CN103103261A - Kit for detecting drug resistance of helicobacter pylori to clarithromycin and preparation method thereof - Google Patents

Abstract

The invention relates to a kit for detecting drug resistance of helicobacter pylori to clarithromycin and a preparation method thereof. The kit disclosed by the invention comprises a fecal DNA (deoxyribonucleic acid) extraction reagent, a PCR (polymerase chain reaction) reaction reagent, a PCR product purification reagent and a purified product enzyme digestion reagent; and the preparation method comprises the preparation of the DNA extraction reagent and the preparation of the PCR reaction reagent. The kit disclosed by the invention can overcome the defects of complex operation, poor stability and susceptibility to interference of external conditions of an E-test method used before, as well as the defects of complex operation, suffering of patients, unwillingness to matching of the patients and the like of a gastric mucosa DNA extraction method. The kit disclosed by the invention can transform macro-substances which are easy to obtain to molecular level for research, integrate bacterial DNA extraction, amplification, purification, enzyme digestion and other steps into a whole for completion, get a reliable drug resistance result of the helicobacter pylori to the clarithromycin, further realize the characteristics of simplicity and convenience in operation, low cost, less suffering of the patients, high compliance and the like in the aspect of getting testing specimens, simultaneously enable the detection process to be standardized, convenient and fast and be widely applied to clinical detection of drug resistance of the helicobacter pylori.

Description

Detect helicobacter pylori to clarithromycin resistance test kit and preparation method

Technical field

The present invention relates to the Drug Resistance Detection method, particularly detect helicobacter pylori to clarithromycin resistance test kit and preparation method.

Background technology

At present, China's Helicobacter Pylori Infection Rate surpasses 50%, and the part hotspot even arrives 70%-80%.Helicobacter pylori is considered to 1 class carcinogen, and long-term helicobacter pylori infection can cause atrophic gastritis, and intestinesization are given birth to even cancer of the stomach.Along with the helicobacter pylori Antibiotic Resistance increases, eradication rate reduces, and especially take the common antibiotics clarithromycin as outstanding, therefore detects its resistance situation to clarithromycin particularly important.

Before the present invention, detecting helicobacter pylori has the E-test method and gets stomach mucous membrane the resistance situation of common antibiotics and put forward two kinds of methods of DNA.The E-test method is a kind of detection method that is applied to various bacterial drug resistances, this method is mainly to be coated with collarium after mucosa tissue and to be coated with bacterium by getting for detection of helicobacter pylori to common antibiotics resistance situation, carry out liquid culture after 2-3 days, cultured bacterium is evenly coated on culture dish, by adding different microbiotic joint strips, judge its resistance situation according to the joint strip scale.But the method complicated operation, and poor stability are subject to ambient conditions and disturb, and therefore are not able to clinically widespread use.And stomach mucous membrane is put forward the DNA method mainly by getting the infected's stomach-tissue, and test kit extracts DNA, and after pcr amplification, enzyme is cut, and judges the mutational site by electrophoretic band, and then judgement bacterial resistance situation.There is complicated operation equally in this method, and patient's misery is reluctant the shortcomings such as cooperation, so this method also can't be in clinical middle application.

Summary of the invention

The object of the invention just is to overcome defects, studies a kind of detection helicobacter pylori to clarithromycin resistance test kit and preparation method thereof.

Technical scheme of the present invention is:

Detect helicobacter pylori to clarithromycin resistance test kit, its technical characteristics is this test kit by extracting faeces DNA reagent, and PCR reaction reagent, PCR product purification reagent and purified product enzyme are cut reagent and formed; Specifically be:

(1) wherein said extraction faeces DNA reagent comprises 2 * cetyl trimethylammonium bromide (CTAB), 2% mercaptoethanol, PBS damping fluid;

(2) wherein said PCR reaction reagent comprises primer 1, primer 2, primer 3, primer 4, Taq Premix (2 *);

(3) wherein said PCR product purification reagent comprises the 4mol/L ammonium acetate;

(4) wherein said purified product enzyme is cut reagent: enzyme 1, enzyme 2.

