CN103194463B

CN103194463B - Comprise the CYP2C9 gene fragment of 1009C > A sudden change, coded protein fragments and application thereof

Info

Publication number: CN103194463B
Application number: CN201310093474.0A
Authority: CN
Inventors: 蔡剑平; 戴大鹏; 胡国新; 李传保; 王双虎; 耿培武
Original assignee: Beijing Hospital
Current assignee: Beijing Hospital
Priority date: 2013-03-22
Filing date: 2013-03-22
Publication date: 2015-11-18
Anticipated expiration: 2033-03-22
Also published as: CN103194463A

Abstract

The invention belongs to field of biology, relate to single base mutation.More specifically, the present invention relates to CYP2C9 gene and correspond to SEQ? ID? the mutational site of the 1009th of NO.2, described site sports A by the C of wild-type, comprises the nucleic acid fragment in this mutational site, its protein fragments of encoding and application thereof.Present invention also offers the allele specific oligonucleotide, test kit and the detection method that detect described mutational site.

Description

Comprise the CYP2C9 gene fragment of 1009C > A sudden change, coded protein fragments and application thereof

Technical field

The invention belongs to field of biology, relate to single base mutation.More specifically, the present invention relates to CYP2C9 gene relative to the 1001st of SEQIDNO.1 or the mutational site of the 1009th of SEQIDNO.2, comprise the nucleic acid fragment in this mutational site and the protein fragments of corresponding encoded thereof.The invention still further relates to the reagent and detection method of identifying described mutational site, and identify the application of this site in direction of medication usage.

Background technology

CYP2C9 is most important a member in cytochrome P 450 enzymes extended familys CYP2C subfamily, accounts for 20% of people's hepatomicrosome CYP enzyme total amount.There are about 10 ~ 16% clinical commonly used drugs via CYP2C9 oxidative metabolism, wherein mainly comprise tolbutamide, S-warfarin, Phenytoin Sodium Salt, Glipizide, U26452, holder draw the medicines (see reference 1-5) such as thiophene miaow, losartan, irbesartan and many non-steroidal anti-inflammatory drugs (as: Ibuprofen BP/EP, lornoxicam, diclofenac and Naproxen Base).

CYP2C9 gene has height polymorphism.So far, named allelotrope has 57 kinds (http://www.cypalleles.ki.se) in the world, removing wild-type (CYP2C9*1) outward, having 56 kinds of mutation types can cause CYP2C9 Argine Monohydrochloride composition to change, and also has multiple newfound sudden change not yet to be named in addition.Study more and the mutation type that clinical meaning is larger mainly comprises following 10 kinds: CYP2C9*2, * 3, * 5, * 6, * 8, * 11, * 12, * 13, * 14, * 16, wherein the widest, that most study, Chinese population research data are the relatively the abundantest saltant type of ethnic group distribution is CYP2C9*2(430C>T), CYP2C9*3(1075A>C) (see reference 6-17,20).

According to current clinical studies show, this polymorphism of CYP2C9 gene is the major cause causing CYP2C9 enzymic activity greatly different between individuals, therefore carrying the huge difference that can cause curative effect of medication between the genotypic individuality of different CYP2C9, even producing serious poisonous side effect of medicine or treat insufficient.Therefore, study CYP2C9 gene pleiomorphism and will provide important scientific basis (see reference 18,19,21,22) to clinical rational drug use to the impact of curative effect of medication.

Summary of the invention

The object of this invention is to provide the new single base mutation site of CYP2C9 gene, comprise the nucleic acid fragment in this mutational site, its protein fragments of encoding and identify the application of this mutational site in medication guide.

First aspect of the present invention is to provide nucleic acid fragment, described nucleic acid fragment comprises the mutational site of the 1001st corresponding to SEQIDNO.1, and be at least 10 continuous nucleotides in the nucleotide sequence shown in SEQIDNO.1, wherein the Nucleotide of the 1001st is A; Or described nucleic acid fragment comprises the mutational site of the 1009th corresponding to SEQIDNO.2, and is at least 10 continuous nucleotides in the nucleotide sequence shown in SEQIDNO.2, and wherein the Nucleotide of the 1009th is A; Or be the complementary sequence of above-mentioned nucleic acid fragment.

Second aspect of the present invention be to provide with containing corresponding to the 1001st of SEQIDNO.1 or correspond to the allelotrope fragment in the mutational site of the 1009th or the allele specific oligonucleotide of all or part of hybridization of its complementary sequence of SEQIDNO.2, wherein the Nucleotide in the mutational site of the 1001st of SEQIDNO.1 or the 1009th of SEQIDNO.2 is A; Described allelotrope fragment is at least 10 continuous nucleotides in the nucleotide sequence shown in SEQIDNO.1 or SEQIDNO.2 or its complementary sequence.

3rd aspect of the present invention is to provide for detecting and/or the test kit of analysis list base mutation, described test kit comprises nucleic acid fragment of the present invention or allele specific oligonucleotide, or comprises the sequence fragment shown in SEQIDNO.12 and/or SEQIDNO.13 and/or SEQIDNO.21.

4th aspect of the present invention is to provide nucleic acid fragment of the present invention or oligonucleotide is detecting the application in CYP2C9 transgenation, and wherein said nucleic acid fragment or oligonucleotide are used as probe or primer.

5th aspect of the present invention is to provide a kind of medication guide, comprises the single base mutation corresponding to the 1001st of SEQIDNO.1 or the 1009th of SEQIDNO.2 detecting CYP2C9 gene in testing sample; According to the sudden change detected, adjust by the dosage of the medicine of CYP2C9 metabolism.

6th aspect of the present invention is to provide the method for analysis of nucleic acids, and described method comprises in the nucleic acid comprising corresponding to the sequence of SEQIDNO.1 analyzed in testing sample the Nucleotide that corresponds to the 1001st or analyzes in the nucleic acid comprising corresponding to the sequence of SEQIDNO.2 in testing sample the Nucleotide corresponding to the 1009th.

7th aspect of the present invention is to provide CYP2C9 albumen or its fragment or varient, and described protein sequence is the sequence shown in SEQIDNO.3; Described fragment or varient comprise the Threonine of the 337th corresponding to SEQIDNO.3, and are at least 10 continuous amino acids of the aminoacid sequence shown in SEQIDNO.3.

