CN103103252A - Detection method for detecting single nucleotide polymorphism (SNP) of second exon of chicken IGFBP-3 (Insulin Like Growth Factor Binding Protein-3) gene - Google Patents
Detection method for detecting single nucleotide polymorphism (SNP) of second exon of chicken IGFBP-3 (Insulin Like Growth Factor Binding Protein-3) gene Download PDFInfo
- Publication number
- CN103103252A CN103103252A CN2012103366453A CN201210336645A CN103103252A CN 103103252 A CN103103252 A CN 103103252A CN 2012103366453 A CN2012103366453 A CN 2012103366453A CN 201210336645 A CN201210336645 A CN 201210336645A CN 103103252 A CN103103252 A CN 103103252A
- Authority
- CN
- China
- Prior art keywords
- chicken
- igfbp
- gene
- pcr
- snp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a detection method for detecting single nucleotide polymorphism (SNP) of second exon of chicken IGFBP-3 (Insulin Like Growth Factor Binding Protein-3) gene. The method is characterized by comprising the following steps of: designing PCR (Polymerase Chain Reaction) primers of the second exon of the chicken IGFBP-3 gene; performing PCR amplification on chicken IGFBP-3 gene segments by using primers P; digesting the IGFBP-3 gene segments subjected to the PCR amplification by using MspI enzyme digestion reaction; carrying out polyacrylamide gel electrophoresis analysis after the PCR product is digested by using MspI; performing statistic analysis on the frequency of SNP sites of the chicken IGFBP-3 gene; and performing association analysis on the genetic effect of the SNP site of the chicken IGFBP-3 gene. The method has the advantages that the single nucleotide polymorphism can be quickly and simply detected with low cost and high precision by designing the specific primer PCR amplification and the specific restriction enzyme digestion identification, and germplasm resources can be classified quickly in molecular genetics, so that the method is used for marker assisted selection (MAS) of egg production traits of chicken to quickly establish chicken populations with excellent heredity.
Description
Technical field
The invention belongs to the molecular genetics field, relate to the detection of gene mononucleotide polymorphism (SNP), particularly a kind of detection method that detects the single nucleotide polymorphism of chicken IGFBP-3 gene the second exon.
Background technology
Single nucleotide polymorphism (SNP) just refers on genomic level by the caused DNA sequence polymorphism of the variation of single core thuja acid.Comprise the forms such as conversion, transversion, insertion and disappearance of single base, wherein 1 of minimum appearance kind of gene frequency is not less than 1%.Base mutation is divided into 2 kinds of conversion (purine-purine or pyrimidine-pyrimidine) and transversion (purine-pyrimidine).In principle, the base of sudden change place can be A, T, C, G, but in fact SNP mostly occurs between C and 2 bases of T.SNP is inhomogeneous at individual gene or whole genomic distribution.SNP will be more than transcription sequence in the non-transcribed sequence, and, in the frequency of transcriptional domain nonsynonymous mutation (change of aminoacid sequence is arranged), the frequency of suddenling change than other modes is much lower.Halushka etc. (1999) pass through 75 gene tests, infer that human genome has 1,000,000 SNP sites, wherein nearly 500,000 at non-coding region, there were significant differences in 5 of gene ' end non-coding region, 3 ' end non-coding region, intron, silent site and coding region for the frequency of SNP, and (p=6. 6 * 10
-10), also there is significant difference (P=0.025) in the frequency of mutantional hotspot CpG in these 5 kinds of zones.
In population genetic research, SNP is as genetic marker of new generation, following characteristics is arranged: (1) quantity is many and widely distributed: according to estimates, in genome, approximately average every 1000 bp just there will be 1 SNP, they will reach 3,000,000 in whole genomic distribution like this, genetic distance is 2~3 cM, and the density ratio microsatellite marker is higher, can the inside of any one gene to be studied or near a series of marks are provided; (2) typical: some SNP that is positioned at gene inside likely directly affects protein structure or expression level, so they may represent some influencing factor in disease genetic mechanism; (3) genetic stability: SNP is the extensive and the most stable point mutation that distributes in genome, and mutation rate is low, with the Repeat Polymorphism mark such as micro-satellite, compares, and SNP has higher genetic stability, especially in coding region SNP; (4) detect fast, easily be automated: SNP is a kind of diallelic heritable variation normally, without picture detection microsatellite marker, the length of fragment is made to measurement when detecting, the mode that only needs one "+/-" or " all or none " to analyze, be conducive to automatically screening or detect SNP; (5) conversion of base is greater than transversion: because in genome, most of C are methylated, deaminizating that can be spontaneous produces T.Therefore SNPs is significant in population genetic and organic evolution as genetic marker.
7 kinds have been defined at present
iGFBPs (
iGFBP1-7),
iGFBPthe-3rd, wherein important a kind of, it is the abundantest in blood
iGFBPs combining form, in blood 95%
the IGF-Iwith
the IGF-IIall with
iGFBP-3 combinations,
iGFBP-3 have prolongation
iGFtransformation period, adjusting
iGFthe effects such as biologic activity, therefore
iGFBP-3 pairs
iGFsthe performance of function has a significant impact, thereby affects indirectly quality of the growing of livestock and poultry, reproductive performance and meat etc.At present, livestock and poultry
iGFBP-3 Study on gene polymorphism mainly concentrate on ox and sheep.Chicken
iGFBP-3the research scarcity in gene genetic variation field, the associated research of the functional study of this gene locus and heritable variation thereof and poultry economic characters (as: body weight, open and produce age in days, open and lay eggs heavily, open the proterties such as product body weight, egg number) is still blank.
Summary of the invention
The objective of the invention is: for above-mentioned deficiency, provide a kind of detection method that detects the polymorphism of chicken IGFBP-3 gene the second exon.Design it and the production traits is carried out association analysis simultaneously, verify whether it can be used as the molecule marker in chicken molecular breeding assisted Selection.