Another technical scheme of the present invention is:

Detect helicobacter pylori to clarithromycin resistance test kit working method, its technical characteristics is that the working method of test kit comprises the following steps:

(1) faeces DNA extracts: get proper amount of fresh ight soil, through after pre-treatment, add DNA extraction reagent to the gained precipitation, through centrifugal, put on and wait clearly series of steps, can obtain the DNA product;

(2) PCR reaction: the DNA, primer 1, primer 2, Taq Premix (2 *) and the ddH that add said extracted in the centrifuge tube ₂O carries out the twice PCR reaction, the product that obtains is carried out agarose gel electrophoresis detect, and can judge according to electrophoretic band to have or not helicobacter pylori infection;

(3) PCR product purification: draw the PCR product and be placed in the EP pipe, after adding equal-volume ammonium acetate, aqueous isopropanol, the vibration mixing through dry under with gained end product room temperature after 3 ethanol rinsings, the step such as centrifugal, adds 20ulddH ₂O puts 4 ℃ of refrigerators standby;

(4) the purified product enzyme is cut: add enzyme 1 in purified product, enzyme 2 is got 5ul product agarose gel electrophoresis and is detected after enzyme is cut, and can judge according to electrophoretic band to have or not the clarithromycin resistance to exist.

Another technical scheme of the present invention is:

Detect helicobacter pylori to clarithromycin resistance test kit preparation method, its major technique step is:

Preparation DNA extraction reagent:

(1) the aseptic PBS damping fluid of preparation: with 4gNaCl, 0.1gKCl, 1.7g Na ₂HPO ₄.12H ₂O, 0.1g KH ₂PO ₄Add 400ml ddH ₂In O, use ddH after adjusting Ph to 7.4 ₂O is settled to 500ml, inserts test kit after being distributed into 100ml;

(2) preparation 2 * CTAB extracting solution, its PH 8.0: by 2% CTAB, 1.4MNacl, 0.02MEDTA, 0.1MTris-cl, 0.2% mercaptoethanol forms, and namely takes CTAB 2g and adds ddH ₂O40ml adds 1MTris-cl10ml, PH8.0, and 0.5M EDTA4ml, PH 8.0 and 5M NaCl 28ml use ddH after the CTAB dissolving ₂The O constant volume adds 2% mercaptoethanol to 100ml before extraction, namely 100ml adds the 0.2ml mercaptoethanol;

(3) preparation 1M Tris-cl 100ml: add 12.11g Tris alkali and 4.9mlHCl in 80ml ddH20, after three's mixing fully dissolves, drip concentrated hydrochloric acid and transfer PH to 8.0, be settled to 100ml;

(4) preparation 0.5M EDTA100ml: at 80mlddH ₂Add 18.01g EDTANa in O ₂The 2H20 stirring and dissolving is transferred PH to 8.0 with NaOH, and approximately the 2gNaOH particle, be settled to 100ml;

(5) preparation 5M NaCl 100ml: take 29.22g NaCl, use the ddH20 constant volume to 100ml;

(6) preparation 3M NaAc10ml: take 2.46g NaAc, use the ddH20 constant volume to 10ml;

Preparation PCR reaction reagent:

Premix reaction solution 2mL: by 10 * PCR damping fluid 2mL, 4 kinds of each 0.2umol of dNTP, rTaq enzyme 2.5U, Mg ²⁺Form 0.015mmol mix;

Preparation PCR product purification reagent:

4mol/L Spirit of Mindererus: take 77g anhydrous solid ammonium acetate crystal, add 100ml ddH ₂O treats to be uniformly dissolved fully, then uses ddH ₂O is settled to 250ml.

Advantage of the present invention and effect are that the macroscopic material that will easily obtain is converted into molecular level research, and extraction, amplification, purifying, the enzyme of DNA of bacteria such as are cut at the step to be fused into integral body and to complete, can not only obtain reliable helicobacter pylori to clarithromycin resistance result, and detect sample obtain possess easy and simple to handle, expense is low, patient's misery is little, the compliance high, testing process standard, convenient, can realize being widely used in clinical Hp Drug Resistance detection simultaneously.

