoleucine mutation, namely corresponding to the phenylalanine of the 434th of SEQ ID NO.3.The CYP2C9 albumen of this sudden change (called after I434F) descends than wild-type to the metabolic activity of medicine.This single base mutation has directive significance to the medication of the individuality that carries this mutational site.

Description of drawings

Fig. 1 is the 1001st the nucleotide sequencing collection of illustrative plates corresponding to SEQ ID NO.1 sequence of the present invention in embodiment 1;

Fig. 2 is insect expression vector pFastBac-dual structure iron;

Fig. 3 is the Western figure as a result of each microsome expressing protein in embodiment 2;

Fig. 4 is the data plot of each microsome metabolism diclofenac in embodiment 3;

Fig. 5 is the data plot of each microsome metabolism tolbutamide in embodiment 4;

Fig. 6 is the data plot of each microsome metabolism losartan in embodiment 5.

Embodiment

By following embodiment explanation the present invention, but content of the present invention is not limited to this.

As without other explanation, " nucleic acid fragment " of the present invention is comprised of Nucleotide or its analogue, can be the fragment of DNA, RNA or its analogue; Can be strand or two strands; It can be natural (as genomic) or synthetic.

In the present invention, " sudden change " refers at the gene that detects, namely has the nucleotide site different from wild-type CYP2C9 gene order in the CYP2C9 gene." mutational site " refers to the position that base is undergone mutation.In the present invention, described mutational site is corresponding to the 1300th in sequence shown in the 1001st of sequence shown in SEQ ID NO.1 or SEQ ID NO.2.

In the present invention, " allele-specific " refer to specifically and allelotrope hybridization, is T as hybridize, make the 1300th Nucleotide of identifying corresponding to sequence shown in the 1001st of sequence shown in SEQ ID NO.1 or SEQ IDNO.2 under rigorous condition.

Content of the present invention relates to the nonsynonymous mutation of CYP2C9 gene.Be arranged in the encoding sequence of gene due to this mutational site, therefore, those skilled in the art as can be known, described mutational site both can show in genomic dna, also can performance in the encoding sequence (being CDS, corresponding to the mRNA sequence).Those skilled in the art can detect this mutational site on genomic dna or mRNA level according to detected sample.In the application, SEQ ID NO.1 be centered by the application's mutational site, the genomic dna sequence of each 1kb of front and back, namely the 1001st of SEQ ID NO.1 the is the mutational site that the present invention relates to.SEQ ID NO.2 is the cDNA sequence with the CYP2C9 gene in described mutational site, and wherein the 1300th is the mutational site that the present invention relates to.Those skilled in the art as can be known, in this article, corresponding to the 1300th site of SEQ ID NO.2 with use mutually corresponding to the 1001st the site synonym of SEQ ID NO.1.

In the present invention, abbreviation mode well known in the art is adopted in Nucleotide and amino acid whose abbreviation, represents VITAMIN B4 as A in Nucleotide, and G represents guanine, and C represents cytosine(Cyt), and T represents thymus pyrimidine.In amino acid, A represents L-Ala, and R represents arginine, and N represents l-asparagine, D represents aspartic acid, and C represents halfcystine, and Q represents glutamine, and E represents L-glutamic acid, G represents glycine, and H represents Histidine, and I represents Isoleucine, and L represents leucine, K represents Methionin, and M represents methionine(Met), and F represents phenylalanine, P represents proline(Pro), and S represents Serine, and T represents Threonine, W represents tryptophane, and Y represents tyrosine, and V represents α-amino-isovaleric acid.

Content of the present invention is based on the new single base mutation site of CYP2C9 gene.Described mutational site is the coding region that is positioned at the CYP2C9 gene, and corresponding to the 1300th of SEQ ID NO.2, this site sports T(1300A by the A of wild-type〉T); In addition, the 434th by the albumen of the CYP2C9 genes encoding of this sudden change is phenylalanine (I434F) by isoleucine mutation.

Aspect first, the invention provides nucleic acid fragment, described nucleic acid fragment comprises the mutational site of the 1001st corresponding to SEQ IDNO.1, and is at least 10 continuous nucleotides in the nucleotide sequence shown in SEQ ID NO.1, and wherein the Nucleotide of the 1001st is T; Perhaps described nucleic acid fragment comprises the mutational site of the 1300th corresponding to SEQ ID NO.2, and is at least 10 continuous nucleotides in the nucleotide sequence shown in SEQ ID NO.2, and wherein the Nucleotide of the 1300th is T; It is perhaps the complementary sequence of above-mentioned nucleic acid fragment.

In one embodiment, the length of described nucleic acid fragment can be as 10-100,100-200,200-500, a 500-1000 Nucleotide.Preferably, the length of described nucleic acid fragment is 10-20,20-30,30-40,40-50,50-60, a 60-100 or 100-300 Nucleotide.

Described mutational site can be positioned at any position of described nucleic acid fragment.

In another embodiment, described nucleic acid fragment is the sequence shown in SEQ ID NO.1.

In another embodiment, described nucleic acid fragment is the sequence shown in SEQ ID NO.2.

In other embodiments, described nucleic acid fragment can be the sequence shown in SEQ ID NO.24-31.

In one embodiment, described oligonucleotide is as probe.Described probe can be under rigorous condition and the target sequence specific hybrid that comprises the mutational site.It is known to those skilled in the art that described probe does not need and the target sequence complete complementary, if can with the target sequence specific hybridization.In preferred embodiments, described hybridization conditions can satisfy make probe only with the target sequence specific hybrid.The length of described probe can be 5-100 Nucleotide, as 5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,40,50,60,70,80,90 or 100 Nucleotide.Described mutational site can appear at any position of probe.In preferred embodiment, described mutational site appears at center or about center of probe sequence.

In another embodiment, the primer that described oligonucleotide synthesizes with the DNA that coaches, sequencing primer or synthetic primer etc. as known in the art.Described primer does not need and the template complete complementary, but should be with the complementary hybridization of template to instruct DNA synthetic.The length of described primer can be 15-40 length of nucleotides, is preferably 18,19,20,21,22,23,24,25,26,27,28,29 or 30 Nucleotide.Described mutational site can appear at any position of described primer; Preferably, described mutational site appears at 3 ' end of described primer.