For achieving the above object, the technical solution used in the present invention is:
Detect the detection method of the single nucleotide polymorphism of chicken IGFBP-3 gene the second exon, comprise the steps:
One, design chicken IGFBP-3 gene Second Exon zone PCR primer
The chicken NC_006089 sequence that NCBI was announced of take is reference, the primer P that design can be increased and be comprised chicken IGFBP-3 gene Second Exon zone, and its sequence is as follows:
Upstream primer is: CATCTTGGGACCAGTGCTTT 20;
Downstream primer is: ATTTTTCAAGCCTGCTGTGG 20;
Two, carry out the IGFBP-3 gene fragment of pcr amplification chicken to be measured with primer P
The collection of a, chicken sample
Gather the chicken kind in a plurality of places as detected object, the chicken complete genome DNA to be measured that comprises chicken IGFBP-3 gene of take is template;
B, chicken complete genome DNA template to be measured are processed
To the above-mentioned chicken complete genome DNA template to be measured containing chicken IGFBP-3 gene separated, extraction, purifying;
C, pcr amplification chicken IGFBP-3 gene fragment
The PCR reaction system adopts mixes the application of sample method, join in 1 1.5ml centrifuge tube, fully mix rear instantaneous centrifugal, divide again and install in each 96 hole flat board, then add the chicken complete genome DNA template to be measured after step b processes, instantaneous centrifugal laggard performing PCR amplification again, described PCR reaction system total amount is 19-25 μ L, it comprises the Mg that 10 * PCR Buffer, 2.0-3.0 μ L, concentration are 25mmol/L
2+2.2-2.5 μ L, dNTPs 0.8-1.5 μ L that concentration is 2 mmol/L, concentration is the upper of 10 pmol/ μ L, each 1 μ L of downstream primer, TaqDNA polysaccharase 0.2-0.6 μ L that concentration is 5 U/mL, the DNA profiling 1 .0-1.5 μ L that concentration is 100 ng/ μ L, ultrapure water 11.8-12.5 μ L, amplification program is: control temperature and be 92-96 ℃, the PCR reaction system is carried out to denaturation and process 4-6 min, maintain the temperature at 92-96 ℃, denaturing treatment 50-70 s, then reduce temperature to 54-58 ℃, carry out anneal 20-40 s, after anneal, rising temperature to 70-74 ℃, carry out again prolonged treatment 20-40s, by above-mentioned denaturing treatment,---anneal---prolonged treatment three steps repeat 30-35 circulations by above-mentioned order and processing requirement, operated rear control temperature and be 70-74 ℃, prolonged treatment 9-10 min, reduce again temperature to 9-10 ℃, the PCR reaction system is preserved,
Three, the IGFBP-3 gene fragment of MspI endonuclease reaction digestion pcr amplification
MspI endonuclease reaction digestion system comprises 4.6-5.2 μ L PCR products, restriction endonuclease MspI 5U, and 10 * Buffer, 0.8-1.1 μ L, distilled water 5-6 μ L, enzyme is cut digestion condition and is: 65 ℃ of water bath with thermostatic control digestion 6-8h;
Four, Polyacrylamide Gel Electrophoresis after MspI digestion PCR product
The polyacrylamide gel that a, making concentration are 10%, adopt 180V voltage electrophoresis 25-35min after point sample, EB dyeing after electrophoresis finishes;
B, until molecular weight, different chicken complete genome DNAs to be measured separates when clear, in Kodak's gel imaging system imaging;
C, according to polyacrylamide gel electrophoresis interpretation of result SNP polymorphism;
The single nucleotide polymorphism of identifying the 1087th of chicken IGFBP-3 gene according to the polyacrylamide gel electrophoresis result is: the CC type shows as 95bp and two bands of 66bp, the CT genotype shows as 161bp, 95 bp and tri-bands of 66 bp, and the TT genotype shows as band of 161bp;
The sequence checking of d, the individual PCR product order-checking of different genotype
The individual PCR product of different genotype is carried out respectively to positive and negative two-way order-checking, simultaneously, carry out the SNP position analysis;
Five, carry out the frequency statistics analysis of chicken IGFBP-3 gene SNP site;
Six, carry out the association analysis of chicken IGFBP-3 gene SNP site genetic effect
The TT genotype in the 1087th site can be used as a candidate molecules genetic marker that improves the chicken egg number.
Compared with prior art, the SNP polymorphism of the 1087th of chicken IGFBP-3 gene disclosed by the invention, one and the closely-related mononucleotide polymorphic site of chicken part producing proterties, the present invention has carried out detection and gene frequency analysis to the SNP genotype of 4 chicken breeds, association analysis is carried out in above-mentioned SNP site and chicken part Economic Importance shape (egg number), and result shows that this site can be as the molecule marker that improves the chicken egg number;
Advantage of the present invention is: the present invention is directed to the SNP polymorphism of above-mentioned the 1087th, identifies by designing increase specific digestion with restriction enzyme of specific primer PCR, and can be fast, the polymorphism of simple, low-cost, its mononucleotide of high precision ground detection; Can molecular genetics, carry out somatotype to germ plasm resource fast, for use in the marker assisted selection (MAS) of chicken egg-laying deseription, the chicken population that Rapid Establishment heredity is good.
The accompanying drawing explanation
Below in conjunction with the drawings and specific embodiments, the present invention is described in further detail.
Fig. 1 is chicken IGFBP-3 gene PCR product electrophoresis;
The Msp I restriction enzyme digestion and electrophoresis result of the PCR product of the 161bp that Fig. 2 is the chicken IGFBP-3 gene polymorphic site that comprises the 1087th; Wherein: 1, swimming lane 1(is the TT type), 2, swimming lane 2(is the TT type), 3, swimming lane 3(is the CC type), 4, swimming lane 4(is the CC type), 5, swimming lane 5 is (CT types), 6, swimming lane 6 is (CT types), M, Marker.
The different genotype sequencer map that Fig. 3 is chicken IGFBP-3 gene SNP.(sequencer map that wherein A is individual the 1087th of CC genotype, the sequencer map that B is individual the 1087th of TT genotype, the sequencer map that C is individual the 1087th of CT genotype).
Embodiment
The present invention utilizes the PCR-RFLP method may produce to chicken IGFBP-3 gene the 1087th bit codon mutation the single nucleotide polymorphism that the proteins encoded conformation changes and is detected, and this SNP and proterties association analysis are shown, the polymorphism in this site can become the molecular breeding mark.
Following examples are only for the present invention is described, rather than are used for limiting scope of the present invention.The implementation method of unreceipted actual conditions in embodiment, usually according to normal condition.