Description of drawings

Fig. 1---extract the laggard performing PCR reaction of DNA PCR from ight soil in the present invention, patient 1,7, and 8,9,10,11,12,13,15,16 show the amplified band schematic diagram.

Fig. 2---carry out enzyme with enzyme 1 and enzyme 2 respectively after the PCR reacting positive in the present invention and cut, the patient's 1 rear discovery of use enzyme 2 2142A-G sudden change, patient 10,11, and after the 13 rear discovery of use enzyme 1 2143A-G sudden change PCR, enzyme is cut schematic diagram.

Fig. 3---test kit structural principle schematic diagram of the present invention, faeces DNA reagent is extracted in 1 representative, and 2 represent the PCR reaction reagent.3 represent PCR product purification reagent, and 4 represent that the purified product enzyme cuts reagent.

Fig. 4---the present invention 1,2,3,4 each several part concrete structure figure.

Embodiment

Working method of the present invention, as shown in Fig. 1,2,3,4:

Embodiment 1:

Extract DNA: comprise the slow middle liquid of PBS, Tirs alkali, concentrated hydrochloric acid, EDTANa ₂.2H ₂O, NaOH, NaCl, CTAB, phenol, chloroform, primary isoamyl alcohol, dehydrated alcohol, NaAc, liquid nitrogen, mercaptoethanol, mortar, water bath with thermostatic control, whizzer, centrifuge tube.2.PCR reaction: comprise primer 1, primer 2, primer 3, primer 4, agarose, EB surrogate, 1 * TAE, Taq Premix (2 *).3.PCR product purification: ammonium acetate, Virahol.4. the purified product enzyme is cut: enzyme 1, enzyme 2, agarose, EB surrogate, 1 * TAE.

The below illustrates:

Faeces DNA extracts:

Get fresh excreta 0.2-0.4g, add and fully vibration being housed in the aseptic PBS damping fluid of 6mL (0.05mol/L, pH 7.4) test tube shaking up the centrifugal 5min of 500rpm after 5～10min, collect supernatant liquor.This step repeats 3 times.Then the centrifugal 10min of supernatant liquor 5000rpm, collecting precipitation is placed in the EP pipe.Throw out suspends in 1mL ddH20, the mixed rear centrifugal 5min collecting precipitation of 14000rpm.Precipitation is dissolved in 200 μ L dehydrated alcohols (20 ℃ of precoolings), and the centrifugal 2min of 14000rpm after the vibration mixing abandons supernatant, and this step repeats 3 times.Gained precipitation after pre-treatment is changed in the 2mlEP pipe, add 600uL, 2 * CTAB solution of 65 ℃ of preheatings (with the mercaptoethanol that before adds 2%) is put into 65 ℃ of water-baths, approximately 1h with the EP pipe that CTAB and precipitation are housed.After cooling, add the phenol of 600ul: chloroform: primary isoamyl alcohol (25: 24: 1), mixing, 12000rpm, centrifugal 15min.Suct clearly, pack into-new EP pipe.Add the 600ul chloroform: primary isoamyl alcohol (24: 1), 12000rpm.Centrifugal 15min.Suct clearly, change in a new EP pipe, add the NaAc (3mol/l) of 1/3 volume to add the dehydrated alcohol of 1ml-20 ℃ of precooling, mixing is placed on-80 ℃, 30min.Centrifugal 12000rpm, 10min abandons supernatant.Add 75% washing with alcohol in the EP pipe 2-3 time, be placed in to be inverted on thieving paper and dry.Add ddH20 (10-20ul) dissolving.Put into-80 ℃ of preservations.

