CN103088134B - Method for detecting microorganism with hydrocarbon degradation function under anaerobic conditions - Google Patents
Method for detecting microorganism with hydrocarbon degradation function under anaerobic conditions Download PDFInfo
- Publication number
- CN103088134B CN103088134B CN201310022349.0A CN201310022349A CN103088134B CN 103088134 B CN103088134 B CN 103088134B CN 201310022349 A CN201310022349 A CN 201310022349A CN 103088134 B CN103088134 B CN 103088134B
- Authority
- CN
- China
- Prior art keywords
- microorganism
- seq
- sample
- under anaerobic
- primer pair
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for detecting a microorganism with a hydrocarbon degradation function under anaerobic conditions. The method comprises the following steps: (1), extracting DNA (Deoxyribose Nucleic Acid) of a sample microorganism; (2), carrying out PCR (Polymerase Chain Reaction) augmentation on the DNA of the sample microorganism by adopting a primer pair I shown by SEQ ID NO:1 and SEQ ID NO:2 in a sequence table, the primer pair II shown by SEQ ID NO:3 and SEQ ID NO:4 in the sequence table, and the primer pair III shown by SEQ ID NO:5 and SEQ ID NO:6 in the sequence table; (3), connecting and transferring the PCR augmentation products to a competent cell and sequencing the PCR augmentation products; and (4), analyzing the sequence to obtain the information of the microorganism with the hydrocarbon degradation function under anaerobic conditions. According to the method disclosed by the invention, the microorganism DNA in the sample is augmented by a special primer, and the information of the microorganism with the hydrocarbon degradation function under anaerobic conditions in the sample is obtained by combining with the sequencing method. The method disclosed by the invention is strong in detecting specificity, convenient to operate, accurate and complete to detect, and capable of overcoming various defects existing the conventional detecting method depending on cultivating and counting.
Description
Technical field
The present invention relates to microorganism detection authenticate technology field, especially relate to a kind of detection and have the method for the hydrocarbon functional microorganism of degrading under anaerobic condition.
Background technology
Oil reservoir is a typical anaerobic environment, wherein contains a large amount of petroleum hydrocarbons and breeds the microorganism of diverse in function.In this huge geology bio-reactor, ubiquity is the microorganism of degradation of hydrocarbon under anaerobic.The large component of crude oil two is made up of aromatic hydrocarbon, alkane and bituminous matter, and most hydro carbons are poorly soluble, and chemical property comparatively degrade by stable being difficult for.In aromatic hydrocarbon, benzene, toluene, ethylbenzene, dimethylbenzene (BTEX compound) are strong pollutents, thereby receive much concern.But it is poisonous also having some in alkane, so the microorganism of research anaerobic degradation alkane is significant equally.Research shows, the microorganism with anaerobic degradation alkane function mainly has nitrate reduction bacterium, sulphate reducing bacteria and methanogen floras.Under anaerobic condition, microbiological deterioration hydrocarbon is conducive to improve oil recovery factor, is the focus of studying both at home and abroad at present.This research has great theory significance and using value aspect the exploitation of oil reservoir irreducible oil biogasification and petroleum pollution biological restoration.
Aspect analyzing and testing alkane degradation microorganism, conventional art mainly comprises following 3 kinds of methods:
(1) selective medium of liquid screening cultural method-employing taking hydrocarbon as sole carbon source cultivated detected sample, through repeatedly cultivating, select the superior and eliminate the inferior, finally obtain the microorganism of the hydrocarbon of can degrading, then use the bacterium amount in Microscopical Method For Detection and turbidimetry for Determination culture; (2) the solid medium screening and separating alkane degradation bacterium that solid culture method-use contains the nutritive substances such as hydrocarbon, nitrogen and phosphorus can be surveyed bacterium number in conjunction with the method for plate culture count and most probable number method (MPN method) simultaneously.(3) bacterium bottle method-identical with ultimate principle and the method for MPN method, utilizes the reacting phenomenon indicator microoraganism growth of alkane degradation product.