As shown in Fig. 1-3, a kind of detection method that detects the single nucleotide polymorphism of chicken IGFBP-3 gene the second exon of the present invention, comprise the steps:
One, design chicken IGFBP-3 gene Second Exon zone PCR primer
The chicken NC_006089 sequence that NCBI was announced of take is reference, the primer P that utilizes Primer 5.0 software designs can increase and comprise chicken IGFBP-3 gene Second Exon zone, and primer P sequence is as follows:
Upstream primer is: CATCTTGGGACCAGTGCTTT 20;
Downstream primer is: ATTTTTCAAGCCTGCTGTGG 20;
With above-mentioned primer pair chicken genome, increased, the gene fragment of the 161bp that comprises chicken IGFBP-3 gene (NC_006089 sequence) Second Exon zone the 1021bp ~ 1181bp of can increasing, after amplification, the electrophoresis detection of fragment is as shown in Figure 1.Wherein swimming lane 1 is for detecting fragment, and M is Marker; To the amplification fragment check order the evaluation after, wherein, the sequence of 1061bp ~ 1110 bp is as follows:
agagacagta?ggattgagtg?cacccccggc?gagtttgctg?atggcactaa;
By analysis, find that the SNP position that Msp I PCR-RFLP detects is that 1087bp(is the 183rd, IGFBP-3 gene C DS district), when this site sports T by C, cause the codon of the 62nd to sport TGG by CGG, thereby form the missense codom sudden change, by Arg, sport Trp.
When 1087bp is C, the 1086bp of pcr amplification IGFBP-3 gene product ~ 1089bp sequence is CCGG, formed the restriction enzyme site of Msp I, when in 1087 sites, sudden change being arranged, the 1086bp of pcr amplification IGFBP-3 gene product ~ 1089bp sequence is CTGG, and restriction endonuclease can not be identified; So just can this SNP polymorphism be detected.
When with restriction endonuclease, the gene fragment enzyme of the corresponding amplification of primer P being cut to digestion, due to the recognition site of 1086bp ~ 1089bp, therefore can be cut into 2 sections fragments.
Two, carry out the IGFBP-3 gene fragment of pcr amplification chicken to be measured with primer P
The collection of a, chicken sample
Gather the chicken kind in a plurality of places as detected object, the chicken complete genome DNA to be measured that comprises chicken IGFBP-3 gene of take is template;
The present invention is specifically usingd population that 3 Chinese Native Chicken Breeds and 1 introduces the chicken kind as detected object, and concrete collecting sample is in Table 1, wherein: sea, capital yellow chicken (400), AA chicken (30), deer park chicken (46), limit chicken (50);
The collection of table 1 chicken sample
Kind | Sample number | The sample title | Sample source | Sample mode |
The yellow chicken in sea, capital | 400 | Blood sample | Jiangsu Jinghai Poultry Group Co., Ltd. | No. 6 syringe needles of venous blood collection |
The AA chicken | 30 | Blood sample | Jiangsu Jinghai Poultry Group Co., Ltd. | No. 6 syringe needles of venous blood collection |
The deer park chicken | 46 | Blood sample | Poultry Institute, Chinese Academy of Agricultural Science | No. 6 syringe needles of venous blood collection |
The limit chicken | 50 | Blood sample | Academy of agricultural sciences, Shanxi Province animal and veterinary institute | No. 6 syringe needles of venous blood collection |
B, chicken complete genome DNA template to be measured are processed
To the above-mentioned chicken complete genome DNA template to be measured containing chicken IGFBP-3 gene separated, extraction, purifying;
C, pcr amplification chicken IGFBP-3 gene fragment
The PCR reaction system adopts mixes the application of sample method, join in 1 1.5ml centrifuge tube, fully mix rear instantaneous centrifugal, divide again and install in each 96 hole flat board, then add the chicken complete genome DNA template to be measured after step b processes, instantaneous centrifugal laggard performing PCR amplification again, described PCR reaction system total amount is 20 μ L, it comprises the Mg that 10 * PCR Buffer, 2.0 μ L, concentration are 25mmol/L
2+2.2 μ L, the dNTPs 0.8 μ L that concentration is 2 mmol/L, concentration is the upper of 10 pmol/ μ L, each 1 μ L of downstream primer, the TaqDNA polysaccharase 0.2 μ L that concentration is 5 U/mL, the DNA profiling 1 .0 μ L that concentration is 100 ng/ μ L, ultrapure water 11.8 μ L, amplification program is: controlling temperature is 92 ℃, the PCR reaction system is carried out to denaturation and process 4 min, maintain the temperature at 92 ℃, denaturing treatment 50s, then reduce temperature to 54 ℃, carry out anneal 20s, after anneal, rising temperature to 70 ℃, carry out again prolonged treatment 20s, by above-mentioned denaturing treatment,---anneal---prolonged treatment three steps repeat 30 circulations by above-mentioned processing requirement, having operated rear control temperature is 70 ℃, prolonged treatment 9min, reduce again temperature to 9 ℃, the PCR reaction system is preserved,
Three, the IGFBP-3 gene fragment of MspI endonuclease reaction digestion pcr amplification
MspI endonuclease reaction digestion system comprises 4.6 μ L PCR products, restriction endonuclease MspI 5U, and 10 * Buffer, 0.8 μ L, distilled water 5 μ L, enzyme is cut digestion condition and is: 65 ℃ of water bath with thermostatic control digestion 6h;
Four, Polyacrylamide Gel Electrophoresis after MspI digestion PCR product
The polyacrylamide gel that a, making concentration are 10%, adopt 180V voltage electrophoresis 25min after point sample, EB dyeing after electrophoresis finishes;
B, until molecular weight, different chicken complete genome DNAs to be measured separates when clear, in Kodak's gel imaging system imaging;
C, according to polyacrylamide gel electrophoresis interpretation of result SNP polymorphism;
When the 1087bp of IGFBP-3 gene is mutated into T by C, the 1086bp of the IGFBP-3 gene product of pcr amplification ~ 1089bp sequence is CTGG, and restriction endonuclease can not be identified; And the 1086bp of IGFBP-3 gene product ~ 1089bp sequence is CCGG, restriction endonuclease can be identified, and amplified fragments is cut to 2 sections;
Because chicken is 2 times of bodies, so the polyacrylamide gel electrophoresis result of the SNP polymorphism of the 1087th of the genomic IGFBP-3 gene of chicken is:
The CC type shows as 95bp and two bands of 66bp, and the CT genotype shows as 161bp, 95 bp and tri-bands of 66 bp, and the TT genotype shows as band of 161bp.