The invention provides the CYP2C9 gene and encoding sequence that comprise new single base mutation.The 1009th Nucleotide that this gene is corresponding to SEQIDNO.2 sports A(1009C>A by C), thus the amino acid causing it to encode sports Threonine by proline(Pro), namely corresponds to the Threonine of the 337th of SEQIDNO.3.The CYP2C9 albumen (called after P337T) of this sudden change declines than wild-type to the metabolic activity of medicine.The medication of this single base mutation to the individuality carrying this mutational site has directive significance.

Accompanying drawing explanation

Fig. 1 is the 1001st the nucleotide sequencing collection of illustrative plates corresponding to SEQIDNO.1 sequence of the present invention in embodiment 1;

Fig. 2 is insect expression vector pFastBac-dual structure iron;

Fig. 3 is the Western result figure of each microsome expressing protein in embodiment 2;

Fig. 4 is the data plot of each microsomal metabolism diclofenac in embodiment 3;

Fig. 5 is the data plot of each microsomal metabolism tolbutamide in embodiment 4;

Fig. 6 is the data plot of each microsomal metabolism losartan in embodiment 5.

Embodiment

By following embodiment, the present invention is described, but content of the present invention is not limited thereto.

As illustrated without other, " nucleic acid fragment " of the present invention is made up of Nucleotide or its analogue, can be the fragment of DNA, RNA or its analogue; Can be strand or double-strand; Can be natural (as genomic) or synthesis.

In the present invention, " sudden change " refers to the gene detected, and namely there is the nucleotide site different from wild-type CYP2C9 gene order in CYP2C9 gene." mutational site " refers to the position that base is undergone mutation.In the present invention, described mutational site corresponds to the 1009th in sequence shown in the 1001st of sequence shown in SEQIDNO.1 or SEQIDNO.2.

In the present invention, " allele-specific " refers to hybridize with allelotrope specifically, as hybridized under high stringency conditions, makes to identify that the 1009th Nucleotide corresponding to sequence shown in the 1001st of sequence shown in SEQIDNO.1 or SEQIDNO.2 is A.

Content of the present invention relates to the nonsynonymous mutation of CYP2C9 gene.Because this mutational site is arranged in the encoding sequence of gene, therefore, those skilled in the art are known, and described mutational site both can show in genomic dna, also can performance in encoding sequence (i.e. CDS, corresponding to mRNA sequence).Those skilled in the art, according to detected sample, can detect this mutational site on genomic dna or mRNA level in-site.In the application, SEQIDNO.1 be centered by the mutational site of the application, the genomic dna sequence of each 1kb in front and back, namely the 1001st of SEQIDNO.1 is the mutational site that the present invention relates to.SEQIDNO.2 is the cDNA sequence of the CYP2C9 gene with described mutational site, and wherein the 1009th is the mutational site that the present invention relates to.Those skilled in the art are known, and in this article, the 1009th site corresponding to SEQIDNO.2 and the 1001st the site synonym corresponding to SEQIDNO.1 are used mutually.

In the present invention, Nucleotide and amino acid whose abbreviation adopt abbreviation mode well known in the art, and as in Nucleotide, A represents VITAMIN B4, G represents guanine, and C represents cytosine(Cyt), and T represents thymus pyrimidine.In amino acid, A represents L-Ala, and R represents arginine, and N represents l-asparagine, D represents aspartic acid, and C represents halfcystine, and Q represents glutamine, and E represents L-glutamic acid, G represents glycine, and H represents Histidine, and I represents Isoleucine, and L represents leucine, K represents Methionin, and M represents methionine(Met), and F represents phenylalanine, P represents proline(Pro), and S represents Serine, and T represents Threonine, W represents tryptophane, and Y represents tyrosine, and V represents α-amino-isovaleric acid.

Content of the present invention is the new single base mutation site based on CYP2C9 gene.Described mutational site is the coding region being positioned at CYP2C9 gene, and corresponding to the 1009th of SEQIDNO.2, this site sports A(1009C>A by the C of wild-type); In addition, Threonine (P337T) is sported by the 337th of albumen of the CYP2C9 genes encoding of this sudden change by proline(Pro).

In first, the invention provides nucleic acid fragment, described nucleic acid fragment comprises the mutational site of the 1001st corresponding to SEQIDNO.1, and is at least 10 continuous nucleotides in the nucleotide sequence shown in SEQIDNO.1, and wherein the Nucleotide of the 1001st is A; Or described nucleic acid fragment comprises the mutational site of the 1009th corresponding to SEQIDNO.2, and is at least 10 continuous nucleotides in the nucleotide sequence shown in SEQIDNO.2, and wherein the Nucleotide of the 1009th is A; Or be the complementary sequence of above-mentioned nucleic acid fragment.

In one embodiment, the length of described nucleic acid fragment can be as 10-100,100-200,200-500,500-1000 Nucleotide.Preferably, the length of described nucleic acid fragment is 10-20,20-30,30-40,40-50,50-60,60-100 or 100-300 Nucleotide.

Described mutational site can be positioned at any position of described nucleic acid fragment.

In another embodiment, described nucleic acid fragment is the sequence shown in SEQIDNO.1.

In another embodiment, described nucleic acid fragment is the sequence shown in SEQIDNO.2.

In other embodiments, described nucleic acid fragment can be the sequence shown in SEQIDNO.24-31.

In one embodiment, described oligonucleotide is used as probe.Described probe can under high stringency conditions with comprise the target sequence specific hybrid in mutational site.It is known to those skilled in the art that described probe does not need and target sequence complete complementary, if can with target sequence specific hybridization.In preferred embodiments, described hybridization conditions can meet make probe only with target sequence specific hybrid.The length of described probe can be 5-100 Nucleotide, as 5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,40,50,60,70,80,90 or 100 Nucleotide.Described mutational site can appear at any position of probe.In a preferred embodiment, described mutational site appears at the center of probe sequence or about center.

In another embodiment, the described oligonucleotide primer of the DNA synthesis that coaches, sequencing primer as known in the art or synthetic primer etc.Described primer does not need and template complete complementary, but should synthesize to instruct DNA with template Complementary hybridization.The length of described primer can be 15-40 length of nucleotides, is preferably 18,19,20,21,22,23,24,25,26,27,28,29 or 30 Nucleotide.Described mutational site can appear at any position of described primer; Preferably, described mutational site appears at 3 ' end of described primer.

Some preferred embodiment in, described oligonucleotide is the sequence as shown in SEQIDNO.32-38.