Some preferred embodiment in, described oligonucleotide is the sequence as shown in SEQ ID NO.32-38.

Based on this, the 3rd aspect of the present invention be to provide for detection of and/or the test kit of analysis list base mutation, described test kit comprises nucleic acid fragment of the present invention or allele specific oligonucleotide, or comprises the sequence fragment shown in SEQ ID NO.14 and/or SEQ ID NO.15 and/or SEQ ID NO.23.

The 4th aspect of the present invention is to provide nucleic acid fragment of the present invention or oligonucleotide for detection of the application of CYP2C9 transgenation, and wherein said nucleic acid fragment or oligonucleotide are as probe or primer.

The 5th aspect of the present invention is to provide medication guide, comprises the 1001st or the single base mutation of the 1300th of SEQ ID NO.2 corresponding to the SEQ ID NO.1 that detect CYP2C9 gene in testing sample.When the CYP2C9 gene that detects is T in the site of the 1300th corresponding to the 1001st of SEQ ID NO.1 or SEQ IDNO.2, adjust accordingly the dosage through the medicine of CYP2C9 metabolism.In specific embodiment, when the CYP2C9 gene was T in the site of the 1300th of SEQ ID NO.2, the CYP2C9 protease activity of this genes encoding descended, therefore need to adjust the dosage through the medicine of CYP2C9 metabolism.

The medicine through the CYP2C9 metabolism described in the present invention comprises: cancer therapy drug, as endoxan, ifosfamide or taxol; Anticoagulant is as warfarin, Acenocoumarol, anticonvulsive drug or mephenytoin; Antidiabetic drug is as tolbutamide, nateglinide, pioglitazone or rosiglitazone; Antiepileptic drug is as Phenytoin Sodium Salt or zonisamide; Antimalarial drug/antiparasitic is as amodiaquine, Tirian or quinine; Antipsychotic drug is as amitriptyline, citalopram, imipramine, Perospirone, Sertraline, thioridazine or Venlafaxine; Depressor is as losartan, irbesartan or valsartan; Non-steroidal anti-inflammatory drug is as diclofenac, pyramidon, quinizine, celecoxib, flurbiprofen, Ibuprofen BP/EP, indomethacin, lornoxicam, mefenamic acid, Naproxen Base, piroxicam or tenoxicam; Anodyne is as, Loperamide, methadone or morphine; Proton pump inhibitor is as lansoprazole or omeprazole; Tranquilizer is as, clobazam, Mephogarbital or Zopiclone.

In one embodiment, described mode can be restriction fragment length polymorphism analysis (RFLP).Those skilled in the art can be according to the present invention content design experiment in the nucleic acid of the sequence of analyzing SEQ ID NO.1 the Nucleotide of the 1001st or the Nucleotide of the 1300th in the nucleic acid of the sequence of SEQ ID NO.2 whether as T.

In another embodiment, described method can be sequencing, comprise and separate and measure nucleotide sequence from genomic dna or RNA, analyze wherein comprise corresponding in the nucleic acid of the sequence of SEQ ID NO.1 corresponding to the Nucleotide of the 1001st or whether comprise corresponding to the Nucleotide corresponding to the 1300th in the nucleic acid of the sequence of SEQ ID NO.2 be T.Sequencing can be any available sequence measurement known in the art.Sequencing primer can design according to those skilled in the art's general knowledge, and the upstream and downstream appropriate position design primer as in site to be detected comprises the fragment in this site to be measured, thereby judges the Nucleotide in this site with expansion.Also can adopt oligonucleotide of the present invention as primer sequence.

In another embodiment, described method is to utilize the method for probe hybridization, comprise in the identification and detection sample specifically corresponding in the nucleic acid of the sequence of SEQ ID NO.1 corresponding to the Nucleotide of the 1001st or whether comprise corresponding to the Nucleotide corresponding to the 1300th in the nucleic acid of the sequence of SEQ ID NO.2 be T; The probe that adopts in described method is oligonucleotide of the present invention.For example, isolate nucleic acid from testing sample, under the condition of the specific target sequence hybridization that may exist in allowing probe and nucleic acid, probe is contacted with nucleic acid; The hybridization that can be detected can realize by using the probe of being crossed by detectable reagent mark; For example, form the enzyme that can detect product with radio isotope, fluorescence dye or energy catalysis and come label probe.Label probe, be all well-known to those skilled in the art with the method that whether has target sequence in the label probe test sample.

In a kind of concrete embodiment, provide with the method for Taqman probe SNP detection method detection corresponding to the Nucleotide of the 1001st of SEQ ID NO.1, comprising:

1) the design primer is used for specific amplification and comprises the PCR product of the 1001st corresponding to SEQ ID NO.1, designs simultaneously two Taqman-MGB probes, respectively for A and the T allelotrope of the 1001st corresponding to SEQ ID NO.1.

The design of primers principle is:

(1) choose should be at the conservative section of gene for sequence;

(2) avoid primer self or and primer between form pairing continuously more than 4 or 4, avoid primer self to form the pili annulati card structure;

(3) primer length is at 18 to 24 Nucleotide;

(4) the Tm value is at 55-65 ℃, and GC content is at 40%-60%;

(5) the Tm value between primer differs and avoids over 2 ℃;

(6) 3 ' of primer end avoids using base A, 3 ' end of primer avoid occurring 3 or 3 with

Upper consecutive identical base;

(7) pcr amplified fragment length is at 50bp-150bp;

(8) last 5 Nucleotide of primer end can not have G and the C over 2.

Taqman MGB probe design principle is:

(1) 5 ' of probe end avoids occurring G;

(2) the Tm value should be 65-67 ℃;

(3) shorten Taqman MGB probe, but probe length is no less than 13bp as far as possible;

(4) avoid the base, especially the G base that duplicate as far as possible, avoid the G that occurs more than 4 or 4 to repeat;

(5) mutational site with probe is placed on middle 1/3 place as far as possible.

Fluorophor can adopt FAM, VIC etc. to come two allelotrope of mark.

2) utilize above-mentioned primer and probe, sample to be tested is carried out real-time quantitative PCR.