As shown in Figure 2, wherein swimming lane 1, swimming lane 2 only have the band of a 161bp, and it is TT genotype individuality, swimming lane 3, swimming lane 4 comprise 66bp and 95bp band, are CC genotype individuality, the band that swimming lane 5, swimming lane 6 comprise 161bp, 66bp band and 95bp band, for CT genotype individuality, swimming lane M is Marker (64bp, 80 bp, 89 bp, 104 bp, 124 bp, 184 bp, 192 bp, 213 bp, 234 bp, 267 bp).
The sequence checking of d, the individual PCR product order-checking of different genotype
The individual PCR product of different genotype is carried out respectively to positive and negative two-way order-checking; Simultaneously, carry out the SNP position analysis, individual its 1087 the sequencer map of the heterozygote CT genotype of band, 66bp band and 95bp band that result shows to comprise 161bp but be expressed as T or C, as shown in Figure 3 C, Wei Liangge peak, the 5th peak from left to right.And CC genotype, TT genotype are respectively C, T, as shown in Fig. 3 A, B.
Five, the frequency statistics analysis of chicken IGFBP-3 gene SNP site;
C gene frequency rangeability in Different Chicken kind IGFBP-3 gene SNP is between 0.62-0.80, as shown in table 2.
Four chicken kinds of table 2
iGFBPgene frequency and the genotype frequency of the 1087th SNP of-3 Exon 2s
Six, the association analysis of chicken IGFBP-3 gene SNP site genetic effect
The TT genotype in the 1087th site can be used as a candidate molecules genetic marker that improves the chicken egg number.As shown in table 3, in the 1087th site, the age in days maximum is produced in opening of CC genotype individuality, is 146.42 days, and the CT genotype is opened product the earliest, is 133.80 days, the CC genotype open produce age in days significantly be greater than the CT genotype (
p<0.05); And TT genotype 300 age in days egg numbers and 66 week age egg number be respectively 101.94 and 186.80, TT genotype 300 ages in days and 66 week age egg number be significantly higher than the CC type (
p<0.05).Above analytic explanation: the TT genotype in the 1087th site can be used as a candidate molecules genetic marker that improves the chicken egg number.
Table 3
iGFBP-the variance analysis (mean number ± standard deviation) of the yellow chicken egg laying performance of 3 Exon 2 1087 polymorphic sites and sea, capital
As shown in Fig. 1-3, a kind of detection method that detects the single nucleotide polymorphism of chicken IGFBP-3 gene the second exon of the present invention, comprise the steps:
One, design chicken IGFBP-3 gene Second Exon zone PCR primer
The chicken NC_006089 sequence that NCBI was announced of take is reference, the primer P that utilizes Primer 5.0 software designs can increase and comprise chicken IGFBP-3 gene Second Exon zone, and primer P sequence is as follows:
Upstream primer is: CATCTTGGGACCAGTGCTTT 20;
Downstream primer is: ATTTTTCAAGCCTGCTGTGG 20;
With above-mentioned primer pair chicken genome, increased, the gene fragment of the 161bp that comprises chicken IGFBP-3 gene (NC_006089 sequence) Second Exon zone the 1021bp ~ 1181bp of can increasing, after amplification, the electrophoresis detection of fragment is as shown in Figure 1.Wherein swimming lane 1 is for detecting fragment, and M is Marker; To the amplification fragment check order the evaluation after, wherein, the sequence of 1061bp ~ 1110 bp is as follows:
agagacagta?ggattgagtg?cacccccggc?gagtttgctg?atggcactaa;
By analysis, find that the SNP position that Msp I PCR-RFLP detects is that 1087bp(is the 183rd, IGFBP-3 gene C DS district), when this site sports T by C, cause the codon of the 62nd to sport TGG by CGG, thereby form the missense codom sudden change, by Arg, sport Trp.
When 1087bp is C, the 1086bp of pcr amplification IGFBP-3 gene product ~ 1089bp sequence is CCGG, formed the restriction enzyme site of Msp I, when in 1087 sites, sudden change being arranged, the 1086bp of pcr amplification IGFBP-3 gene product ~ 1089bp sequence is CTGG, and restriction endonuclease can not be identified; So just can this SNP polymorphism be detected.
When with restriction endonuclease, the gene fragment enzyme of the corresponding amplification of primer P being cut to digestion, due to the recognition site of 1086bp ~ 1089bp, therefore can be cut into 2 sections fragments.