Based on this, 3rd aspect of the present invention is to provide for detecting and/or the test kit of analysis list base mutation, described test kit comprises nucleic acid fragment of the present invention or allele specific oligonucleotide, or comprises the sequence fragment shown in SEQIDNO.12 and/or SEQIDNO.13 and/or SEQIDNO.21.

4th aspect of the present invention is to provide nucleic acid fragment of the present invention or oligonucleotide for detecting the application of CYP2C9 transgenation, and wherein said nucleic acid fragment or oligonucleotide are used as probe or primer.

5th aspect of the present invention is to provide medication guide, comprises the single base mutation corresponding to the 1001st of SEQIDNO.1 or the 1009th of SEQIDNO.2 detecting CYP2C9 gene in testing sample.When the CYP2C9 gene detected is when the site corresponding to the 1001st of SEQIDNO.1 or the 1009th of SEQIDNO.2 is A, adjust the dosage of the medicine through CYP2C9 metabolism accordingly.In the particular embodiment, when CYP2C9 gene is when the site of the 1009th of SEQIDNO.2 is A, the CYP2C9 protease activity of this genes encoding declines, therefore needs adjustment through the dosage of the medicine of CYP2C9 metabolism.

The medicine through CYP2C9 metabolism described in the present invention comprises: cancer therapy drug, as endoxan, ifosfamide or taxol; Anticoagulant, as warfarin, Acenocoumarol, anticonvulsive drug or mephenytoin; Antidiabetic drug, as tolbutamide, nateglinide, pioglitazone or rosiglitazone; Antiepileptic drug, as Phenytoin Sodium Salt or zonisamide; Antimalarial drug/antiparasitic, as amodiaquine, Tirian or quinine; Antipsychotic drug, as amitriptyline, citalopram, imipramine, Perospirone, Sertraline, thioridazine or Venlafaxine; Depressor, as losartan, irbesartan or valsartan; Non-steroidal anti-inflammatory drug, as diclofenac, pyramidon, quinizine, celecoxib, flurbiprofen, Ibuprofen BP/EP, indomethacin, lornoxicam, mefenamic acid, Naproxen Base, piroxicam or tenoxicam; Anodyne, as, Loperamide, methadone or morphine; Proton pump inhibitor, as lansoprazole or omeprazole; Tranquilizer, as, clobazam, Mephogarbital or Zopiclone.

In one embodiment, described method can be restriction fragment length polymorphism analysis (RFLP).Whether those skilled in the art can according to content design experiment of the present invention analyze the Nucleotide of the 1009th in the nucleic acid of the Nucleotide of the 1001st in the nucleic acid of the sequence of SEQIDNO.1 or the sequence of SEQIDNO.2 for A.

In another embodiment, described method can be sequencing, comprise and being separated and the nucleotide sequence measured from genomic dna or RNA, analyze and wherein comprise corresponding to corresponding to the Nucleotide of the 1001st or comprising corresponding to corresponding to whether the Nucleotide of the 1009th is A in the nucleic acid of the sequence of SEQIDNO.2 in the nucleic acid of the sequence of SEQIDNO.1.Sequencing can be any available sequence measurement known in the art.Sequencing primer can design according to the general knowledge of those skilled in the art, as the upstream and downstream appropriate position design primer in site to be detected, with the fragment of expanding packet containing this site to be measured, thus judges the Nucleotide in this site.Also oligonucleotide of the present invention can be adopted as primer sequence.

In another embodiment, described method is the method utilizing probe hybridization, and whether the Nucleotide comprised in identification and detection sample specifically corresponding to corresponding to the 1009th in the Nucleotide corresponding to the 1001st in the nucleic acid of the sequence of SEQIDNO.1 or the nucleic acid comprising corresponding to the sequence of SEQIDNO.2 is A; The probe adopted in described method is oligonucleotide of the present invention.Such as, from testing sample, isolate nucleic acid, under the condition allowing probe and the specific target sequence that may exist in nucleic acid to hybridize, probe is contacted with nucleic acid; The hybridization that can be detected can be realized by the probe that detectable reagent is labeled by using; Such as, form the enzyme that can detect product with radio isotope, fluorescence dye or energy catalysis and carry out label probe.Label probe, to detect in sample with label probe the method that whether there is target sequence be all well-known to those skilled in the art.

In a kind of concrete embodiment, the method detecting the Nucleotide of the 1001st corresponding to SEQIDNO.1 is provided, comprises with Taqman probe SNP detection method:

1) design primer to be used for specific amplification and to comprise the PCR primer of the 1001st corresponding to SEQIDNO.1, design two Taqman-MGB probes, respectively for C and the A allelotrope of the 1001st corresponding to SEQIDNO.1 simultaneously.

Design of primers principle is:

(1) choose should at the conservative section of gene for sequence;

(2) avoid primer self or and primer between form more than 4 or 4 and match continuously, avoid primer self to form pili annulati card structure;

(3) primer length is at 18 to 24 Nucleotide;

(4) Tm value at 55-65 DEG C, GC content at 40%-60%;

(5) the Tm value difference between primer avoids exceeding 2 DEG C;

(6) 3 ' end of primer is avoided using base A, and 3 ' of primer holds the base avoiding appearance more than 3 or 3 consecutive identical;

(7) pcr amplified fragment length is at 50bp-150bp;

(8) last 5 Nucleotide of prime end can not have G and C more than 2.TaqmanMGB probe design principle is:

(1) 5 ' end of probe is avoided occurring G;

(2) Tm value should be 65-67 DEG C;

(3) shorten TaqmanMGB probe, but probe length is no less than 13bp as far as possible;

(4) avoid the base duplicated, especially G base as far as possible, avoid the G of appearance more than 4 or 4 to repeat;

(5) mutational site of probe is placed on as far as possible the place of middle 1/3.Fluorophor can adopt FAM, VIC etc. to mark two allelotrope.

2) utilize above-mentioned primer and probe, real-time quantitative PCR is carried out to sample to be tested.

PCR condition: 95 DEG C of denaturations enter 30 amplification cycles after 10 minutes: 92 DEG C of sex change 12 seconds, 60 DEG C of annealing and extend 1 minute (this stage detects fluorescent signal).

3) data analysis.

According to the power of sample two kinds of fluorescence, analysis design mothod result, judges whether sample to be tested CYP2C9 gene exists 1009C>A sudden change.