The PCR condition: 95 ℃ of denaturations enter 30 amplification cycles after 10 minutes: 92 ℃ of sex change 12 seconds, 60 ℃ of annealing and extend 1 minute (this stage is detected fluorescent signal).

3) data analysis.

Analyze experimental result, judge according to the power of two kinds of fluorescence of sample whether sample to be tested CYP2C9 gene exists 1300A the T sudden change.

In the present invention, described sample can be any sample that comprises nucleic acid, as blood; Preferred described sample comes from the people.Described nucleic acid can be DNA or coding RNA, is preferably genomic dna.The method of analysis of nucleic acids of the present invention can be take DNA or RNA as target compound.Those skilled in the art as can be known, when take DNA as the detection target compound, analyze in testing sample comprise corresponding in the nucleic acid of the sequence of SEQ ID NO.1 corresponding to the Nucleotide of the 1001st, the probe that uses or primer are according to the sequences Design of SEQ ID NO.1; When take RNA when detecting target compound, analyze in testing sample comprise corresponding in the nucleic acid of the sequence of SEQID NO.2 corresponding to the Nucleotide of the 1300th, the probe that uses or primer are according to the sequences Design of SEQ ID NO.2.

The 7th aspect of the present invention is to provide CYP2C9 albumen or its fragment or varient, and described protein sequence is the sequence shown in SEQ ID NO.3; Described fragment or varient comprise the phenylalanine of the 434th corresponding to SEQ ID NO.3, and are at least 10 continuous amino acids of the aminoacid sequence shown in SEQ ID NO.3, as 10-20,20-50 or 50-100 amino acid.

The below will further illustrate the present invention by specific embodiment, but the following specific embodiment purpose of property presented for purpose of illustration only.

Embodiment

Embodiment 1: the evaluation in the mutational site that people CYP2C9 gene is new

In the present embodiment, gather the obvious patient blood sample on the low side of clinical warfarin medication dose, extract the genomic dna in blood, the design sequencing primer carries out sequence amplification, order-checking to 9 exons of CYP2C9 gene, analyzes its CYP2C9 gene and whether has the mutational site.

1) extract DNA:

Take 5ml vein EDTA anticoagulated blood sample from the measured; Then according to common salting-out process and/or adopt special DNA extraction test kit (available from the DNA extraction test kit of U.S. Omega company) to extract the genomic dna of blood sample to be measured.

2) pcr amplification:

Design of amplification primers increases to 9 exon sequences of the CYP2C9 gene in the genome DNA sample that obtains.Described amplimer sees Table 1 to sequence.

Adopt 50 μ l PCR reaction systems, comprising: 1 * PCR damping fluid, 1.5mM MgCl ₂, the genomic dna of 100～150ng, upstream and downstream primer be the LATaq archaeal dna polymerase 1.5U that 0.2 μ M, dNTP are 0.4mM, TaKaRa company.The pcr amplification loop parameter is as follows: 94 ℃ of denaturations 5 minutes, and 94 ℃ of sex change 30 seconds were annealed 30 seconds, and 72 ℃ were extended 2 minutes and 30 seconds, and extended 5 minutes after 30 circulations again.Annealing temperature is relevant to primer length, and actual temp sees Table 1.

Use the GeneAmp PCR System9700 amplification instrument amplification of American AB I company.

Table 1: sequencing primer is to reaching annealing temperature

3) purifying amplified production:

Get 50 μ l pcr amplification products and carry out the agarose gel electrophoresis separation, blade cuts the purpose band.Reclaiming test kit (Omega company) according to the E.Z.N.A. gel requires the DNA that carries out the purpose band to reclaim purifying.

4) order-checking:

Product after to reclaim uses sequencing primer according to CEQ as template ^TMDTCS-Quick Start Kit sequencing kit (U.S. Beckman company) the PCR reaction that requires to check order, reaction finish and purifying after, separate sequence with the interpretation amplified production with the CEQ8000 type gene sequencer of U.S. Beckman company.Sequencing primer sees Table 2.

Table 2: sequencing primer

The zone	Sequencing primer (5 '-3 ')
		Exons 1	TACCTCTAGGGATACAC(SEQ?ID?NO.16)
Wai Xianzi2 ﹠3	CTAACAACCAGGACTCATAAT(SEQ?ID?NO.17)
		Exon 4	TTGCTGTTAAGGGAATTTGTAGGTAAGATA(SEQ?ID?NO.18)
Exon 5	TAGTGGTCTATTTTGTTATTCATTCAT(SEQ?ID?NO.19)
		Exon 6	TTCCAGTTTCTATGTTG(SEQ?ID?NO.20)
Exon 7	ACCCGGTGATGGTAGAGGTT(SEQ?ID?NO.21)
		Exon 8	ACGGGATTTCCTCATCTG(SEQ?ID?NO.22)
Exon 9	CGATACACTGAACAGTTATTGC(SEQ?ID?NO.23)

5) data analysis:

The sequence and the wild-type CYP2C9*1 sequence (GenBank number of registration NM_000771.3) that record are compared.

By compare of analysis, find that the Nucleotide of the 1300th of CYP2C9 gene coding region becomes T(as shown in Figure 1 by A, wherein W represents A or T), this sudden change is positioned at the 9th exon of CYP2C9 gene.Infer accordingly in the protein of this CYP2C9 genes encoding, the 434th amino acids sports phenylalanine (F) by Isoleucine (I).This sudden change is now by the P450 called after neomorph CYP2C9*59 of NK, but not yet externally announcement.

Exemplarily provided the method for identifying the new mutant site in the present embodiment.Those skilled in the art can clearly learn according to foregoing and detect specifically the method that comprises in testing sample corresponding to the 1001st Nucleotide of SEQ ID NO.1: the nucleic acid in sample separation, carry out amplified reaction under corresponding experiment condition in the present embodiment, primer uses primer pair SEQ ID NO.14 and 15; With sequencing primer SEQ IDNO.23, the product of amplification is checked order; Sequencing result and wild-type result are compared, analyzed the Nucleotide corresponding to the 1001st site of SEQ ID NO.1.