Two, carry out the IGFBP-3 gene fragment of pcr amplification chicken to be measured with primer P
The collection of a, chicken sample
Gather the chicken kind in a plurality of places as detected object, the chicken complete genome DNA to be measured that comprises chicken IGFBP-3 gene of take is template;
The present invention is specifically usingd population that 3 Chinese Native Chicken Breeds and 1 introduces the chicken kind as detected object, and concrete collecting sample is in Table 1, wherein: sea, capital yellow chicken (400), AA chicken (30), deer park chicken (46), limit chicken (50);
The collection of table 1 chicken sample
Kind | Sample number | The sample title | Sample source | Sample mode |
The yellow chicken in sea, capital | 400 | Blood sample | Jiangsu Jinghai Poultry Group Co., Ltd. | No. 6 syringe needles of venous blood collection |
The AA chicken | 30 | Blood sample | Jiangsu Jinghai Poultry Group Co., Ltd. | No. 6 syringe needles of venous blood collection |
The deer park chicken | 46 | Blood sample | Poultry Institute, Chinese Academy of Agricultural Science | No. 6 syringe needles of venous blood collection |
The limit chicken | 50 | Blood sample | Academy of agricultural sciences, Shanxi Province animal and veterinary institute | No. 6 syringe needles of venous blood collection |
B, chicken complete genome DNA template to be measured are processed
To the above-mentioned chicken complete genome DNA template to be measured containing chicken IGFBP-3 gene separated, extraction, purifying;
C, pcr amplification chicken IGFBP-3 gene fragment
The PCR reaction system adopts mixes the application of sample method, join in 1 1.5ml centrifuge tube, fully mix rear instantaneous centrifugal, divide again and install in each 96 hole flat board, then add the chicken complete genome DNA template to be measured after step b processes, instantaneous centrifugal laggard performing PCR amplification again, described PCR reaction system total amount is 21 μ L, it comprises the Mg that 10 * PCR Buffer, 2 μ L, concentration are 25mmol/L
2+2.4 μ L, the dNTPs 1.2 μ L that concentration is 2 mmol/L, concentration is the upper of 10 pmol/ μ L, each 1 μ L of downstream primer, the TaqDNA polysaccharase 0.4 μ L that concentration is 5 U/mL, the DNA profiling 1 .2 μ L that concentration is 100 ng/ μ L, ultrapure water 11.8 μ L, amplification program is: controlling temperature is 94 ℃, the PCR reaction system is carried out to denaturation and process 5min, maintain the temperature at 94 ℃, denaturing treatment 60s, then reduce temperature to 56 ℃, carry out anneal 30s, after anneal, rising temperature to 72 ℃, carry out again prolonged treatment 30s, by above-mentioned denaturing treatment,---anneal---prolonged treatment three steps repeat 32 circulations by above-mentioned processing requirement, having operated rear control temperature is 72 ℃, prolonged treatment 9.5min, reduce again temperature to 10 ℃, the PCR reaction system is preserved,
Three, the IGFBP-3 gene fragment of MspI endonuclease reaction digestion pcr amplification
MspI endonuclease reaction digestion system comprises 5 μ L PCR products, restriction endonuclease MspI 5U, and 10 * Buffer, 1.0 μ L, distilled water 5.5 μ L, enzyme is cut digestion condition and is: 65 ℃ of water bath with thermostatic control digestion 7h;
Four, Polyacrylamide Gel Electrophoresis after MspI digestion PCR product
The polyacrylamide gel that a, making concentration are 10%, adopt 180V voltage electrophoresis 30min after point sample, EB dyeing after electrophoresis finishes;
B, until molecular weight, different chicken complete genome DNAs to be measured separates when clear, in Kodak's gel imaging system imaging;
C, according to polyacrylamide gel electrophoresis interpretation of result SNP polymorphism;
When the 1087bp of IGFBP-3 gene is mutated into T by C, the 1086bp of the IGFBP-3 gene product of pcr amplification ~ 1089bp sequence is CTGG, and restriction endonuclease can not be identified; And the 1086bp of IGFBP-3 gene product ~ 1089bp sequence is CCGG, restriction endonuclease can be identified, and amplified fragments is cut to 2 sections;
Because chicken is 2 times of bodies, so the polyacrylamide gel electrophoresis result of the SNP polymorphism of the 1087th of the genomic IGFBP-3 gene of chicken is:
The CC type shows as 95bp and two bands of 66bp, and the CT genotype shows as 161bp, 95 bp and tri-bands of 66 bp, and the TT genotype shows as band of 161bp.
As shown in Figure 2, wherein swimming lane 1, swimming lane 2 only have the band of a 161bp, and it is TT genotype individuality, swimming lane 3, swimming lane 4 comprise 66bp and 95bp band, are CC genotype individuality, the band that swimming lane 5, swimming lane 6 comprise 161bp, 66bp band and 95bp band, for CT genotype individuality, swimming lane M is Marker (64bp, 80 bp, 89 bp, 104 bp, 124 bp, 184 bp, 192 bp, 213 bp, 234 bp, 267 bp).
The sequence checking of d, the individual PCR product order-checking of different genotype
The individual PCR product of different genotype is carried out respectively to positive and negative two-way order-checking; Simultaneously, carry out the SNP position analysis, individual its 1087 the sequencer map of the heterozygote CT genotype of band, 66bp band and 95bp band that result shows to comprise 161bp but be expressed as T or C, as shown in Figure 3 C, Wei Liangge peak, the 5th peak from left to right, and CC genotype, TT genotype are respectively C, T, as shown in Fig. 3 A, B.
Five, the frequency statistics analysis of chicken IGFBP-3 gene SNP site;
C gene frequency rangeability in Different Chicken kind IGFBP-3 gene SNP is between 0.62-0.80, as shown in table 2.
Four chicken kinds of table 2
iGFBPgene frequency and the genotype frequency of the 1087th SNP of-3 Exon 2s
Six, the association analysis of chicken IGFBP-3 gene SNP site genetic effect
The TT genotype in the 1087th site can be used as a candidate molecules genetic marker that improves the chicken egg number.As shown in table 3, in the 1087th site, the age in days maximum is produced in opening of CC genotype individuality, is 146.42 days, and the CT genotype is opened product the earliest, is 133.80 days, the CC genotype open produce age in days significantly be greater than the CT genotype (
p<0.05); And TT genotype 300 age in days egg numbers and 66 week age egg number be respectively 101.94 and 186.80, TT genotype 300 ages in days and 66 week age egg number be significantly higher than the CC type (
p<0.05).Above analytic explanation: the TT genotype in the 1087th site can be used as a candidate molecules genetic marker that improves the chicken egg number.
Table 3
iGFBP-the variance analysis (mean number ± standard deviation) of the yellow chicken egg laying performance of 3 Exon 2 1087 polymorphic sites and sea, capital
As shown in Fig. 1-3, a kind of detection method that detects the single nucleotide polymorphism of chicken IGFBP-3 gene the second exon of the present invention, comprise the steps:
One, design chicken IGFBP-3 gene Second Exon zone PCR primer
The chicken NC_006089 sequence that NCBI was announced of take is reference, the primer P that utilizes Primer 5.0 software designs can increase and comprise chicken IGFBP-3 gene Second Exon zone, and primer P sequence is as follows:
Upstream primer is: CATCTTGGGACCAGTGCTTT 20;
Downstream primer is: ATTTTTCAAGCCTGCTGTGG 20;
With above-mentioned primer pair chicken genome, increased, the gene fragment of the 161bp that comprises chicken IGFBP-3 gene (NC_006089 sequence) Second Exon zone the 1021bp ~ 1181bp of can increasing, after amplification, the electrophoresis detection of fragment is as shown in Figure 1.Wherein swimming lane 1 is for detecting fragment, and M is Marker; To the amplification fragment check order the evaluation after, wherein, the sequence of 1061bp ~ 1110 bp is as follows:
agagacagta?ggattgagtg?cacccccggc?gagtttgctg?atggcactaa;
By analysis, find that the SNP position that Msp I PCR-RFLP detects is that 1087bp(is the 183rd, IGFBP-3 gene C DS district), when this site sports T by C, cause the codon of the 62nd to sport TGG by CGG, thereby form the missense codom sudden change, by Arg, sport Trp.