The PCR reaction:

After adding in the 200ulEP pipe 1ul DNA, 1ul primer 1,1ul primer 2,10ul TaqPremix (2 *), the 7ul ddH20 of said extracted to be made into the 20ul reaction system, carry out PCR:95 ℃ of sex change 2min for the first time, 94 ℃ of 30s of the sex change of 5 circulations, 57 ℃ of 30s anneal, extend 72 ℃ of 30s, 94 ℃ of 15s of the sex change of 30 circulations, the 57 ℃ of 15s that anneal extend 72 ℃ of 20s.Add the above-mentioned PCR reaction product of 5ul, 2.5ul primer 3,2.5ul primer 4,25ul Taq Premix (2 *), 15ul ddH again in new 1.5mlEP pipe ₂O is made into the 50ul reaction system, carries out PCR reaction for the second time: 95 ℃ of sex change 2min, and 94 ℃ of 10s of the sex change of 25 circulations, 63 ℃ of 20s anneal.Get 5ul product agarose gel electrophoresis and detect, electrophoresis result as shown in Figure 2, patient 1,7,8,9,10,11,12,13,15,16 show amplified bands, represent that namely in above-mentioned patient's ight soil, helicobacter pylori DNA is positive.

The PCR product purification:

Draw the above-mentioned gained PCR of 200ul product and be placed in 1.5ml EP pipe, add equal-volume 4mol/L Spirit of Mindererus, the vibration mixing, add again isopyknic Virahol, vibration mixing, the standing 10min of room temperature, 12000r/min, centrifugal 10min removes supernatant, add 70% ethanol 1ml rinsing, vibration, centrifugal 10min, abandon supernatant, then add 70% ethanol 1ml vibration mixing, centrifugal 5min (12000r/min) under 4 ℃, supernatant is abandoned in suction, and is dry under room temperature, adds 20ulddH ₂O puts 4 ℃ of refrigerators standby.

The purified product enzyme is cut:

Get respectively the 3ul purified product and add in two 200ulEP pipes, add respectively enzyme 1, enzyme 2, be made into the 20ul reaction system, 37 ℃ respectively, 55 ℃ of water-bath 14h get 5ul product agarose gel electrophoresis and detect, electrophoresis result as shown in Figure 3, the patient's 1 rear discovery of use enzyme 2 2142A-G sudden change, patient 10,11, the 13 rear discovery of use enzyme 1 2143A-G sudden changes can represent patient 1,10,11,13 pairs of clarithromycin resistances.

Test kit is by extracting faeces DNA reagent, and PCR reaction reagent, PCR product purification reagent and purified product enzyme are cut reagent and formed;

1) extract faeces DNA reagent and comprise the i.e. 2 * CTAB of 2 * cetyl trimethylammonium bromide, its effect is the dissolved cell film, and mixes with nucleic acid formation mixture; 2% mercaptoethanol, its effect are protection DNA, improve the DNA extraction success ratio.Liquid during PBS is slow, its effect is the wash-out non-specific adsorption, keeps the cell electrolyte balance.2) the PCR reaction reagent comprises primer 1, primer 2, and primer 3, primer 4 all copies for initiate dna; Taq Premix 2 *, its effect is that extended DNA copies; 3) PCR product purification reagent comprises ammonium acetate, and its effect is precipitation DNA, makes its purifying; 4) the purified product enzyme is cut reagent: enzyme 1, and enzyme 2, wherein enzyme 1 is Mbo ll, and enzyme 2 is Bsa l, and its effect is to cut rear band according to its enzyme to judge whether helicobacter pylori exists the resistance site.

Contain four kinds of primers in the PCR reaction reagent, wherein primer 1 sequence is GGTCTCAGCAAAGAGTCCCT, and the primer 2 sequence is CCCACCAAGCATTGTCCT, and primer 3 sequences are AGGATGCGTCAGTCGCAAGAT; Primer 4 sequences are CCTGTGGATAACACAGGCCAGT.

By test kit of the present invention, effectively instruct clinical in the patient clinical medication of helicobacter pylori infection repeatedly.Known by above experimental result, the reason that 1,10,11,13 patients are difficult to eradicate helicobacter pylori may cause for the resistance of clarithromycin; Therefore we are to 1,10, and after 11,13 patients carried out the rescue therapy scheme (being PPI+ levofloxacin+amoxycilline Trihydrate bp) of helicobacter pylori eradication, the patient helicobacter pylori was all successfully eradicated.