In the present invention, described sample can be any sample comprising nucleic acid, as blood; Preferred described sample comes from people.Described nucleic acid can be DNA or coding RNA, is preferably genomic dna.The method of analysis of nucleic acids of the present invention can with DNA or RNA for target compound.Those skilled in the art are known, and when being when detecting target compound with DNA, analyze in the nucleic acid comprising corresponding to the sequence of SEQIDNO.1 in testing sample the Nucleotide corresponding to the 1001st, the probe used or primer are according to the sequences Design of SEQIDNO.1; When being when detecting target compound with RNA, analyze in the nucleic acid comprising corresponding to the sequence of SEQIDNO.2 in testing sample the Nucleotide corresponding to the 1009th, the probe used or primer are according to the sequences Design of SEQIDNO.2.

7th aspect of the present invention is to provide CYP2C9 albumen or its fragment or varient, and described protein sequence is the sequence shown in SEQIDNO.3; Described fragment or varient comprise the Threonine of the 337th corresponding to SEQIDNO.3, and are at least 10 continuous amino acids of the aminoacid sequence shown in SEQIDNO.3, as 10-20,20-50 or 50-100 amino acid.

To further illustrate the present invention by specific embodiment below, but following specific embodiment is only for exemplary object.

Embodiment

Embodiment 1: the qualification in the mutational site that people CYP2C9 gene is new

In the present embodiment, gather the obvious patient blood sample on the low side of clinical warfarin medication dose, extract the genomic dna in blood, design sequencing primer carries out sequence amplification, order-checking to 9 of CYP2C9 gene exons, analyzes its CYP2C9 gene and whether there is mutational site.

1) DNA is extracted:

5ml vein EDTA anticoagulated blood sample is taked from measured; Then according to common salting-out process and/or adopt special DNA extraction kit (DNA extraction kit of purchased from American Omega company) to extract the genomic dna of blood sample to be measured.

2) pcr amplification:

Design of amplification primers, increases to 9 exon sequences of the CYP2C9 gene in the genome DNA sample obtained.Described amplimer to sequence in table 1.

Adopt 50 μ lPCR reaction systems, comprising: 1 × PCR damping fluid, 1.5mMMgCl ₂, the genomic dna of 100 ~ 150ng, upstream and downstream primer are 0.2 μM, dNTP is the LATaqDNA polysaccharase 1.5U of 0.4mM, TaKaRa company.Pcr amplification loop parameter is as follows: 94 DEG C of denaturations 5 minutes, and 94 DEG C of sex change 30 seconds, anneal 30 seconds, 72 DEG C extend 2 points 30 seconds, extend 5 minutes again after 30 circulations.Annealing temperature is relevant to primer length, and actual temp is in table 1.

Use the GeneAmpPCRSystem9700 amplification instrument amplification of American AB I company.

Table 1: sequencing primer to and annealing temperature

3) purifying amplified production:

Get 50 μ lPCR amplified productions and carry out agarose gel electrophoresis separation, blade cuts object band.Reclaim test kit (Omega company) according to E.Z.N.A. gel and require that the DNA carrying out object band reclaims purifying.

4) check order:

With the product after recovery for template, use sequencing primer according to CEQ ^tMdTCS-QuickStartKit sequencing kit (Beckman company of the U.S.) requires that carrying out order-checking PCR reacts, and reaction terminates and after purifying, carries out being separated the sequence with interpretation amplified production with the CEQ8000 type gene sequencer of Beckman company of the U.S..Sequencing primer is in table 2.

Table 2: sequencing primer

Region	Sequencing primer (5 '-3 ')
		Exons 1	TACCTCTAGGGATACAC(SEQ ID NO.16)
Wai Xianzi2 &3	CTAACAACCAGGACTCATAAT(SEQ ID NO.17)
		Exon 4	TTGCTGTTAAGGGAATTTGTAGGTAAGATA(SEQ ID NO.18)
Exon 5	TAGTGGTCTATTTTGTTATTCATTCAT(SEQ ID NO.19)
		Exon 6	TTCCAGTTTCTATGTTG(SEQ ID NO.20)
Exon 7	ACCCGGTGATGGTAGAGGTT(SEQ ID NO.21)
		Exon 8	ACGGGATTTCCTCATCTG(SEQ ID NO.22)
Exon 9	CGATACACTGAACAGTTATTGC(SEQ ID NO.23)

5) data analysis:

The sequence recorded and wild-type CYP2C9*1 sequence (GenBank number of registration NM_000771.3) are compared.

By compare of analysis, find that the Nucleotide of the 1009th of CYP2C9 gene coding region becomes A(as shown in Figure 1 from C, wherein M represents C or A), this sudden change is positioned at the 7th exon of CYP2C9 gene.Infer in the protein of this CYP2C9 genes encoding accordingly, the 337th amino acids sports Threonine (T) by proline(Pro) (P).This sudden change now by P450 NK called after neomorph CYP2C9*58, but is not yet externally announced.

The method in qualification new mutant site is exemplarily given in the present embodiment.Those skilled in the art clearly can learn the method detecting specifically and comprise the 1001st Nucleotide corresponding to SEQIDNO.1 in testing sample according to foregoing: the nucleic acid in sample separation, carry out amplified reaction under experiment condition corresponding in the present embodiment, primer uses primer pair SEQIDNO.12 and 13; With sequencing primer SEQIDNO.21, the product of amplification is checked order; By sequencing result and wild-type results comparison, analyze the Nucleotide in the 1001st site corresponding to SEQIDNO.1.

Embodiment 2: the expression of target gene

To be connected with the plasmid vector (being presented by professor Zhou Shufeng of American South University of Florida) of the open reading frame of wild-type CYP2C9*1 for template, side-directed mutagenesis is utilized to obtain the open reading frame of CYP2C9*2, CYP2C9*3 and P337T mutant of the present invention respectively.Side-directed mutagenesis is techniques well known, and those skilled in the art, according to the template determined and target, unambiguously can know how to complete this step.

Then the ORF of three mutant genes of CYP2C9*1 gene and site-directed mutagenesis is cloned in the carrier pFastBac-dual being connected with cytochrome P450 reductase (OR), after making CYP2C9 gene and OR be placed in PH and p10 promotor respectively, build and express OR and CYP2C9(or its mutant simultaneously) dual-expression vector.The insertion point of pFastBac-dual carrier structure figure and CYP2C9 gene and OR is see Fig. 2.Not comprise CYP2C9 gene, only to include the carrier of OR gene as negative control vector (pOR).