Embodiment 2: the expression of target gene

Plasmid vector (by professor's Zhou Shufeng present of American South University of Florida) take the open reading frame that is connected with wild-type CYP2C9*1 as template, utilizes side-directed mutagenesis to obtain respectively the open reading frame (ORF) of CYP2C9*2, CYP2C9*3, CYP2C9*13 and I434F mutant of the present invention.Side-directed mutagenesis is techniques well known, and those skilled in the art can know beyond all doubtly and how complete this step according to template and the target determined.

Then the ORF with four mutant genes of CYP2C9*1 gene and site-directed mutagenesis is cloned in the carrier pFastBac-dual that is connected with cytochrome P450 reductase (OR), after making CYP2C9 gene and OR be placed in respectively PH and p10 promotor, build and to express simultaneously OR and CYP2C9(or its mutant) dual-expression vector.The insertion point of pFastBac-dual carrier structure figure and CYP2C9 gene and OR is referring to Fig. 2.Not comprise the CYP2C9 gene, only to include the carrier of OR gene as negative control carrier (pOR).

According to Bac-to-Bac baculovirus expression system test kit (available from American I nvitrogen company, be used for insect cell mass expressing external goal gene) operation instruction, the dual-expression vector that utilization builds and control vector are packed respectively P1 generation and P2 for insect viruses, the P2 that obtains measure after titre according to MOI(multiplicity-of-infection for virus) be that 4 infect dose infects the sf21 insect cell.Infect centrifugal collecting cell after 72 hours, use Ultrasonic Cell Disruptor (U.S. SONIC company) to have children outside the state plan smudge cells according to 40% energy, utilize differential centrifugation to extract the insect cell microsome.Detect the expression amount of CYP2C9 and OR in each microsome with the Western method; With CYP2C9 standard substance (being called for short STD, available from U.S. BD Gentest company), obtaining microsome is carried out quantitatively.

The Western result as shown in Figure 3.What the first row showed is the CYP2C9 expression amount, and what the second row showed is the OR expression amount.As seen from the figure, control vector pOR only expresses OR albumen, and 5 dual-expression vectors are all expressed OR albumen, and expresses respectively * 1, * 2, * 3, * 13 type CYP2C9 and I434F albumen of the present invention.

The enzymes metabolism activation analysis

According to existing result of study, wild-type (* 1 type) is all higher to the metabolic activity of various medicines, and the metabolic activity of * 2 types has obvious decline than the metabolic activity of wild-type, and the metabolic activity of * 3 types is than * 2 types lower (referring to reference 18,19,21,22).Therefore, existing a kind of like this common recognition in the art: the expressed enzyme of same genotype can represent metabolic activity to other substrate medicine to the metabolic activity of specific substrate.Thereby, the enzyme expressed according to a certain genotype to specific substrate metabolic activity data can analogize the expressed enzyme of this genotype to the metabolic activity of other substrate medicine (as, the metabolic activity of the enzyme that the metabolic activity of enzyme that can this genotype is expressed and wild-type are expressed compares).

Embodiment 3: the metabolic characteristic of the insect microsome analyzed in vitro that utilization obtains to diclofenac:

1) chromatographic condition: chromatographic column is ZORBAX SB-C18 post (2.1*150mm, 5-Micron, Agilent, the U.S.); Moving phase is 0.1%TFA: water: acetonitrile=20:35:45; Column temperature is 40 ℃; The detection wavelength is: 280nm.

2) incubation conditions:

Reaction cumulative volume 200 μ L, comprising: 100mM Tris-HCl (pH7.4), 1 * NADPH coenzyme generation system (U.S. Promega company), 2pmol cytochrome b5 and diclofenac (available from U.S. Sigma company, the reaction final concentration is 1-100 μ M).After 37 ℃ of preincubate 5min, add the restructuring microsome (expressing respectively * 1, * 2, * 3, * 13 type CYP2C9, I434F of the present invention) of embodiment 2 structures of 2-5pmol to react to start.37 ℃ hatch 20min after, add mark Carbamzepine (available from U.S. Sigma company) and vortex concussion 2min in 100 μ L0.1M HCl and 10 μ L20ng/ μ L.Add vortex concussion 2min after 800 μ L glacial acetic acid ethyl esters, the centrifugal 5min of 10,000 * g under 4 ℃.The careful organic layer that shifts dries up with Nitrogen evaporator, adds 100 μ L moving phases redissolve and get 20 μ L and detect in Waterse2695 type high performance liquid chromatograph.

The Michaelis-Menten data results of the present embodiment as shown in Figure 4.Further carry out pharmacokinetic analysis, result is as shown in table 3:

Table 3: the pharmacokinetic analysis result of each microsome metabolism diclofenac

Wherein, V _maxRepresent maximum speed of reaction (numerical value is larger, shows that catalytic efficiency is higher), K _mBe Michaelis-Menton constant (numerical value is larger, shows that catalytic efficiency is lower), V _max/ K _mReflected whole medicine clearance rate, be comprehensive performance assessment criteria, numerical value is lower, the whole the enzyme activity that shows mutant is lower, drug metabolic rate is lower, and the individuality that carries this mutant is lower to the requirement of medicine, otherwise the drug intoxication phenomenon easily occurs.

Reached as seen from Table 3 by Fig. 4, the whole the enzyme activity of I434F of the present invention also is starkly lower than mutant * 2 types and * 3 types well below wild-type * 1 type, but higher than mutant * 13 types.

Embodiment 4: the metabolic characteristic of the insect microsome analyzed in vitro that utilization obtains to tolbutamide:

1) chromatographic condition: chromatographic column is ZORBAX SB-C18 post (2.1*150mm, 5-Micron, Agilent, the U.S.); Moving phase is 0.1%TFA: water: acetonitrile=20:40:40; Column temperature is 40 ℃; The detection wavelength is: 230nm.