When 1087bp is C, the 1086bp of pcr amplification IGFBP-3 gene product ~ 1089bp sequence is CCGG, formed the restriction enzyme site of Msp I, when in 1087 sites, sudden change being arranged, the 1086bp of pcr amplification IGFBP-3 gene product ~ 1089bp sequence is CTGG, and restriction endonuclease can not be identified; So just can this SNP polymorphism be detected.
When with restriction endonuclease, the gene fragment enzyme of the corresponding amplification of primer P being cut to digestion, due to the recognition site of 1086bp ~ 1089bp, therefore can be cut into 2 sections fragments.
Two, carry out the IGFBP-3 gene fragment of pcr amplification chicken to be measured with primer P
The collection of a, chicken sample
Gather the chicken kind in a plurality of places as detected object, the chicken complete genome DNA to be measured that comprises chicken IGFBP-3 gene of take is template;
The present invention is specifically usingd population that 3 Chinese Native Chicken Breeds and 1 introduces the chicken kind as detected object, and concrete collecting sample is in Table 1, wherein: sea, capital yellow chicken (400), AA chicken (30), deer park chicken (46), limit chicken (50);
The collection of table 1 chicken sample
Kind | Sample number | The sample title | Sample source | Sample mode |
The yellow chicken in sea, capital | 400 | Blood sample | Jiangsu Jinghai Poultry Group Co., Ltd. | No. 6 syringe needles of venous blood collection |
The AA chicken | 30 | Blood sample | Jiangsu Jinghai Poultry Group Co., Ltd. | No. 6 syringe needles of venous blood collection |
The deer park chicken | 46 | Blood sample | Poultry Institute, Chinese Academy of Agricultural Science | No. 6 syringe needles of venous blood collection |
The limit chicken | 50 | Blood sample | Academy of agricultural sciences, Shanxi Province animal and veterinary institute | No. 6 syringe needles of venous blood collection |
B, chicken complete genome DNA template to be measured are processed
To the above-mentioned chicken complete genome DNA template to be measured containing chicken IGFBP-3 gene separated, extraction, purifying;
C, pcr amplification chicken IGFBP-3 gene fragment
The PCR reaction system adopts mixes the application of sample method, join in 1 1.5ml centrifuge tube, fully mix rear instantaneous centrifugal, divide again and install in each 96 hole flat board, then add the chicken complete genome DNA template to be measured after step b processes, instantaneous centrifugal laggard performing PCR amplification again, described PCR reaction system total amount is 23.5 μ L, it comprises the Mg that 10 * PCR Buffer, 3.0 μ L, concentration are 25mmol/L
2+2.5 μ L, the dNTPs 1.5 μ L that concentration is 2 mmol/L, concentration is the upper of 10 pmol/ μ L, each 1 μ L of downstream primer, the TaqDNA polysaccharase 0.6 μ L that concentration is 5 U/mL, the DNA profiling 1 .5 μ L that concentration is 100 ng/ μ L, ultrapure water 12.4 μ L, amplification program is: controlling temperature is 96 ℃, the PCR reaction system is carried out to denaturation and process 6 min, maintain the temperature at 96 ℃, denaturing treatment 70s, then reduce temperature to 58 ℃, carry out anneal 40s, after anneal, rising temperature to 74 ℃, carry out again prolonged treatment 40s, by above-mentioned denaturing treatment,---anneal---prolonged treatment three steps repeat 35 circulations by above-mentioned processing requirement, having operated rear control temperature is 74 ℃, prolonged treatment 10min, reduce again temperature to 10 ℃, the PCR reaction system is preserved,
Three, the IGFBP-3 gene fragment of MspI endonuclease reaction digestion pcr amplification
MspI endonuclease reaction digestion system comprises 5.2 μ L PCR products, restriction endonuclease MspI 5U, and 10 * Buffer, 1.1 μ L, distilled water 6 μ L, enzyme is cut digestion condition and is: 65 ℃ of water bath with thermostatic control digestion 8h;
Four, Polyacrylamide Gel Electrophoresis after MspI digestion PCR product
The polyacrylamide gel that a, making concentration are 10%, adopt 180V voltage electrophoresis 35min after point sample, EB dyeing after electrophoresis finishes;
B, until molecular weight, different chicken complete genome DNAs to be measured separates when clear, in Kodak's gel imaging system imaging;
C, according to polyacrylamide gel electrophoresis interpretation of result SNP polymorphism;
When the 1087bp of IGFBP-3 gene is mutated into T by C, the 1086bp of the IGFBP-3 gene product of pcr amplification ~ 1089bp sequence is CTGG, and restriction endonuclease can not be identified; And the 1086bp of IGFBP-3 gene product ~ 1089bp sequence is CCGG, restriction endonuclease can be identified, and amplified fragments is cut to 2 sections;
Because chicken is 2 times of bodies, so the polyacrylamide gel electrophoresis result of the SNP polymorphism of the 1087th of the genomic IGFBP-3 gene of chicken is:
The CC type shows as 95bp and two bands of 66bp, and the CT genotype shows as 161bp, 95 bp and tri-bands of 66 bp, and the TT genotype shows as band of 161bp.
As shown in Figure 2, wherein swimming lane 1, swimming lane 2 only have the band of a 161bp, and it is TT genotype individuality, swimming lane 3, swimming lane 4 comprise 66bp and 95bp band, are CC genotype individuality, the band that swimming lane 5, swimming lane 6 comprise 161bp, 66bp band and 95bp band, for CT genotype individuality, swimming lane M is Marker (64bp, 80 bp, 89 bp, 104 bp, 124 bp, 184 bp, 192 bp, 213 bp, 234 bp, 267 bp).