In above-mentioned 3 kinds of methods, bacterium bottle method at present application is more, but all following defects of these 3 kinds of methods: and detects not comprehensively, while detection for anerobe compared with being suitable for aerobic bacteria detection, difficulty is very large; For the low microorganism of abundance, may cause undetected because culture condition discomfort is eliminated gradually; Sense cycle is long, consumption is large, must adopt respectively different culture condition to detect, thereby workload is large for the different microorganism of physiological property; Detect the classified information that Microscopical Method For Detection, reduced turbidity method, MPN and bacterium bottle method all can not obtain alkane degradation bacterium.In addition, in environmental sample, (as oil reservoir) growing rich and varied microorganism, the overwhelming majority has degraded hydrocarbon function, but wherein most microorganisms belong to not educable, because traditional method depends on cultivation, therefore adopt the traditional method cannot cognitive these microorganisms, caused a blind area in structure of community and the function understanding of this quasi-microorganism.
Microbial DNA in primer amplified sample for the present invention, obtains the information in sample with the microorganism of alkane degradation function in conjunction with the method for order-checking.Detection specificity of the present invention is strong, simple operation, and detection accurately, comprehensively, has overcome and has relied on the existing various defects of traditional detection method of cultivating and counting.
Summary of the invention
Object of the present invention be exactly provide in order to overcome the defect that above-mentioned prior art exists a kind of with strong points, easy and simple to handle, detect the method for microorganism in comprehensive and accurate rapid detection sample with the hydrocarbon function of degrading under anaerobic condition.
Object of the present invention can be achieved through the following technical solutions.
The invention provides the method for microorganism that a kind of detection has the hydrocarbon function of degrading under anaerobic condition, the method comprises the steps:
(1) DNA of extraction sample microorganism;
(2) adopt respectively primer pair 2 shown in primer pair 1, SEQ ID NO:3 and SEQ ID NO:4 shown in SEQ ID NO:1 and SEQ ID NO:2 in sequence table, and shown in SEQ ID NO:5 and SEQ ID NO:6, primer pair 3 carries out pcr amplification to the DNA of sample microorganism:
(3) pcr amplification product is connected and be converted into competent cell order-checking;
(4) analytical sequence, obtains having in sample the information of microorganism of hydrocarbon function of degrading under anaerobic condition.
In method of the present invention, the primer pair that step (2) adopts is specially:
Primer pair 1
Forward: CCNACCACNAAGCAYGG(SEQ ID NO:1),
Reverse: TCGTCRTTGCCCCATTTIGGIGC(SEQ ID NO:2);
Primer pair 2
Forward: TCGAYGAYGGSTGCATGGA(SEQ ID NO:3),
Reverse: TTCTGGTTYTTCTGCAC(SEQ ID NO:4);
Primer pair 3
Forward: GCAGTACAAYTCCTACACSACYGABATGGT(SEQ ID NO:5),
Reverse: CCRTGCTTSGGRCCVGCCTGVCCGAA(SEQ ID NO:6).
The reaction composition that adopts respectively above-mentioned each primer pair to carry out pcr amplification to the DNA of sample microorganism is that sterilized water 12 μ L, 2 × Taq PCR master mix9 μ L, concentration are 12.5 μ molL
-1the forward of primer pair and the DNA2 μ L of the each 1 μ L of reverse primer, sample microorganism.The DNA concentration of described sample microorganism is adjusted at 50ng μ L
-1left and right.
The response procedures that adopts above-mentioned primer pair to carry out pcr amplification to the DNA of sample microorganism is: a) 94 ° of C insulation 5min; B) 94 ° of C insulation 45s; C) 60 ° of C insulation 1min; D) 72 ° of C insulation 1min; E) repeat b) ~ d) 48 times; F) after 72 ° of C insulation 10min, finish.
brief description of drawings
Fig. 1 is pcr amplification product agarose gel electrophoresis figure.
Embodiment
Below in conjunction with specific embodiment, the present invention is described in detail.These embodiment, just for the present invention is described, do not form limitation of the scope of the invention.
Embodiment
In North China oil well production fluid sample (S1, S2, S3, S4), there is the detection of the microorganism of the hydrocarbon function of degrading under anaerobic condition
1. extract the DNA of microorganism in sample
Adopt Axygen bacterial genomes DNA extraction test kit (Axygen Biosciences, Inc., the U.S.), the method for describing is to specifications extracted the DNA of North China Oilfield fluid produced by oil production well sample microorganism.