According to Bac-to-Bac baculovirus expression system test kit (purchased from American Invitrogen company, for mass expressing external goal gene in insect cell) operation instruction, utilize the dual-expression vector that builds and control vector to pack P1 generation and P2 respectively for insect viruses, according to MOI(multiplicity-of-infection after institute obtains P2 generation virus mensuration titre) be 4 infect dose infect sf21 insect cell.Infect centrifugal collecting cell after 72 hours, use Ultrasonic Cell Disruptor (SONIC company of the U.S.) according to the energy excusing from death smudge cells of 40%, utilize differential centrifugation to extract insect cell microsome.The expression amount of CYP2C9 and OR in each microsome is detected by Western method; With CYP2C9 standard substance (being called for short STD, purchased from American BDGentest company), obtained microsome is carried out quantitatively.

Western result as shown in Figure 3.What the first row showed is CYP2C9 expression amount, and what the second row showed is OR expression amount.As seen from the figure, control vector pOR only expresses OR albumen, and 4 dual-expression vectors all express OR albumen, and expresses * 1, * 2, * 3 type CYP2C9 and P337T albumen of the present invention respectively.

Enzymes metabolism activation analysis

According to existing result of study, wild-type (the * 1 type) metabolic activity to various medicine is all higher, and the metabolic activity of * 2 types has obvious decline than the metabolic activity of wild-type, the metabolic activity of * 3 types is lower than * 2 types (see reference 18,19,21,22).Therefore, existing one is like this known together in the art: the enzyme expressed by same genotype can represent the metabolic activity to other substrate medicine to the metabolic activity of specific substrate.Thus, enzyme expressed by a certain genotype can analogize the metabolic activity (e.g., the metabolic activity of the enzyme metabolic activity of enzyme this genotype expressed by and wild-type expressed by can be compared) of the enzyme expressed by this genotype to other substrate medicine to specific substrate metabolic activity data.

Embodiment 3: utilize the Insect Microsomes analyzed in vitro obtained to the metabolic characteristic of diclofenac:

1) chromatographic condition: chromatographic column is ZORBAXSB-C18 post (2.1*150mm, 5-Micron, Agilent, the U.S.); Moving phase is 0.1%TFA: water: acetonitrile=20:35:45; Column temperature is 40 DEG C; Determined wavelength is: 280nm.

2) incubation conditions:

Reaction cumulative volume 200 μ L, comprising: 100mMTris-HCl (pH7.4), 1 × NADPH coenzyme generation system (Promega company of the U.S.), 2pmol cytochrome b5 and diclofenac (purchased from American Sigma company, reaction final concentration is 1-100 μM).After 37 DEG C of preincubate 5min, the restructuring microsome (expressing * 1, * 2, * 3 type CYP2C9, P337T of the present invention respectively) that the embodiment 2 adding 2-5pmol builds is to start reaction.37 DEG C hatch 20min after, add mark Carbamzepine (purchased from American Sigma company) in 100 μ L0.1MHCl and 10 μ L20ng/ μ L and vortex concussion 2min.After adding 800 μ L glacial acetic acid ethyl esters, vortex shakes 2min, with 10 at 4 DEG C, and the centrifugal 5min of 000 × g.Careful transfer organic layer, dries up with Nitrogen evaporator, then adds 100 μ L moving phases and redissolve and get 20 μ L in the e2695 type high performance liquid chromatograph of Waters and detect.

The Michaelis-Menten data results of the present embodiment as shown in Figure 4.Carry out pharmacokinetic analysis further, result is as shown in table 3:

Table 3: the pharmacokinetic analysis result of each microsomal metabolism diclofenac

Wherein, V _maxrepresent maximum speed of reaction (numerical value is larger, shows that catalytic efficiency is higher), K _mfor Michaelis-Menton constant (numerical value is larger, shows that catalytic efficiency is lower), V _max/ K _mthen reflect overall medicine clearance rate, be comprehensive performance assessment criteria, numerical value is lower, show that the overall the enzyme activity of mutant is lower, drug metabolic rate is lower, and the requirement of individuality to medicine of carrying this saltant type is lower, otherwise easily occurs drug intoxication phenomenon.

From Fig. 4 and table 3, the overall the enzyme activity of P337T of the present invention is starkly lower than wild-type * 1 type, a little less than saltant type * 2 type, but higher than saltant type * 3 type.

Embodiment 4: utilize the Insect Microsomes analyzed in vitro obtained to the metabolic characteristic of tolbutamide:

1) chromatographic condition: chromatographic column is ZORBAXSB-C18 post (2.1*150mm, 5-Micron, Agilent, the U.S.); Moving phase is 0.1%TFA: water: acetonitrile=20:40:40; Column temperature is 40 DEG C; Determined wavelength is: 230nm.

2) incubation conditions:

Reaction cumulative volume 200 μ L, comprising: 100mMTris-HCl (pH7.4), 1 × NADPH coenzyme generation system, 10pmol cytochrome b5 and tolbutamide (purchased from American Sigma company, reaction final concentration is 10-1000 μM).After 37 DEG C of preincubate 5min, the restructuring microsome that the embodiment 2 adding 10-20pmol builds starts reaction.37 DEG C hatch 60min after, add mark P-607 (purchased from American Sigma company) in 40 μ L0.1MHCl and 50 μ L20ng/ μ L and vortex concussion 2min.After adding 800 μ L glacial acetic acid ethyl esters, vortex shakes 2min, with 10 at 4 DEG C, and the centrifugal 5min of 000 × g.Careful transfer organic layer, dries up under Nitrogen evaporator, adds 100 μ L moving phases and redissolves and get 20 μ L in the e2695 type high performance liquid chromatograph of Waters and detect.

The Michaelis-Menten data results of the present embodiment as shown in Figure 5.Carry out pharmacokinetic analysis further, result is as shown in table 4:

Table 4: the pharmacokinetic analysis result of each microsomal metabolism tolbutamide

From Fig. 5 and table 4, the overall the enzyme activity of P337T of the present invention lower than wild-type * 1 type and saltant type * 2 type, but higher than saltant type * 3 type.

Embodiment 5: utilize the Insect Microsomes analyzed in vitro obtained to the metabolic characteristic of losartan

1, chromatographic condition: chromatographic column is ZORBAXSB-C18 post (2.1*150mm, 5-Micron, Agilent, the U.S.); Moving phase is 0.1%TFA: water: acetonitrile=20:42:38; Column temperature is 40 DEG C; Determined wavelength is: 230nm.