2) incubation conditions:

Reaction cumulative volume 200 μ L, comprising: 100mM Tris-HCl (pH7.4), 1 * NADPH coenzyme generation system, 10pmol cytochrome b5 and tolbutamide (available from U.S. Sigma company, the reaction final concentration is 10-1000 μ M).After 37 ℃ of preincubate 5min, add the restructuring microsome of embodiment 2 structures of 10-20pmol to start reaction.37 ℃ hatch 60min after, add mark P-607 (available from U.S. Sigma company) and vortex concussion 2min in 40 μ L0.1M HCl and 50 μ L20ng/ μ L.Add vortex concussion 2min after 800 μ L glacial acetic acid ethyl esters, the centrifugal 5min of 10,000 * g under 4 ℃.The careful organic layer that shifts dries up under Nitrogen evaporator, adds 100 μ L moving phases redissolve and get 20 μ L and detect in Waterse2695 type high performance liquid chromatograph.

The Michaelis-Menten data results of the present embodiment as shown in Figure 5.Further carry out pharmacokinetic analysis, result is as shown in table 4:

Table 4: the pharmacokinetic analysis result of each microsome metabolism tolbutamide

By Fig. 5 and table 4 as can be known, the whole the enzyme activity of I434F of the present invention is starkly lower than wild-type * 1 type and mutant * 2 types, also lower than mutant * 3 types, but higher than mutant * 13 types.

Embodiment 5: utilize the insect microsome analyzed in vitro of acquisition to the metabolic characteristic of losartan

1, chromatographic condition: chromatographic column is ZORBAX SB-C18 post (2.1*150mm, 5-Micron, Agilent, the U.S.); Moving phase is 0.1%TFA: water: acetonitrile=20:42:38; Column temperature is 40 ℃; The detection wavelength is: 230nm.

2, incubation conditions:

Reaction cumulative volume 200 μ L, comprising: 100mM Tris-HCl (pH7.4), 1 * NADPH coenzyme generation system, 10pmol cytochrome b5 and losartan (available from U.S. Sigma company, the reaction final concentration is 0.5-25 μ M).After 37 ℃ of preincubate 5min, add the restructuring microsome of embodiment 2 structures of 10-20pmol to start reaction.37 ℃ hatch 30min after, add mark diazepam (available from U.S. Sigma company) and vortex concussion 2min in 40 μ L0.1M HCl and 10 μ L10ng/ μ L.Add vortex concussion 2min after 800 μ L glacial acetic acid ethyl esters, the centrifugal 5min of 10,000 * g under 4 ℃.The careful organic layer that shifts dries up under Nitrogen evaporator, adds 100 μ L moving phases redissolve and get 20 μ L and detect in Waters e2695 type high performance liquid chromatograph.

The Michaelis-Menten data results of the present embodiment as shown in Figure 6.Further carry out pharmacokinetic analysis, result is as shown in table 5:

Table 5: the pharmacokinetic analysis result of each microsome metabolism losartan

By Fig. 5 and table 4 as can be known, the whole the enzyme activity of I434F of the present invention is far below wild-type * 1 type, also lower than mutant * 2 types and * 3 types, but higher than mutant * 13 types.

Can find out according to above-described embodiment, I434F mutant enzyme metabolic activity of the present invention is well below wild-type * 1 type, and corresponding to mutant * 2 types, its metabolic activity is also lower.Therefore, in practice, need to consider suitably to regulate on dosage carrying this genotypic individuality, as the usage quantity that reduces medicine and the generation of avoiding adverse drug reaction.This medicine adjustment by gene targeting is even more important for the narrow medicine (as warfarin, Phenytoin Sodium Salt etc.) for the treatment of window.

Sequence:

SEQ ID NO.1: genomic dna sequence

GGACAGAGCCCTCCTGACTTATTCACTTCCTAAAAGGAGCCATCTCTTTAGTAATGTTGCATTGGGATTATGTGTCAACATATGAAATTGGGGGAGGCATATTCAGACCATAGCACATTTTTCAATGGAAATATAATGTTGAGGAAACCCAGAGAAGGCAACATTTTCTTGCTCAAGGAGATGAGAAAGAGGGTAAAAAAGGAGATAAAATTTGACCTATGTCCTGACTGTGGTAATAGAAAAGTTCATCTTGGCTAAAAGGAGCAGCATGATATAAAATTTGAAACCTCATGGTGTGTTGGAGACTGATGATGAGTGGCTATGCCTAGAGTTGACAGTATCGGATTTGAAGAGTGTAAGGAGTGATGTGGATCATCAGACTGGAAACAGAATGTGAGGGTCCAGATCAATCCATTGGGACCTTATCCTATAGGACATACAGGGAAGCCATTTAAAGTTTTAAAGTGAGAAGGTGACATGTTTAGACATGTGCTCCTGAAAGTACCTAGAGGAAAAAAATCTTTGGCTGCATATTGAGCCAGAAATACAAAGGGAAATACAGTATGTTAGCCTCCTCCTCTAAGCCCTTCTCAGTTCAACCCACTGGACAAGAAATGTATGTTTCTAAAGAAAGATTGATGAAGACATTTAAAGTCTCTTGAAAGATTTTAATAAAGTGCTTGGCATGTAGCTGGTACTCAACAAATATTTGTTGAATACAGGGTGCCTGTTAAGATCTGATATTAGGTGAAGAGTAAGTATGTCCATTCATTTTTCAGTTGCCTATACATCCATCCATTCATCCATTTATCCATCCACTCATCCATCCATTCATTCATGCATGCACCCATCCACCCATCTATCTCTTCATCTCTTCTACGATACACTGAACAGTTATTGCATATTCTGTTTGTGCCAGTTACAGAGACAGTGTTTGTCACTGTCACAGTTACGCATGAGGAGTAACTGCTCTCTGTGTTTGCTATTTTCAGGAAAACGGTTTTGTGTGGGAGAAGCCCTGGCCGGCATGGAGCTGTTTTTATTCCTGACCTCCATTTTACAGAACTTTAACCTGAAATCTCTGGTTGACCCAAAGAACCTTGACACCACTCCAGTTGTCAATGGATTTGCCTCTGTGCCGCCCTTCTACCAGCTGTGCTTCATTCCTGTCTGAAGAAGAGCAGATGGCCTGGCTGCTGCTGTGCAGTCCCTGCAGCTCTCTTTCCTCTGGGGCATTATCCATCTTTCACTATCTGTAATGCCTTTTCTCACCTGTCATCTCACATTTTCCCTTCCCTGAAGATCTAGTGAACATTCGACCTCCATTACGGAGAGTTTCCTATGTTTCACTGTGCAAATATATCTGCTATTCTCCATACTCTGTAACAGTTGCATTGACTGTCACATAATGCTCATACTTATCTAATGTTGAGTTATTAATATGTTATTATTAAATAGAGAAATATGATTTGTGTATTATAATTCAAAGGCATTTCTTTTCTGCATGTTCTAAATAAAAAGCATTATTATTTGCTGAGTCAGTTTATTAGACCTTCCTTCTTTTATGCATAATGTAGGTCAGAAATTAAAGAAAATAGAGTTCCAGGAGGCCATGCTGGTTCTCAAAATGATAAGGACAGAAAGGACAAAGAGGAAGAGGGTAGGGAAGCTATTTTGGGTGAGTGTTAGAGTTACTTGAGGATTGGATTTGAAAGTGAGAAACTGTGTCCAGGGGCAGCTCTAACCTCTAGGGAAATATTCAGAGGATCAGTCAAAGGGTGGAATGGACATTAAATGCTAGAATTCTTATATCCACATTGGTGTTCCTTTTTTTTTGAGACAAAGTCTTGCTCTGTCACCCAGGCTGGAGTGCAGTGGTGTGATCTCAGCTCTCTATAACCTCCGCCTCCCAGGTTCAAGTGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGATTACAGGTGCATGCCACCACACCTGGCTAATTTTTTGTATTTTTAG