2. adopt respectively primer pair 1(forward: CCNACCACNAAGCAYGG, reverse: TCGTCRTTGCCCCATTTIGGIGC), primer pair 2(forward: TCGAYGAYGGSTGCATGGA, reverse: TTCTGGTTYTTCTGCAC) and primer pair 3(forward: GCAGTACAAYTCCTACACSACYGABATGGT, oppositely: CCRTGCTTSGGRCCVGCCTGVCCGAA) DNA of sample microorganism is carried out to pcr amplification.
1) pcr amplification reaction system
Utilize primer pair 1, primer pair 2 and primer pair 3 to carry out respectively pcr amplification to sample microbial DNA, pcr amplification reaction composing system is identical, comprises 12 μ L sterilized waters, and 9 μ L2 × Taq PCRmaster mix and concentration are 12.5 μ molL
-1the each 1 μ L of forward and reverse primer of primer pair, finally add the DNA2 μ L of microorganism in the sample of extraction.
2) pcr amplification reaction program
Utilize primer pair 1, primer pair 2 identical with the PCR response procedures that primer pair 3 carries out the amplification of sample microbial DNA: a) 94 ° of C insulation 5min; B) 94 ° of C insulation 45s; C) 60 ° of C insulation 1min; D) 72 ° of C insulation 1min; E) repeat b) ~ d) 48 times; F) after 72 ° of C insulation 10min, finish.
3) after pcr amplification reaction finishes, get 5 μ L PCR products, the sepharose with 1.0% carries out electrophoresis qualification, takes pictures.The results are shown in Figure 1.
3. amplified production connection is converted into competent cell order-checking
Adopt Axygen glue to reclaim purification kit (Axygen Biosciences, Inc., the U.S.), the method that by specification is described is extracted amplification gained goal gene.Employing Takara company
simple support agent box, the goal gene connection that the method that by specification is described obtains extraction is converted in competent escherichia coli cell, cultivates the cell connecting after transforming, and then cultivation gained cell is sent to Nanjing Genscript Biotechnology Co., Ltd.'s order-checking.
1) the primer pair 1 S1 sample that increases, amplified production connects after being converted into competent escherichia coli cell and checks order, and represents sequence A 11(SEQ ID NO:7):
TCGGCCACGGCCAACTGCGCCAAGATGGTGGAATACGCTCTTCT
AAACGGCTACGACCCGGTTGTTCAGATGCAGATGGGGCCAAAG
ACCGGCGATTCCGCCAAGTTCACGGACTTCGAGCAGCTTTTCGC
CGCGTGGGTGACCCAGATGGAATGGCTGACGAACACCCTGGTG
CGCACGGTGAACCTTGGCCGGTACAAGGACCCGGAATTCTACG
GCAGGCCCTTCCTCTCGGCCACATACGAGCGGGCGGTTGAATCG
GGCCTGGATGCGGTAAGCCCGGTGGGTGATCGCGGCAACTGCT
GGATAACCGGTTTCACATGGGTTGAAAACATAGACAGCCTGGCT
GCGGTTAAAAAGCTTGTTTTCGACGACAAAAAATACACCATGA
GCGAACTTCTGGAAGCCCTTCGCACCAACTGGGACGGCCGCGA
GCAGATGAGGCTCGATTTCGTGAATGCCCCCAAATGGGGCAAC
GACG
2) the primer pair 2 S3 sample that increases, amplified production connects after being converted into competent escherichia coli cell and checks order, and represents sequence A 23(SEQ ID NO:8):
ATGGAACTTGGCCGGGACGCCTGTGAGCTTTCCGAGCAGCCCA
ACGGCTGGCATAATCCGATTACAACCGTTGTGGCGGCCAATTCC
CTGGTGGCTATCAAAAAACTGATTTATGATGATAAAAAGTACAC
CATGGGCCAGCTCATGAATGCCCTGAGGGCAAACTGGGAAGGC
TATGAAGAAATGCAGAAGGACTTTAAAAACGCTCCCAAGTGGG
GCAATGACGATGAATATTGCGACGCAATAATCAAGGCCTTTTATG
AGGATATCATCGGAGGAGAAATGAGCAAGATTACCAACTATTCG