The sequence checking of d, the individual PCR product order-checking of different genotype
The individual PCR product of different genotype is carried out respectively to positive and negative two-way order-checking; Simultaneously, carry out the SNP position analysis, individual its 1087 the sequencer map of the heterozygote CT genotype of band, 66bp band and 95bp band that result shows to comprise 161bp but be expressed as T or C, as shown in Figure 3 C, Wei Liangge peak, the 5th peak from left to right, and CC genotype, TT genotype are respectively C, T, as shown in Fig. 3 A, B.
Five, the frequency statistics analysis of chicken IGFBP-3 gene SNP site;
C gene frequency rangeability in Different Chicken kind IGFBP-3 gene SNP is between 0.62-0.80, as shown in table 2.
Four chicken kinds of table 2
iGFBPgene frequency and the genotype frequency of the 1087th SNP of-3 Exon 2s
Six, the association analysis of chicken IGFBP-3 gene SNP site genetic effect
The TT genotype in the 1087th site can be used as a candidate molecules genetic marker that improves the chicken egg number.As shown in table 3, in the 1087th site, the age in days maximum is produced in opening of CC genotype individuality, is 146.42 days, and the CT genotype is opened product the earliest, is 133.80 days, the CC genotype open produce age in days significantly be greater than the CT genotype (
p<0.05); And TT genotype 300 age in days egg numbers and 66 week age egg number be respectively 101.94 and 186.80, TT genotype 300 ages in days and 66 week age egg number be significantly higher than the CC type (
p<0.05).Above analytic explanation: the TT genotype in the 1087th site can be used as a candidate molecules genetic marker that improves the chicken egg number.
Table 3
iGFBP-the variance analysis (mean number ± standard deviation) of the yellow chicken egg laying performance of 3 Exon 2 1087 polymorphic sites and sea, capital
Claims (1)
1. detect the detection method of the single nucleotide polymorphism of chicken IGFBP-3 gene the second exon, it is characterized in that comprising the steps:
One, design chicken IGFBP-3 gene Second Exon zone PCR primer
The chicken NC_006089 sequence that NCBI was announced of take is reference, the primer P that design can be increased and be comprised chicken IGFBP-3 gene Second Exon zone, and its sequence is as follows:
Upstream primer is: CATCTTGGGACCAGTGCTTT 20;
Downstream primer is: ATTTTTCAAGCCTGCTGTGG 20;
Two, carry out the IGFBP-3 gene fragment of pcr amplification chicken to be measured with primer P
The collection of a, chicken sample
Gather the chicken kind in a plurality of places as detected object, the chicken complete genome DNA to be measured that comprises chicken IGFBP-3 gene of take is template;
B, chicken complete genome DNA template to be measured are processed
To the above-mentioned chicken complete genome DNA template to be measured containing chicken IGFBP-3 gene separated, extraction, purifying;
C, pcr amplification chicken IGFBP-3 gene fragment
The PCR reaction system adopts mixes the application of sample method, join in 1 1.5ml centrifuge tube, fully mix rear instantaneous centrifugal, divide again and install in each 96 hole flat board, then add the chicken complete genome DNA template to be measured after step b processes, instantaneous centrifugal laggard performing PCR amplification again, described PCR reaction system total amount is 19-25 μ L, it comprises the Mg that 10 * PCR Buffer, 2.0-3.0 μ L, concentration are 25mmol/L
2+2.2-2.5 μ L, dNTPs 0.8-1.5 μ L that concentration is 2 mmol/L, concentration is the upper of 10 pmol/ μ L, each 1 μ L of downstream primer, TaqDNA polysaccharase 0.2-0.6 μ L that concentration is 5 U/mL, the DNA profiling 1 .0-1.5 μ L that concentration is 100 ng/ μ L, ultrapure water 11.8-12.5 μ L, amplification program is: control temperature and be 92-96 ℃, the PCR reaction system is carried out to denaturation and process 4-6 min, maintain the temperature at 92-96 ℃, denaturing treatment 50-70 s, then reduce temperature to 54-58 ℃, carry out anneal 20-40 s, after anneal, rising temperature to 70-74 ℃, carry out again prolonged treatment 20-40s, by above-mentioned denaturing treatment,---anneal---prolonged treatment three steps repeat 30-35 circulations by above-mentioned order and processing requirement, operated rear control temperature and be 70-74 ℃, prolonged treatment 9-10 min, reduce again temperature to 9-10 ℃, the PCR reaction system is preserved,
Three, the IGFBP-3 gene fragment of MspI endonuclease reaction digestion pcr amplification
MspI endonuclease reaction digestion system comprises 4.6-5.2 μ L PCR products, restriction endonuclease MspI 5U, and 10 * Buffer, 0.8-1.1 μ L, distilled water 5-6 μ L, enzyme is cut digestion condition and is: 65 ℃ of water bath with thermostatic control digestion 6-8h;
Four, Polyacrylamide Gel Electrophoresis after MspI digestion PCR product
The polyacrylamide gel that a, making concentration are 10%, adopt 180V voltage electrophoresis 25-35min after point sample, EB dyeing after electrophoresis finishes;
B, until molecular weight, different chicken complete genome DNAs to be measured separates when clear, in Kodak's gel imaging system imaging;
C, according to polyacrylamide gel electrophoresis interpretation of result SNP polymorphism;
The single nucleotide polymorphism of identifying the 1087th of chicken IGFBP-3 gene according to the polyacrylamide gel electrophoresis result is: the CC type shows as 95bp and two bands of 66bp, the CT genotype shows as 161bp, 95 bp and tri-bands of 66 bp, and the TT genotype shows as band of 161bp;
The sequence checking of d, the individual PCR product order-checking of different genotype
The individual PCR product of different genotype is carried out respectively to positive and negative two-way order-checking, simultaneously, carry out the SNP position analysis;
Five, carry out the frequency statistics analysis of chicken IGFBP-3 gene SNP site;
Six, carry out the association analysis of chicken IGFBP-3 gene SNP site genetic effect