SEQ ID NO.2: encoding sequence

ATGGATTCTCTTGTGGTCCTTGTGCTCTGTCTCTCATGTTTGCTTCTCCTTTCACTCTGGAGACAGAGCTCTGGGAGAGGAAAACTCCCTCCTGGCCCCACTCCTCTCCCAGTGATTGGAAATATCCTACAGATAGGTATTAAGGACATCAGCAAATCCTTAACCAATCTCTCAAAGGTCTATGGCCCTGTGTTCACTCTGTATTTTGGCCTGAAACCCATAGTGGTGCTGCATGGATATGAAGCAGTGAAGGAAGCCCTGATTGATCTTGGAGAGGAGTTTTCTGCAAGAGGCATTTTCCCACTGGCTGAAAGAGCTAACAGAGGATTTGGAATTGTTTTCAGCAATGGAAAGAAATGGAAGGAGATCCGGCGTTTCTCCCTCATGACGCTGCGGAATTTTGGGATGGGGAAGAGGAGCATTGAGGACCGTGTTCAAGAGGAAGCCCGCTGCCTTGTGGAGGAGTTGAGAAAAACCAAGGCCTCACCCTGTGATCCCACTTTCATCCTGGGCTGTGCTCCCTGCAATGTGATCTGCTCCATTATTTTCCATAAACGTTTTGATTATAAAGATCAGCAATTTCTTAACTTAATGGAAAAGTTGAATGAAAACATCAAGATTTTGAGCAGCCCCTGGATCCAGATCTGCAATAATTTTTCTCCTATCATTGATTACTTCCCGGGAACTCACAACAAATTACTTAAAAACGTTGCTTTTATGAAAAGTTATATTTTGGAAAAAGTAAAAGAACACCAAGAATCAATGGACATGAACAACCCTCAGGACTTTATTGATTGCTTCCTGATGAAAATGGAGAAGGAAAAGCACAACCAACCATCTGAATTTACTATTGAAAGCTTGGAAAACACTGCAGTTGACTTGTTTGGAGCTGGGACAGAGACGACAAGCACAACCCTGAGATATGCTCTCCTTCTCCTGCTGAAGCACCCAGAGGTCACAGCTAAAGTCCAGGAAGAGATTGAACGTGTGATTGGCAGAAACCGGAGCCCCTGCATGCAAGACAGGAGCCACATGCCCTACACAGATGCTGTGGTGCACGAGGTCCAGAGATACATTGACCTTCTCCCCACCAGCCTGCCCCATGCAGTGACCTGTGACATTAAATTCAGAAACTATCTCATTCCCAAGGGCACAACCATATTAATTTCCCTGACTTCTGTGCTACATGACAACAAAGAATTTCCCAACCCAGAGATGTTTGACCCTCATCACTTTCTGGATGAAGGTGGCAATTTTAAGAAAAGTAAATACTTCATGCCTTTCTCAGCAGGAAAACGGTTTTGTGTGGGAGAAGCCCTGGCCGGCATGGAGCTGTTTTTATTCCTGACCTCCATTTTACAGAACTTTAACCTGAAATCTCTGGTTGACCCAAAGAACCTTGACACCACTCCAGTTGTCAATGGATTTGCCTCTGTGCCGCCCTTCTACCAGCTGTGCTTCATTCCTGTCTGA

SEQ ID NO.3: protein sequence

MDSLVVLVLCLSCLLLLSLWRQSSGRGKLPPGPTPLPVIGNILQIGIKDISKSLTNLSKVYGPVFTLYFGLKPIVVLHGYEAVKEALIDLGEEFSARGIFPLAERANRGFGIVFSNGKKWKEIRRFSLMTLRNFGMGKRSIEDRVQEEARCLVEELRKTKASPCDPTFILGCAPCNVICSIIFHKRFDYKDQQFLNLMEKLNENIKILSSPWIQICNNFSPIIDYFPGTHNKLLKNVAFMKSYILEKVKEHQESMDMNNPQDFIDCFLMKMEKEKHNQPSEFTIESLENTAVDLFGAGTETTSTTLRYALLLLLKHPEVTAKVQEEIERVIGRNRSPCMQDRSHMPYTDAVVHEVQRYIDLLPTSLPHAVTCDIKFRNYLIPKGTTILISLTSVLHDNKEFPNPEMFDPHHFLDEGGNFKKSKYFMPFSAGKRFCVGEALAGMELFLFLTSILQNFNLKSLVDPKNLDTTPVVNGFASVPPFYQLCFIPV

SEQ ID NO.24: nucleic acid fragment

ACGGTTTTGTGTGG

SEQ ID NO.25: nucleic acid fragment

CAGGAAAACGGTTTTGTGTGG

SEQ ID NO.26: nucleic acid fragment

AGGAAAACGGTTTTGTGTGGGAGAAGC

SEQ ID NO.27: nucleic acid fragment

CAGGAAAACGGTTTTGTGTGGGAGAAGCCCTG

SEQ ID NO.28: nucleic acid fragment

CTATTTTCAGGAAAACGGTTTTGTGTGGGAGAAGCCCTG

SEQ ID NO.29: nucleic acid fragment

TTGCTATTTTCAGGAAAACGGTTTTGTGTGGGAGAAGCCCTGGC

SEQ ID NO.30: nucleic acid fragment

GTTTGCTATTTTCAGGAAAACGGTTTTGTGTGGGAGAAGCCCTGGCCG

SEQ ID NO.31: nucleic acid fragment

GTTTGCTATTTTCAGGAAAACGGTTTTGTGTGGGAGAAGCCCTGGCCGGCATG

SEQ ID NO.32: oligonucleotide sequence

GCTTCTCCCACACAAAAC

SEQ ID NO.33: oligonucleotide sequence

CAGGGCTTCTCCCACACAAAAC

SEQ ID NO.34: oligonucleotide sequence

GGCCAGGGCTTCTCCCACACAAAAC

SEQ ID NO.35: oligonucleotide sequence

GCCGGCCAGGGCTTCTCCCACACAAAACC

SEQ ID NO.36: oligonucleotide sequence

CATGCCGGCCAGGGCTTCTCCCACACAAAACCG

SEQ ID NO.37: oligonucleotide sequence

CAAAACCGTTTTCCTG

SEQ ID NO.38: oligonucleotide sequence

CACACAAAACCGTTTTCCTG

Reference:

1.Aquilante?CA.Sulfonylurea?pharmacogenomics?in?Type2diabetes:the?influence?of?drug?target?and?diabetes?risk?polymorphisms.Expert?Rev?Cardiovasc?Ther.2010;8(3):359–372.

2.Xu?HM,Murray?M,Mclachlan?AJ.Influence?of?genetic?polymorphisms?on?the?pharmacokinetics?and?pharmacodynamics?of?sulfonylurea?drugs.Current?Drug?Metabolism.2009;10(6):643-658.

3.Wang?B,Wang?J,Huang?SQ,et?al.Genetic?polymorphism?of?the?human?cytochrome?P450?2C9gene?and?its?clinical?significance.Current?Drug?Metabolism.2009;10(7):781-834。

4. Li Zhi, king fruit, Zhou Honghao .CYP2C9 gene pleiomorphism and functional meaning progress thereof. Chinese Clinical pharmacology and therapeutics 2008; 13 (6): 601-609.

5.Zhou?Sh.F,Liu?J.P.Chowbay?B.Polymorphism?of?human?cytochrome?P450enzymes?and?its?clinical?impact.Drug?Metab?Rev.2009;41(2):89-295.

6.Xiong?Y,Wang?M,Fang?K?et?al:A?systematic?genetic?polymorphism?analysis?of?the?CYP2C9?gene?in?four?different?geographical?Han?populations?in?mainland?China.Genomics2011;97:277-281.

7.Zhu?J,Zhang?W,Li?Y,Wang?H,Zheng?W,Wang?C:ARMS?test?for?diagnosis?of?CYP2C9?and?VKORC1?mutation?in?patients?with?pulmonary?embolism?in?Han?Chinese.Pharmacogenomics?2010;11:113-119.

8.Zhang?YN,Cui?W,Han?M?et?al:[Gene?polymorphism?of?CYP450?2C9?and?VKORC1?in?Chinese?population?and?their?relationships?to?the?maintaining?dosage?of?warfarin.].Zhonghua?Liu?Xing?Bing?Xue?Za?Zhi?2010;31:218-222.

9.Li?Z,Wang?G,Wang?LS?et?al:Effects?of?the?CYP2C9*13allele?on?the?pharmacokinetics?of?losartan?in?healthy?male?subjects.Xenobiotica2009;39:788-793.

10.Yu?BN,Luo?CH,Wang?D?et?al:CYP2C9allele?variants?in?Chinese?hypertension?patients?and?healthy?controls.Clin?Chim?Acta2004;348:57-61.

11.Yang?JQ,Morin?S,Verstuyft?C?et?al:Frequency?of?cytochrome?P450?2C9?allelic?variants?in?the?Chinese?and?French?populations.Fundam?Clin?Pharmacol2003;17:373-376.

12.Wang?SL,Huang?J,Lai?MD,Tsai?JJ:Detection?of?CYP2C9?polymorphism?based?on?the?polymerase?chain?reaction?in?Chinese.Pharmacogenetics1995;5:37-42.

13. the horse Jingjing, Li Jinheng, Cheng Lu. three dimensional gel gene chips Study of China crowd CYP2C9 and CYP2C19 gene pleiomorphism. Chinese Clinical pharmacology and therapeutics 2009; 14 (9): 966-973.

14. the Zhao Gang great waves, Ding Yuanyuan, the .Pyrosequencing such as Yang Fan detect foundation and the reliability consideration thereof of CYP2C9*3 gene pleiomorphism method. Chinese Clinical pharmacology and therapeutics 2009; 14 (7): 799-803.

15. Ma Xinchao, Yang Jian, Huang Chenrong etc. the gene pleiomorphism of vitamin K epoxide reductase subunit 1 unit's 1 cytochrome P450 2C9 in Han population in Jiangsu province. University Of Suzhou's journal (medicine) 2009; 29 (2): 279-282.

16. Tang and year, the cuckoo Kui is opened just total. the research of Xinjiang Uygur healthy population cytochrome P450 gene polymorphism. and Chinese medicine and clinical 2007; 7 (2): 91-94.

17. how to shake space, Sun Limin, Li Yueqin etc. Guangdong crowd CYP2C9 allelotrope and genotype distribution frequency. Guangdong medical science 2006; 27 (8): 1131-1132.

18.Rokitta?D,Fuhr?U.Comparison?of?enzyme?kinetic?parameters?obtained?in?vitro?for?reactions?mediated?by?human?CYP2C?enzymes?including?major?CYP2C9variants.Curr?Drug?Metab.2010;11(2):153-161.

19.Van?Booven?D,Marsh?S,McLeod?H?et?al:Cytochrome?P450?2C9-CYP2C9.Pharmacogenet?Genomics2010;20:277-281.

20.Si?D,Guo?Y,Zhang?Y,Yang?L,Zhou?H,Zhong?D.Identification?of?a?novel?variant?CYP2C9?allele?in?Chinese.Pharmacogenetics.2004;14(7):465-469.

21.Hiratsuka?M:In?vitro?assessment?of?the?allelic?variants?of?cytochrome?P450.Drug?Metab?Pharmacokinet2011.

22.Guo?Y,Wang?Y,Si?D,Fawcett?PJ,Zhong?D,Zhou?H.Catalytic?activities?of?human?cytochrome?P450?2C9*1,2C9*3and2C9*13.Xenobiotica2005;35:853-861.

23.Zhou?SF,Zhou?ZW,Yang?LP,Cai?JP:Substrates,inducers,inhibitors?and?structure-activity?relationships?of?human?Cytochrome?P450?2C9and?implications?in?drug?development.Curr?Med?Chem2009;16:3480-3675.

24.Cali?JJ,Ma?D,Sobol?M?et?al:Luminogenic?cytochrome?P450assays.Expert?Opin?Drug?Metab?Toxicol2006;2:629-645.

25.Anzenbacherova?E,Veinlichova?A,Masek?V,Anzenbacher?P:Comparison?of"high?throughput"micromethods?for?determination?of?cytochrome?P450activities?with?classical?methods?using?HPLC?for?product?identification.Biomed?Pap?Med?Fac?Univ?Palacky?Olomouc?Czech?Repub2005;149:353-355.

Claims

1. nucleic acid fragment, described nucleic acid fragment comprises the mutational site of the 1001st corresponding to SEQ ID NO.1, and is at least 10 continuous nucleotides in the nucleotide sequence shown in SEQ ID NO.1, and wherein the Nucleotide of the 1001st is T; Perhaps described nucleic acid fragment comprises the mutational site of the 1300th corresponding to SEQ ID NO.2, and is at least 10 continuous nucleotides in the nucleotide sequence shown in SEQ ID NO.2, and wherein the Nucleotide of the 1300th is T; It is perhaps the complementary sequence of described nucleic acid fragment.

2. nucleic acid fragment according to claim 1, is characterized in that, the length of described nucleic acid fragment is 10-100,100-200, a 200-500 or 500-1000 Nucleotide; Preferably, the length of described nucleic acid fragment is 10-20,20-30,30-40,40-50,50-60, a 60-100 or 100-300 Nucleotide; Further preferably, described nucleic acid fragment is the sequence shown in SEQ ID NO.1,2,24-31.

3. allele specific oligonucleotide, described oligonucleotide with contain corresponding to the 1001st of SEQ ID NO.1 or corresponding to allelotrope fragment or all or part of hybridization of its complementary sequence in the mutational site of the 1300th of SEQ ID NO.2, wherein the Nucleotide in the mutational site of the 1300th of the 1001st of SEQ ID NO.1 the or SEQ ID NO.2 is T; Described allelotrope fragment is at least 10 continuous nucleotides or its complementary sequence in the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2.

4. allele specific oligonucleotide according to claim 3, is characterized in that, described oligonucleotide is probe or primer; Preferably, when described oligonucleotide was probe, the length of described oligonucleotide was 5-100 Nucleotide; When described oligonucleotide was primer, the length of described oligonucleotide was 15-40 Nucleotide; Preferably, when described oligonucleotide was probe, described mutational site was positioned at center or about center of probe sequence; When described oligonucleotide was primer, described mutational site was positioned at 3 ' end of primer.

5. allele specific oligonucleotide according to claim 4, is characterized in that, described oligonucleotide is the sequence as shown in SEQ ID NO.32-38.

For detection of and/or the test kit of analysis list base mutation, comprise the described nucleic acid fragment of claim 1 or 2 and/or the described allele specific oligonucleotide of claim 3-5 any one; Perhaps comprise the sequence fragment shown in SEQ ID NO.14 and/or SEQ ID NO.15 and/or SEQ ID NO.23.

7. the described nucleic acid fragment of claim 1 or 2 and/or the described allele specific oligonucleotide of the claim 3-5 any one application in detecting the CYP2C9 transgenation, wherein said nucleic acid fragment or oligonucleotide are as probe or primer.

8. a medication guide, comprise the 1001st or the single base mutation of the 1300th of SEQ ID NO.2 corresponding to the SEQ ID NO.1 that detect CYP2C9 gene in testing sample, according to the sudden change that detects, adjust the dosage through the medicine of CYP2C9 metabolism, preferably, described medicine is endoxan, ifosfamide, taxol, warfarin, Acenocoumarol, mephenytoin, tolbutamide, nateglinide, pioglitazone, rosiglitazone, Phenytoin Sodium Salt, zonisamide, amodiaquine, Tirian, quinine, amitriptyline, citalopram, imipramine, Perospirone, Sertraline, thioridazine, Venlafaxine, losartan, irbesartan, valsartan, diclofenac, pyramidon, quinizine, celecoxib, flurbiprofen, Ibuprofen BP/EP, indomethacin, lornoxicam, mefenamic acid, Naproxen Base, piroxicam, tenoxicam, Loperamide, methadone, morphine, lansoprazole, omeprazole, clobazam, Mephogarbital or Zopiclone.

9. the method for an analysis of nucleic acids, comprise analyze in testing sample comprise corresponding in the nucleic acid of the sequence of SEQ ID NO.1 corresponding to the Nucleotide of the 1001st or analyze in testing sample comprise corresponding in the nucleic acid of the sequence of SEQ ID NO.2 corresponding to the Nucleotide of the 1300th; Preferably, described method is sequencing, restriction fragment length polymorphism analysis or probe hybridization method.

10.CYP2C9 albumen or its fragment or varient, described protein sequence are the sequence shown in SEQ ID NO.3; Described fragment or varient comprise the phenylalanine of the 434th corresponding to SEQ ID NO.3, and are at least 10 continuous amino acids of the aminoacid sequence shown in SEQ ID NO.3.