2, incubation conditions:

Reaction cumulative volume 200 μ L, comprising: 100mMTris-HCl (pH7.4), 1 × NADPH coenzyme generation system, 10pmol cytochrome b5 and losartan (purchased from American Sigma company, reaction final concentration is 0.5-25 μM).After 37 DEG C of preincubate 5min, the restructuring microsome that the embodiment 2 adding 10-20pmol builds starts reaction.37 DEG C hatch 30min after, add mark diazepam (purchased from American Sigma company) in 40 μ L0.1MHCl and 10 μ L10ng/ μ L and vortex concussion 2min.After adding 800 μ L glacial acetic acid ethyl esters, vortex shakes 2min, with 10 at 4 DEG C, and the centrifugal 5min of 000 × g.Careful transfer organic layer, dries up under Nitrogen evaporator, adds 100 μ L moving phases and redissolves and get 20 μ L and detect in Waterse2695 type high performance liquid chromatograph.

The Michaelis-Menten data results of the present embodiment as shown in Figure 6.Carry out pharmacokinetic analysis further, result is as shown in table 5:

Table 5: the pharmacokinetic analysis result of each microsomal metabolism losartan

From Fig. 5 and table 4, the overall the enzyme activity of P337T of the present invention far below wild-type * 1 type, also lower than saltant type * 2 type and * 3 types.

Can find out according to above-described embodiment, P337T mutant enzyme metabolic activity of the present invention is well below wild-type * 1 type, and relative to saltant type * 2 type and * 3 types, its metabolic activity is also lower.Therefore, in practice, need to consider suitably to regulate on dosage carrying this genotypic individuality, as reduced the usage quantity of medicine and avoiding the generation of adverse drug reaction.This adjustment of the medicine by gene targeting is even more important for the medicine (as warfarin, Phenytoin Sodium Salt etc.) that treatment window is narrow.

Sequence:

SEQIDNO.1: genomic dna sequence

TAAGACTTGTTTTGTGACCTAACATACGGTCAATTCTTGATAACAATCCATGTGCTGTGGAAAAGAATGTGTATTCTGTAGCAGTTGGATAAAATATCCTGCAAATATCTATGAGATCCATTTGATCTATAGTGCAGATGAATTTCAATGTTTCCTTGTTGATTTTCTATCTGGATGACCTGTCCAATGCTGAAAGTGGGGTGTTGAAGTCTCCAGGTATTATTATATTGGGGCCTATCTCTCTCTAGTTCTAATTATATGTCTTTTATATATCTGGGTGCTGCATTATTGGTTGCATATATATTTAAACTTGTTCCATCTTCTTGCCAAGCTGACCACTTTATCACCAATAGTGATCTTCTTTGTGTCTCCTTATGGTTTTTGTTTTGAAATCTACTTTGTCTGTTTTAAATATAGTAACTCATGCTCTTTTTTTCATTTCCATTGGCAGGTACTGTCTCATTCAATTCCTTTATTTTCAGCCTATGTGTGTCTTTATAAGTGAAGTGTGTTTCTTTTAGGCAACAGATTAATAGGTCTTGTTTTTCCATCCAGGTCAGTAACAGGTCAGTATGTCTTTTGATTGGAGATTTTATTCCATTTACATTCAGTGTTATTATTGATAAGTAAGGACTTACCCATGCCCCTTTGTTATTTGTTTTCTGGTTGTTTTGTGGACTTCTCTTCCTTCTTTCATTTCTTCCTGTCTTCCTTTATTGAAGAGAATTTTCTCCACTTATATGTGTACAGATTTTTCTTAATATCTGGTTTATGGCAGTTACACATTTGTGCATCTGTAACCATCCTCTCTTTAAGTTTGCATATACTTCCAGCACTATAATTTAAATTTATAATGATGTTTGGATACCTTCATGATTCATATACCCCTGAATTGCTACAACAAATGTGCCATTTTTCTCCTTTTCCATCAGTTTTTACTTGTGTCTTATCAGCTAAAGTCCAGGAAGAGATTGAACGTGTGATTGGCAGAAACCGGAGCACCTGCATGCAAGACAGGAGCCACATGCCCTACACAGATGCTGTGGTGCACGAGGTCCAGAGATACATTGACCTTCTCCCCACCAGCCTGCCCCATGCAGTGACCTGTGACATTAAATTCAGAAACTATCTCATTCCCAAGGTAAGTTTGTTTCTCCTACACTGCAACTCCATGTTTTCGAAGTCCCCAAATTCATAGTATCATTTTTAAACCTCTACCATCACCGGGTGAGAGAAGTGCATAACTCATATGTATGGCAGTTTAACTGGACTTTCTCTTGTTTCCAGTTTGGGGCTATAAAGGTTTGTAACAGGTCCTAGTGTCTGGCAGTGTGTGTTCTCCAGATTTATTATCTTTCTTCAAGATTGGTTTGGCTACTCTTAGGTGCTTATATTTCCAAATAATTTTTAAAGGTATTAGTTTGTCAATTTCCCAAAACCTTGGGCTGGAATTTCTGGCAGGGTGACACTAAATTTATAGGCTAGTTTGGAAAGAACTGAATCTTGACACGTTGAGGCTTTCCATTCCTGAATATAATTATGCTTCCAATTTGTTTGGGGTTTCTTTTATTTAACCAGGAATGTTGTGAATTTGTTGTCATGGCTTTCGAGTCTTTGGTTTTCCCTAGATAATTAATATTTTTGTTGTAGAACATAAATAGTTTTTATCATTCTGATGATGTTAATCTGTCAACTTTGCTAAATTTACTAGTCACTATTCGTAATTTATTTCTGGATTCATTGTAATTTCTGTGTATATTATACTGTATCTGAGTTAATATTGTTTTATTTCTTATTTTCCATTTCTCATGGGCTTAATGTCTCTTTATCACATTCATTATTGCATTAGCTAGAATTTCTAGGAGAGCATTGAATAGAATTGGTGACAGTGGGGATCCTTGTTTCTCATTTCTAATCTGCAGGAAGCAGTGGAAGTTTTCCATTTCAATATTGAGAATGATGCTTGAAGTAGATTTTGGTAGATATTTTTTATCAGATTAG