Embodiment 2:

1. prepare DNA extraction reagent:

(1) the aseptic PBS damping fluid of preparation: with 4gNaCl, 0.1gKCl, 1.7g Na ₂HPO ₄.12H ₂O, 0.1g KH ₂PO ₄Add 400ml ddH ₂In O, use ddH after adjusting Ph to 7.4 ₂O is settled to 500ml, inserts test kit after being distributed into 100ml.

(2) preparation 2 * CTAB extracting solution, its PH 8.0: by 2% CTAB, 1.4MNacl, 0.02MEDTA, 0.1MTris-cl, 0.2% mercaptoethanol forms, and namely takes CTAB 2g and adds 40ml ddH ₂O adds 1M Tris-cl10ml to flask, PH8.0, and 0.5M EDTA4ml, PH 8.0 and 5M NaCl 28ml treat CTAB dissolving ddH after fully stirring ₂The O constant volume adds 2% mercaptoethanol to 100ml before extraction DNA, namely 100ml adds the 0.2ml mercaptoethanol;

(3) preparation 1M Tris-cl 100ml:12.11g Tris alkali, 80ml ddH ₂O after 4.9ml HCl three mixing fully dissolves, drips concentrated hydrochloric acid and transfers PH to 8.0, is settled to 100ml;

(4) preparation 0.5M EDTA100ml: at 80mlddH ₂Add 18.01g EDTANa in O ₂2H ₂The O stirring and dissolving is transferred PH to 8.0 with NaOH, and approximately the 2gNaOH particle, be settled to 100m l;

(5) preparation 5M NaCl 100ml: take 29.22g NaCl, use ddH ₂The O constant volume is to 100ml;

(6) preparation 3M NaAc10ml: take 2.46g NaAc, use ddH ₂The O constant volume is to 10ml.

2. prepare the PCR reaction reagent:

(1) Premix reaction solution 2mL: by 10 * PCR damping fluid 2mL, 4 kinds of each 0.2umol of dNTP, rTaq enzyme 2.5U, Mg ²⁺0.015mmol form;

(2) primer 1,2, and 3,4 require available from corresponding company according to primer sequence;

3.PCR product purification reagent:

4mol/L Spirit of Mindererus: take 77g anhydrous solid ammonium acetate crystal, add 100ml ddH ₂O treats to be uniformly dissolved fully, then uses ddH ₂O is settled to 250ml;

4. the purified product enzyme is cut reagent: according to preparing needs available from corresponding company.

Claims (6)

1. detect helicobacter pylori to clarithromycin resistance test kit, it is characterized in that this test kit by extracting faeces DNA reagent, PCR reaction reagent, PCR product purification reagent and purified product enzyme are cut reagent and are formed; Specifically be:

(1) wherein said extraction faeces DNA reagent comprises 2 * cetyl trimethylammonium bromide (CTAB), 2% mercaptoethanol, PBS damping fluid;

(2) wherein said PCR reaction reagent comprises primer 1, primer 2, and primer 3, primer 4, Taq Premix2 *;

(3) wherein said PCR product purification reagent comprises the 4mol/L ammonium acetate;

(4) wherein said purified product enzyme is cut reagent: enzyme 1, enzyme 2.

2. detection helicobacter pylori according to claim 1 is to clarithromycin resistance test kit, it is characterized in that containing in the PCR reaction reagent four kinds of primers, wherein primer 1 sequence is GGTCTCAGCAAAGAGTCCCT, the primer 2 sequence is CCCACCAAGCATTGTCCT, and primer 3 sequences are AGGATGCGTCAGTCGCAAGAT; Primer 4 sequences are CCTGTGGATAACACAGGCCAGT.