GGAGGTCCGGTGCTTCCGGTGGGACAGGGTGTCGGGCTGTATAT
GGAAGTCGGATCGCGGACCGGCCCGACCCCTGACGGTCGATTC
GGAGGGGAAGCGGCAGATGACGGCGGGATTTCTCCTTATATGGG
TACGGACCATAAAGGGCCGACCGCGGTGCTGAGATCGGTATCA
AACGTGCAGAAAAACCAG
3) the primer pair 3 S2 sample that increases, amplified production connects after being converted into competent escherichia coli cell and checks order, and represents sequence A 32(SEQ ID NO:9):
GAAGGGCGTCATCGCCGGCTTCCAGCGCGCATCAAGCGACCG
CAAGATCGTCGCCGCGGTGTTTACCGGCGTCGGCGACAAGGCC
TTCTGCACCGGTGGCAACACCGCCGAGTACGCCGTCTACTACTC
GCGCCGGCCCAATGAATACGGCGAGTACATGGACCTCTTCAACG
CCATGGTCGACGGCATCCTCAACTGCAAGAAGCCGGTGATCTGC
CGCGTGAACGGCATGCGCGTCGCCGGCGGCCAGGAGATCGGCA
TGGCCACCGACATCACCGTCACCTCCGACCTCGCCGTGC
4) the primer pair 3 S3 sample that increases, amplified production connects after being converted into competent escherichia coli cell and checks order, and represents sequence A 33(SEQ ID NO:10):
CAAAGGCGTGATCCTCGCCTTCCGTGAGGCGAGCGCAGCGCGC
GACGTCGTCGCAGTGGTGTTTACCGGTGCCGGCGACAAGGCCTT
CTGCACCGGCGGAAATACCAAGGAATACGCCGAATATTACGCCG
GCAATCCGCAGGAATATCGCGGCTATATGCGGCTGTTCAACGACA
TGGTGTCAGCCATCCTGGGCTGCGACAAGCCCGTGATCTGCCGG
GTCAACGGCATGCGCATCGGCGGCGGCCAGGAAATCGGCATGG
CCTGCGATTTCACGATCGCGCAGGATCTGGCGCGC
5) the primer pair 3 S4 sample that increases, amplified production connects after being converted into competent escherichia coli cell and checks order, and represents sequence A 34(SEQ ID NO:11):
ATGGAGCTCTTCAACAACATGGTCGACTCCATCCTCACGTGCAA
GAAGCCCGTCATCTGCCGGGTGAACGGCATGAGGGTCGCCGGC
GGGCAGGAAATCGGCCTGGCGTGCGACATCGCTATCGCCTCCG
ACCTCGCCATC
4. sequential analysis
The database search program blast(based on sequence similarity by gained sequence results in state-run biotechnology information center of the U.S. (NCBI) exploitation
http:// blast.ncbi.com) upper compare of analysis, the information that obtains detecting the microorganism in sample with the hydrocarbon function of degrading under anaerobic condition is as follows:
1) the primer pair 1 S1 sample that increases, amplified production connects after being converted into competent escherichia coli cell and checks order, and represents sequence A 11.Through sequence alignment analysis, sequence A 11 is in protein level and Desulfatibacillum alkenivorans AK-01 similarity 83%, and this bacterium is the microorganism of alkane of can under anaerobic degrading.This bacterium of S1 sample detection clone number is 23, and always cloning number is that 23(is in table 1), the microorganism of the alkane that shows under anaerobic to degrade in S1 sample is all such bacterium.
Adopt primer pair 1 increase S3 sample and S4 sample, amplified production represents that the sequencing result of sequence is with S1 sample.For S3 sample, the clone's number that such bacterium detected is 24, and always cloning number is that 26(is in table 1), in the microorganism of the alkane of under anaerobic degrading in calculating S3 sample, such bacterium relative abundance is 92.3%.For S4 sample, detect that such bacterium clone number is 28, always cloning number is that 28(is in table 1), calculating under anaerobic the degrade microorganism of alkane of S4 sample is all such bacterium.