SEQIDNO.2: encoding sequence

ATGGATTCTCTTGTGGTCCTTGTGCTCTGTCTCTCATGTTTGCTTCTCCTTTCACTCTGGAGACAGAGCTCTGGGAGAGGAAAACTCCCTCCTGGCCCCACTCCTCTCCCAGTGATTGGAAATATCCTACAGATAGGTATTAAGGACATCAGCAAATCCTTAACCAATCTCTCAAAGGTCTATGGCCCTGTGTTCACTCTGTATTTTGGCCTGAAACCCATAGTGGTGCTGCATGGATATGAAGCAGTGAAGGAAGCCCTGATTGATCTTGGAGAGGAGTTTTCTGCAAGAGGCATTTTCCCACTGGCTGAAAGAGCTAACAGAGGATTTGGAATTGTTTTCAGCAATGGAAAGAAATGGAAGGAGATCCGGCGTTTCTCCCTCATGACGCTGCGGAATTTTGGGATGGGGAAGAGGAGCATTGAGGACCGTGTTCAAGAGGAAGCCCGCTGCCTTGTGGAGGAGTTGAGAAAAACCAAGGCCTCACCCTGTGATCCCACTTTCATCCTGGGCTGTGCTCCCTGCAATGTGATCTGCTCCATTATTTTCCATAAACGTTTTGATTATAAAGATCAGCAATTTCTTAACTTAATGGAAAAGTTGAATGAAAACATCAAGATTTTGAGCAGCCCCTGGATCCAGATCTGCAATAATTTTTCTCCTATCATTGATTACTTCCCGGGAACTCACAACAAATTACTTAAAAACGTTGCTTTTATGAAAAGTTATATTTTGGAAAAAGTAAAAGAACACCAAGAATCAATGGACATGAACAACCCTCAGGACTTTATTGATTGCTTCCTGATGAAAATGGAGAAGGAAAAGCACAACCAACCATCTGAATTTACTATTGAAAGCTTGGAAAACACTGCAGTTGACTTGTTTGGAGCTGGGACAGAGACGACAAGCACAACCCTGAGATATGCTCTCCTTCTCCTGCTGAAGCACCCAGAGGTCACAGCTAAAGTCCAGGAAGAGATTGAACGTGTGATTGGCAGAAACCGGAGCACCTGCATGCAAGACAGGAGCCACATGCCCTACACAGATGCTGTGGTGCACGAGGTCCAGAGATACATTGACCTTCTCCCCACCAGCCTGCCCCATGCAGTGACCTGTGACATTAAATTCAGAAACTATCTCATTCCCAAGGGCACAACCATATTAATTTCCCTGACTTCTGTGCTACATGACAACAAAGAATTTCCCAACCCAGAGATGTTTGACCCTCATCACTTTCTGGATGAAGGTGGCAATTTTAAGAAAAGTAAATACTTCATGCCTTTCTCAGCAGGAAAACGGATTTGTGTGGGAGAAGCCCTGGCCGGCATGGAGCTGTTTTTATTCCTGACCTCCATTTTACAGAACTTTAACCTGAAATCTCTGGTTGACCCAAAGAACCTTGACACCACTCCAGTTGTCAATGGATTTGCCTCTGTGCCGCCCTTCTACCAGCTGTGCTTCATTCCTGTCTGA

SEQIDNO.3: protein sequence

MDSLVVLVLCLSCLLLLSLWRQSSGRGKLPPGPTPLPVIGNILQIGIKDISKSLTNLSKVYGPVFTLYFGLKPIVVLHGYEAVKEALIDLGEEFSARGIFPLAERANRGFGIVFSNGKKWKEIRRFSLMTLRNFGMGKRSIEDRVQEEARCLVEELRKTKASPCDPTFILGCAPCNVICSIIFHKRFDYKDQQFLNLMEKLNENIKILSSPWIQICNNFSPIIDYFPGTHNKLLKNVAFMKSYILEKVKEHQESMDMNNPQDFIDCFLMKMEKEKHNQPSEFTIESLENTAVDLFGAGTETTSTTLRYALLLLLKHPEVTAKVQEEIERVIGRNRSTCMQDRSHMPYTDAVVHEVQRYIDLLPTSLPHAVTCDIKFRNYLIPKGTTILISLTSVLHDNKEFPNPEMFDPHHFLDEGGNFKKSKYFMPFSAGKRICVGEALAGMELFLFLTSILQNFNLKSLVDPKNLDTTPVVNGFASVPPFYQLCFIPV

SEQIDNO.24: nucleic acid fragment

CCGGAGCACCTGCAT

SEQIDNO.25: nucleic acid fragment

AGCACCTGCATGCAAGAC

SEQIDNO.26: nucleic acid fragment

AACCGGAGCACCTGCATGCAAGAC

SEQIDNO.27: nucleic acid fragment

ATTGGCAGAAACCGGAGCACCTGCATGCAAGACAG

SEQIDNO.28: nucleic acid fragment

CGGAGCACCTGCATGCAAGACAGGAGCCACAT

SEQIDNO.29: nucleic acid fragment

GAAACCGGAGCACCTGCATGCAAGACA

SEQIDNO.30: nucleic acid fragment

TGATTGGCAGAAACCGGAGCACCTGCATGCAAGACAGGAGC

SEQIDNO.31: nucleic acid fragment

CGTGTGATTGGCAGAAACCGGAGCACCTGCATGCAAGACAGGAGCCACATG

SEQIDNO.32: oligonucleotide sequence

CTGTCTTGCATGCAGGTG

SEQIDNO.33: oligonucleotide sequence

GCTCCTGTCTTGCATGCAGGTGC

SEQIDNO.34: oligonucleotide sequence

GTGGCTCCTGTCTTGCATGCAGGTG

SEQIDNO.35: oligonucleotide sequence

GCATGTGGCTCCTGTCTTGCATGCAGGTGC

SEQIDNO.36: oligonucleotide sequence

GTAGGGCATGTGGCTCCTGTCTTGCATGCAGGTGCT

SEQIDNO.37: oligonucleotide sequence

CAGGTGCTCCGGTTTC

SEQIDNO.38: oligonucleotide sequence

GCATGCAGGTGCTCCGGT

Reference:

1.AquilanteCA.SulfonylureapharmacogenomicsinType2diabetes:theinfluenceofdrugtargetanddiabetesriskpolymorphisms.ExpertRevCardiovascTher.2010;8(3):359–372.

2.XuHM,MurrayM,MclachlanAJ.Influenceofgeneticpolymorphismsonthepharmacokineticsandpharmacodynamicsofsulfonylureadrugs.CurrentDrugMetabolism.2009;10(6):643-658.

3.WangB,WangJ,HuangSQ,etal.GeneticpolymorphismofthehumancytochromeP4502C9geneanditsclinicalsignificance.CurrentDrugMetabolism.2009;10(7):781-834。

4. Li Zhi, Wang Guo, Zhou Honghao .CYP2C9 gene pleiomorphism and functional meaning progress thereof. Chinese Clinical pharmacology and therapeutics 2008; 13 (6): 601-609.

5.ZhouSh.F,LiuJ.P.ChowbayB.PolymorphismofhumancytochromeP450enzymesanditsclinicalimpact.DrugMetabRev.2009;41(2):89-295.

6.XiongY,WangM,FangKetal:AsystematicgeneticpolymorphismanalysisoftheCYP2C9geneinfourdifferentgeographicalHanpopulationsinmainlandChina.Genomics2011;97:277-281.

7.ZhuJ,ZhangW,LiY,WangH,ZhengW,WangC:ARMStestfordiagnosisofCYP2C9andVKORC1mutationinpatientswithpulmonaryembolisminHanChinese.Pharmacogenomics2010;11:113-119.

8.ZhangYN,CuiW,HanMetal:[GenepolymorphismofCYP4502C9andVKORC1inChinesepopulationandtheirrelationshipstothemaintainingdosageofwarfarin.].ZhonghuaLiuXingBingXueZaZhi2010;31:218-222.

9.LiZ,WangG,WangLSetal:EffectsoftheCYP2C9*13alleleonthepharmacokineticsoflosartaninhealthymalesubjects.Xenobiotica2009;39:788-793.

10.YuBN,LuoCH,WangDetal:CYP2C9allelevariantsinChinesehypertensionpatientsandhealthycontrols.ClinChimActa2004;348:57-61.

11.YangJQ,MorinS,VerstuyftCetal:FrequencyofcytochromeP4502C9allelicvariantsintheChineseandFrenchpopulations.FundamClinPharmacol2003;17:373-376.

12.WangSL,HuangJ,LaiMD,TsaiJJ:DetectionofCYP2C9polymorphismbasedonthepolymerasechainreactioninChinese.Pharmacogenetics1995;5:37-42.

13. horse Jingjings, Li Jinheng, Cheng Lu. three dimensional gel gene chips Study of China crowd CYP2C9 and CYP2C19 gene pleiomorphism. Chinese Clinical pharmacology and therapeutics 2009; 14 (9): 966-973.

14. Zhao Gang great waves, the .Pyrosequencing such as Ding Yuanyuan, Yang Fan detect foundation and the reliability consideration thereof of CYP2C9*3 gene pleiomorphism method. Chinese Clinical pharmacology and therapeutics 2009; 14 (7): 799-803.

15. Ma Xinchao, Yang Jian, Huang Chenrong etc. the gene pleiomorphism of vitamin K epoxide reductase subunit 1 unit 1 cytochrome P450 2C9 in Han population in Jiangsu province. University Of Suzhou's journal (medicine) 2009; 29 (2): 279-282.

16. Tang and year, cuckoo Kui, Zhang Zonggang. the research of Xinjiang Uygur healthy population cytochrome P450 gene polymorphism. Chinese medicine and clinical 2007; 7 (2): 91-94.

How 17. shake space, Sun Limin, Li Yueqin etc. Guangdong crowd CYP2C9 allelotrope and genotype distribution frequency. and Guangdong medical science 2006; 27 (8): 1131-1132.

18.RokittaD,FuhrU.ComparisonofenzymekineticparametersobtainedinvitroforreactionsmediatedbyhumanCYP2CenzymesincludingmajorCYP2C9variants.CurrDrugMetab.2010;11(2):153-161.

19.VanBoovenD,MarshS,McLeodHetal:CytochromeP4502C9-CYP2C9.PharmacogenetGenomics2010;20:277-281.

20.SiD,GuoY,ZhangY,YangL,ZhouH,ZhongD.IdentificationofanovelvariantCYP2C9alleleinChinese.Pharmacogenetics.2004;14(7):465-469.

21.HiratsukaM:InvitroassessmentoftheallelicvariantsofcytochromeP450.DrugMetabPharmacokinet2011.

22.GuoY,WangY,SiD,FawcettPJ,ZhongD,ZhouH.CatalyticactivitiesofhumancytochromeP4502C9*1,2C9*3and2C9*13.Xenobiotica2005;35:853-861.

23.ZhouSF,ZhouZW,YangLP,CaiJP:Substrates,inducers,inhibitorsandstructure-activityrelationshipsofhumanCytochromeP4502C9andimplicationsindrugdevelopment.CurrMedChem2009;16:3480-3675.

24.CaliJJ,MaD,SobolMetal:LuminogeniccytochromeP450assays.ExpertOpinDrugMetabToxicol2006;2:629-645.

25.AnzenbacherovaE,VeinlichovaA,MasekV,AnzenbacherP:Comparisonof"highthroughput"micromethodsfordeterminationofcytochromeP450activitieswithclassicalmethodsusingHPLCforproductidentification.BiomedPapMedFacUnivPalackyOlomoucCzechRepub2005;149:353-355.

Claims

1. nucleic acid fragment, described nucleic acid fragment comprises the mutational site of the 1001st corresponding to SEQIDNO.1, and is at least 10 continuous nucleotides in the nucleotide sequence shown in SEQIDNO.1 or its complementary sequence, and wherein the Nucleotide of the 1001st is A; Or described nucleic acid fragment comprises the mutational site of the 1009th corresponding to SEQIDNO.2, and is at least 10 continuous nucleotides in the nucleotide sequence shown in SEQIDNO.2 or its complementary sequence, and wherein the Nucleotide of the 1009th is A.

2. nucleic acid fragment according to claim 1, is characterized in that, the length of described nucleic acid fragment is 10-100,100-200,200-500 or 500-1000 Nucleotide.

3. nucleic acid fragment according to claim 2, is characterized in that, the length of described nucleic acid fragment is 10-20,20-30,30-40,40-50,50-60,60-100 or 100-300 Nucleotide.

4. nucleic acid fragment according to claim 1, is characterized in that, described nucleic acid fragment be SEQIDNO.1,2, the sequence shown in 24-31.

5., for detecting and/or the test kit of analysis list base mutation, comprise the nucleic acid fragment described in any one of claim 1-4; Or comprise the sequence fragment shown in SEQIDNO.12, SEQIDNO.13 and SEQIDNO.21.

6. the nucleic acid fragment described in any one of claim 1-4 detects the application in the preparation of CYP2C9 transgenation in preparation.

7.CYP2C9 albumen, described protein sequence is the sequence shown in SEQIDNO.3.