3. detection helicobacter pylori according to claim 1 is to clarithromycin resistance test kit, it is characterized in that the purified product enzyme cuts reagent and contain enzyme 1 and enzyme 2, and wherein enzyme 1 is Mbo ll, and enzyme 2 is Bsa l.

4. a detection helicobacter pylori as claimed in claim 1 to clarithromycin resistance test kit working method, is characterized in that the working method of test kit comprises the following steps:

(1) faeces DNA extracts: get proper amount of fresh ight soil, through after pre-treatment, add DNA extraction reagent to the gained precipitation, through centrifugal, put on and wait clearly series of steps, can obtain the DNA product;

(2) PCR reaction: the DNA, primer 1, primer 2, Taq Premix (2 *) and the ddH that add said extracted in the centrifuge tube ₂O carries out the twice PCR reaction, the product that obtains is carried out agarose gel electrophoresis detect, and can judge according to electrophoretic band to have or not helicobacter pylori infection;

(3) PCR product purification: draw the PCR product and be placed in the EP pipe, after adding equal-volume ammonium acetate, aqueous isopropanol, the vibration mixing through dry under with gained end product room temperature after 3 ethanol rinsings, the step such as centrifugal, adds 20ulddH ₂O puts 4 ℃ of refrigerators standby;

(4) the purified product enzyme is cut: add enzyme 1 in purified product, enzyme 2 is got 5ul product agarose gel electrophoresis and is detected after enzyme is cut, and can judge according to electrophoretic band to have or not the clarithromycin resistance to exist.

5. a detection helicobacter pylori as claimed in claim 1 to clarithromycin resistance test kit preparation method, is characterized in that the preparation method of test kit comprises the following steps:

Preparation DNA extraction reagent:

(1) the aseptic PBS damping fluid of preparation: with 4gNaCl, 0.1gKCl, 1.7g Na ₂HPO ₄.12H ₂O, 0.1g KH ₂PO ₄Add 400ml ddH ₂In O, use ddH after adjusting Ph to 7.4 ₂O is settled to 500ml, inserts test kit after being distributed into 100ml;

(2) preparation 2 * CTAB extracting solution, its PH 8.0: by 2%CTAB, 1.4MNacl, 0.02MEDTA, 0.1MTris-cl, 0.2% mercaptoethanol forms, and namely takes CTAB 2g and adds 40mlddH ₂O adds 1MTris-cl10ml, PH8.0, and 0.5M EDTA4ml, PH 8.0 and 5M NaCl 28ml use ddH after the CTAB dissolving ₂The O constant volume adds 2% mercaptoethanol in advance to 100ml, and namely 100ml adds the 0.2ml mercaptoethanol;

(3) preparation 1M Tris-cl 100ml:12.11g Tris alkali, 80ml ddH20 after 4.9ml HCl three mixing fully dissolves, drips concentrated hydrochloric acid and transfers PH to 8.0, is settled to 100ml;

(4) preparation 0.5M EDTA100ml: add 18.01g EDTANa in 80ml water ₂2H ₂The O stirring and dissolving is transferred PH to 8.0 with NaOH, and approximately the 2gNaOH particle, be settled to 100ml;

(5) preparation 5M NaCl 100ml: take 29.22g NaCl, use ddH ₂The O constant volume is to 100ml;

(6) preparation 3M NaAc10ml: take 2.46g NaAc, use ddH ₂The O constant volume is to 10ml;

Preparation PCR reaction reagent:

Premix reaction solution 2mL: by 10 * PCR damping fluid 2mL, 4 kinds of each 0.2umol of dNTP, rTaq enzyme 2.5U, Mg ²⁺0.015mmol form;

Preparation PCR product purification reagent:

4mol/L Spirit of Mindererus: take 77g anhydrous solid ammonium acetate crystal, add 100ml ddH ₂O treats to be uniformly dissolved fully, then uses ddH ₂O is settled to 250ml.

One kind as claimed in claim 1 for detection of helicobacter pylori to clarithromycin resistance test kit be detect the helicobacter pylorus positive patient carrying out eradication therapy in its application to clarithromycin resistance situation.

Images