2) the primer pair 2 S3 sample that increases, amplified production connects after being converted into competent escherichia coli cell and checks order, and represents sequence A 23.Through sequence alignment analysis, above-mentioned sequence, in protein level and Desulfobacula toluolica similarity 81%, shows to exist in reservoir media the microorganism of the aromatic hydrocarbon of can under anaerobic degrading.S3 sample detection, such bacterium clone number is 30, always cloning number is that 30(is in table 1), in the microorganism of the aromatic hydrocarbon that shows under anaerobic to degrade in S3 sample, be all such bacterium.
Adopt the primer pair 2 S4 sample that increases, amplified production represents that the sequencing result of sequence is with S3 sample, such bacterium of S4 sample detection clone number is 25, and always cloning number is that 25(is in table 1), the microorganism of the aromatic hydrocarbon that shows under anaerobic to degrade in S4 sample is all such bacterium.
3) the primer pair 3 S2 sample that increases, amplified production connects after being converted into competent escherichia coli cell and checks order, and represents sequence A 32.Through sequence alignment analysis, above-mentioned sequence, in protein level and Azoarcus toluvorans similarity 87%, shows to exist in reservoir media the microorganism of the aromatic hydrocarbon of can under anaerobic degrading.Such bacterium of S2 sample detection clone number is 14, and always cloning number is that 26(is in table 1), in the microorganism of the aromatic hydrocarbon that shows under anaerobic to degrade in S2 sample, the relative abundance of such bacterium is 53.8%.
4) the primer pair 3 S3 sample that increases, amplified production connects after being converted into competent escherichia coli cell and checks order, and represents sequence A 33.Through sequence alignment analysis, above-mentioned sequence, in protein level and Thauera chlorobenzoica similarity 90%, shows to exist in reservoir media the microorganism of the aromatic hydrocarbon of can under anaerobic degrading.Such bacterium clone number of S3 sample detection is 8, and always cloning number is that 21(is in table 1), in the microorganism of the aromatic hydrocarbon of under anaerobic degrading in calculating S3 sample, the relative abundance of such bacterium is 38.1%.
5) the primer pair 3 S4 sample that increases, amplified production connects after being converted into competent escherichia coli cell and checks order, and represents sequence A 34.Through sequence alignment analysis, above-mentioned sequence is in protein level and Desulfobacterium aniline DSM4660 similarity 87%, such bacterium clone number of S4 sample detection is 15, total clone's number is that 27(is in table 1), in the microorganism of the aromatic hydrocarbon of under anaerobic degrading in calculating S4 sample, the relative abundance of such bacterium is 55.6%.
Table 1 anaerobism alkane degradation gene library clone number
(note: " ND " represents not detect)
Claims (3)
1. detection has a method of microorganism for the hydrocarbon function of degrading under anaerobic condition, it is characterized in that comprising the steps:
(1) DNA of extraction sample microorganism;
(2) adopt respectively primer pair 2 shown in primer pair 1, SEQ ID NO:3 and SEQ ID NO:4 shown in SEQ ID NO:1 and SEQ ID NO:2 in sequence table, and shown in SEQ ID NO:5 and SEQ ID NO:6, primer pair 3 carries out pcr amplification to the DNA of sample microorganism;
(3) pcr amplification product is connected and be converted into competent cell order-checking;
(4) analytical sequence, obtains having in sample the information of microorganism of hydrocarbon function of degrading under anaerobic condition.
2. detection according to claim 1 has the method for microorganism of the hydrocarbon function of degrading under anaerobic condition, and wherein the reaction composition of the described pcr amplification of step (2) is that sterilized water 12 μ L, 2 × TaqPCR master mix9 μ L, concentration are 12.5 μ molL
-1the forward of primer pair and the DNA2 μ L of the each 1 μ L of reverse primer, sample microorganism.