The TT genotype in the 1087th site can be used as a candidate molecules genetic marker that improves the chicken egg number.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2012103366453A CN103103252A (en) | 2012-09-13 | 2012-09-13 | Detection method for detecting single nucleotide polymorphism (SNP) of second exon of chicken IGFBP-3 (Insulin Like Growth Factor Binding Protein-3) gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2012103366453A CN103103252A (en) | 2012-09-13 | 2012-09-13 | Detection method for detecting single nucleotide polymorphism (SNP) of second exon of chicken IGFBP-3 (Insulin Like Growth Factor Binding Protein-3) gene |
Publications (1)
Publication Number | Publication Date |
---|---|
CN103103252A true CN103103252A (en) | 2013-05-15 |
Family
ID=48311443
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2012103366453A Pending CN103103252A (en) | 2012-09-13 | 2012-09-13 | Detection method for detecting single nucleotide polymorphism (SNP) of second exon of chicken IGFBP-3 (Insulin Like Growth Factor Binding Protein-3) gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103103252A (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103275986A (en) * | 2013-05-30 | 2013-09-04 | 扬州大学 | Jinghai yellow chicken laying-number molecular marker and application thereof |
CN103789444A (en) * | 2014-02-26 | 2014-05-14 | 扬州大学 | Molecular genetic marker of 300-day-old egg-laying number of Jinghai yellow chicken and application of molecular genetic marker |
CN108866209A (en) * | 2018-08-28 | 2018-11-23 | 扬州大学 | Liver marks and utilizes molecular marker-assisted selection method with the assisted Selection of geese fatty liver weight |
CN109082475A (en) * | 2018-08-28 | 2018-12-25 | 扬州大学 | Liver marks and utilizes molecular marker-assisted selection method with the assisted Selection of goose abdominal fat weight |
CN110317885A (en) * | 2019-08-05 | 2019-10-11 | 红河学院 | The PCR-RFLP method of the miniature chicken BPI gene SNP in mountain is enclosed greatly in a kind of detection |
CN113348512A (en) * | 2019-01-25 | 2021-09-03 | 吉尼劳吉株式会社 | Method for predicting genotype by using single nucleotide polymorphism data |
-
2012
- 2012-09-13 CN CN2012103366453A patent/CN103103252A/en active Pending
Non-Patent Citations (3)
Title |
---|
俞亚波等: "六个鸡种IGFBP-3基因第2外显子Msp I酶切位点的遗传多态性研究", 《中国家禽》 * |
沈敏等: "IGFBP-3基因多态性及其与中国美利奴羊部分羊毛性状的关联性分析", 《遗传》 * |
金崇富等: "京海黄鸡IGFBP-3基因外显子1和内含子1部分序列多态性及其与生长繁殖性状的相关性", 《中国畜牧兽医》 * |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103275986A (en) * | 2013-05-30 | 2013-09-04 | 扬州大学 | Jinghai yellow chicken laying-number molecular marker and application thereof |
CN103789444A (en) * | 2014-02-26 | 2014-05-14 | 扬州大学 | Molecular genetic marker of 300-day-old egg-laying number of Jinghai yellow chicken and application of molecular genetic marker |
CN103789444B (en) * | 2014-02-26 | 2014-10-15 | 扬州大学 | Molecular genetic marker of 300-day-old egg-laying number of Jinghai yellow chicken and application of molecular genetic marker |
CN108866209A (en) * | 2018-08-28 | 2018-11-23 | 扬州大学 | Liver marks and utilizes molecular marker-assisted selection method with the assisted Selection of geese fatty liver weight |
CN109082475A (en) * | 2018-08-28 | 2018-12-25 | 扬州大学 | Liver marks and utilizes molecular marker-assisted selection method with the assisted Selection of goose abdominal fat weight |
CN113348512A (en) * | 2019-01-25 | 2021-09-03 | 吉尼劳吉株式会社 | Method for predicting genotype by using single nucleotide polymorphism data |
CN110317885A (en) * | 2019-08-05 | 2019-10-11 | 红河学院 | The PCR-RFLP method of the miniature chicken BPI gene SNP in mountain is enclosed greatly in a kind of detection |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN101629209B (en) | Method for detecting cattle Six6 gene single nucleotide polymorphism | |
CN103103252A (en) | Detection method for detecting single nucleotide polymorphism (SNP) of second exon of chicken IGFBP-3 (Insulin Like Growth Factor Binding Protein-3) gene | |
CN108220408B (en) | Grain-saving green-shin recessive white feather broiler new strain breeding method | |
WO2023165128A1 (en) | Chicken low-density snp liquid-phase chip based on target capture sequencing and use thereof | |
CN107779516B (en) | It is a kind of influence pig birth weight character SNP marker and its application | |
CN110951889B (en) | Haplotype molecular marker related to chicken body weight and application thereof | |
CN109811063A (en) | One kind SNP marker relevant to growth speed of pigs and its application | |
CN104962634A (en) | Kit used for detecting body size traits of chicken and molecular breeding method of chicken | |
CN110331217B (en) | Microsatellite marker paternity test primer suitable for Nile tilapia, Oreochromis aureus and hybrid thereof, method and application | |
CN111926085A (en) | Molecular marker influencing chicken muscle brightness and application thereof | |
CN104894289A (en) | Kit for detecting chicken growth characters and chicken molecular breeding method | |
CN110079613B (en) | Molecular marker of heat stress tolerance of Holstein cattle and detection method | |
CN108570508B (en) | Molecular marker related to chicken beak malformation character and application thereof | |
CN107828902B (en) | SNP molecular marker related to sheep tail length and application thereof | |
CN104878110B (en) | A kind of analysis method of animal economic characters chondriogen effect | |
CN106801105A (en) | The SSR marker being associated with ramee fineness and application | |
CN114231645B (en) | SNP molecular marker related to black peritoneum characters of chickens and application | |
CN110835651B (en) | Primer and kit for detecting indel multiple allele markers of chicken CDKN3 gene promoter region and application of primer and kit | |
CN112176073B (en) | PROS1 gene molecular marker related to chicken carcass traits and application | |
CN103103253A (en) | Method for detecting single nucleotide polymorphism of 5' flanking region of chicken MDH (Malate Dehydrogenase) gene | |
CN107868835B (en) | SNP molecular marker related to sheep tail width and application thereof | |
CN102094081A (en) | Method for detecting single nucleotide polymorphism of cattle SH2B1 gene | |
CN110551824B (en) | SNP molecular marker related to sperm storage capacity of hen and application thereof | |
CN107130037B (en) | Method and special kit for auxiliary detection of cattle growth and carcass traits through TNNI1 gene | |
CN111118173A (en) | Linkage SNP locus affecting yak milk freezing point and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C12 | Rejection of a patent application after its publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130515 |