3. detection according to claim 1 has the method for microorganism of the hydrocarbon function of degrading under anaerobic condition, and wherein the response procedures of the described pcr amplification of step (2) is: a) 94 ° of C insulation 5min; B) 94 ° of C insulation 45s; C) 60 ° of C insulation 1min; D) 72 ° of C insulation 1min; E) repeat b) ~ d) 48 times; F) after 72 ° of C insulation 10min, finish.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310022349.0A CN103088134B (en) | 2013-01-22 | 2013-01-22 | Method for detecting microorganism with hydrocarbon degradation function under anaerobic conditions |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310022349.0A CN103088134B (en) | 2013-01-22 | 2013-01-22 | Method for detecting microorganism with hydrocarbon degradation function under anaerobic conditions |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103088134A CN103088134A (en) | 2013-05-08 |
| CN103088134B true CN103088134B (en) | 2014-07-30 |
Family
ID=48201261
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310022349.0A Active CN103088134B (en) | 2013-01-22 | 2013-01-22 | Method for detecting microorganism with hydrocarbon degradation function under anaerobic conditions |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103088134B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101864488B (en) * | 2010-05-30 | 2013-03-06 | 大庆石油管理局 | PCR-DGG primer for extracting sample microorganism total DNA in microbial enhanced oil recovery |
-
2013
- 2013-01-22 CN CN201310022349.0A patent/CN103088134B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN103088134A (en) | 2013-05-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Guo et al. | Dissecting microbial community structure and methane-producing pathways of a full-scale anaerobic reactor digesting activated sludge from wastewater treatment by metagenomic sequencing | |
| Antwi et al. | Functional bacterial and archaeal diversity revealed by 16S rRNA gene pyrosequencing during potato starch processing wastewater treatment in an UASB | |
| Barnhart et al. | Investigation of coal-associated bacterial and archaeal populations from a diffusive microbial sampler (DMS) | |
| Venkiteshwaran et al. | Correlating methane production to microbiota in anaerobic digesters fed synthetic wastewater | |
| Sivagurunathan et al. | Batch fermentative hydrogen production by enriched mixed culture: combination strategy and their microbial composition | |
| Guo et al. | Methylotrophic methanogenesis governs the biogenic coal bed methane formation in Eastern Ordos Basin, China | |
| Zhang et al. | Effect of salinity on the microbial community and performance on anaerobic digestion of marine macroalgae | |
| Liu et al. | Bacterial community dynamics in a swine wastewater anaerobic reactor revealed by 16S rDNA sequence analysis | |
| CN103981259A (en) | Analysis method for diversity of microbes and abundance of species in coal seam water | |
| Shelton et al. | Environmental drivers of differences in microbial community structure in crude oil reservoirs across a methanogenic gradient | |
| Lackner et al. | Hydrogenotrophic methanogenesis and autotrophic growth of Methanosarcina thermophila | |
| Dong et al. | Performance and microbial community of hydrogenotrophic methanogenesis under thermophilic and extreme-thermophilic conditions | |
| Guo et al. | Phylogenetic diversity of microbial communities associated with coalbed methane gas from Eastern Ordos Basin, China | |
| Grohmann et al. | Microbiome dynamics and adaptation of expression signatures during methane production failure and process recovery | |
| CN103882105A (en) | Method for measuring content of saturated hydrocarbon-degrading gene AlkB in petroleum-contaminated soil | |
| Smith et al. | Effect of an algal amendment on the microbial conversion of coal to methane at different sulfate concentrations from the Powder River Basin, USA | |
| Perkins et al. | Comparative 16S rRNA gene surveys of granular sludge from three upflow anaerobic bioreactors treating purified terephthalic acid (PTA) wastewater | |
| CN107686849A (en) | A kind of method for promoting oil reservoir petrochina hydrocarbon anaerobic degradation methane phase | |
| CN103088134B (en) | Method for detecting microorganism with hydrocarbon degradation function under anaerobic conditions | |
| CN105018343B (en) | Ortho states microorganism oil gas and the automation sample processing device and Automation workstation of hydrate exploration technology | |
| Rettenmaier et al. | Comparison of sampling techniques and different media for the enrichment and isolation of cellulolytic organisms from biogas fermenters | |
| CN104975090A (en) | Method for automatically detecting abundance of butane oxidizing bacteria | |
| CN105018609A (en) | Automatic detection method of abundance of methane-oxidizing bacteria | |
| Xiao et al. | Selective enrichment of clostridium spp. by nutrition control from SiHe coal geological microbial communities | |
| Xingbiao et al. | Influences of microbial community structures and diversity changes by nutrients injection in Shengli oilfield, China |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |