CN103088134A - Method for detecting microorganism with hydrocarbon degradation function under anaerobic conditions - Google Patents
Method for detecting microorganism with hydrocarbon degradation function under anaerobic conditions Download PDFInfo
- Publication number
- CN103088134A CN103088134A CN2013100223490A CN201310022349A CN103088134A CN 103088134 A CN103088134 A CN 103088134A CN 2013100223490 A CN2013100223490 A CN 2013100223490A CN 201310022349 A CN201310022349 A CN 201310022349A CN 103088134 A CN103088134 A CN 103088134A
- Authority
- CN
- China
- Prior art keywords
- microorganism
- seq
- sample
- under anaerobic
- primer pair
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for detecting a microorganism with a hydrocarbon degradation function under anaerobic conditions. The method comprises the following steps: (1), extracting DNA (Deoxyribose Nucleic Acid) of a sample microorganism; (2), carrying out PCR (Polymerase Chain Reaction) augmentation on the DNA of the sample microorganism by adopting a primer pair I shown by SEQ ID NO:1 and SEQ ID NO:2 in a sequence table, the primer pair II shown by SEQ ID NO:3 and SEQ ID NO:4 in the sequence table, and the primer pair III shown by SEQ ID NO:5 and SEQ ID NO:6 in the sequence table; (3), connecting and transferring the PCR augmentation products to a competent cell and sequencing the PCR augmentation products; and (4), analyzing the sequence to obtain the information of the microorganism with the hydrocarbon degradation function under anaerobic conditions. According to the method disclosed by the invention, the microorganism DNA in the sample is augmented by a special primer, and the information of the microorganism with the hydrocarbon degradation function under anaerobic conditions in the sample is obtained by combining with the sequencing method. The method disclosed by the invention is strong in detecting specificity, convenient to operate, accurate and complete to detect, and capable of overcoming various defects existing the conventional detecting method depending on cultivating and counting.
Description
Technical field
The present invention relates to microorganism detection authenticate technology field, especially relate to a kind of method that detection has degraded hydrocarbon functional microorganism under anaerobic condition.
Background technology
Oil reservoir is a typical anaerobic environment, wherein contains a large amount of petroleum hydrocarbons and breeds the microorganism of diverse in function.In this huge geology bio-reactor, ubiquity is the microorganism of degradation of hydrocarbon under anaerobic.The large component of crude oil two is comprised of aromatic hydrocarbon, alkane and bituminous matter, and most hydro carbons are poorly soluble, and chemical property comparatively degrade by stable being difficult for.In aromatic hydrocarbon, benzene, toluene, ethylbenzene, dimethylbenzene (BTEX compound) are strong pollutents, thereby receive much concern.But some are also arranged in alkane is poisonous, so the microorganism of research anaerobic degradation alkane is significant equally.Studies show that, the microorganism with anaerobic degradation alkane function mainly has nitrate reduction bacterium, sulphate reducing bacteria and methanogen floras.Under anaerobic condition, the microbiological deterioration hydrocarbon is conducive to improve oil recovery factor, is the focus of studying both at home and abroad at present.This research has great theory significance and using value aspect the exploitation of oil reservoir irreducible oil biogasification and petroleum pollution biological restoration.
Aspect analyzing and testing alkane degradation microorganism, conventional art mainly comprises following 3 kinds of methods:
(1) selective medium of liquid screening cultural method-employing take hydrocarbon as sole carbon source cultivated detected sample, through repeatedly cultivating, and the survival of the fittest, then the microorganism of the hydrocarbon that obtains at last to degrade uses the bacterium amount in Microscopical Method For Detection and turbidimetry for Determination culture; (2) solid culture method-use contains the solid medium screening and separating alkane degradation bacterium of the nutritive substances such as hydrocarbon, nitrogen and phosphorus, can survey the bacterium number in conjunction with the method for plate culture count and most probable number method (MPN method) simultaneously.(3) bacterium bottle method-identical with ultimate principle and the method for MPN method is utilized the reacting phenomenon indicator microoraganism growth of alkane degradation product.
In above-mentioned 3 kinds of methods, bacterium bottle method is used at present more, but these 3 kinds of methods following defective all: detects not comprehensive, be suitable for that aerobic bacteria detects and when being used for the anerobe detection difficulty very large; For the low microorganism of abundance, may be because the culture condition discomfort be eliminated gradually and causes undetected; Sense cycle is long, consumption is large, must adopt respectively different culture condition to detect for the different microorganism of physiological property, thereby workload is large; Detect Microscopical Method For Detection, reduced turbidity method, MPN and bacterium bottle method and all can not obtain the classified information of alkane degradation bacterium.In addition, in environmental sample, (as oil reservoir) growing rich and varied microorganism, the overwhelming majority has degraded hydrocarbon function, but wherein most microorganisms belong to and can not cultivate, because traditional method depends on cultivation, therefore adopt the traditional method can't cognitive these microorganisms, caused the structure of community of this quasi-microorganism and a blind area on function understanding.
The present invention has the information of the microorganism of alkane degradation function with the microbial DNA in the primer amplified sample in the method acquisition sample in conjunction with order-checking.Detection specificity of the present invention is strong, simple operation, and it is accurate, comprehensive to detect, and has overcome the existing various defectives of traditional detection method that rely on cultivation and counting.
Summary of the invention
Purpose of the present invention be exactly provide in order to overcome the defective that above-mentioned prior art exists a kind of with strong points, easy and simple to handle, detect the method for microorganism that has degraded hydrocarbon function under anaerobic condition in comprehensive and accurate rapid detection sample.
Purpose of the present invention can be achieved through the following technical solutions.
The invention provides the method for microorganism that a kind of detection has degraded hydrocarbon function under anaerobic condition, the method comprises the steps:
(1) extract the DNA of sample microorganism;
(2) adopt respectively primer pair 2 shown in primer pair 1, SEQ ID NO:3 and SEQ ID NO:4 shown in SEQ ID NO:1 and SEQ ID NO:2 in sequence table, and the DNA of 3 pairs of sample microorganisms of primer pair shown in SEQ ID NO:5 and SEQ ID NO:6 carries out pcr amplification:
(3) the pcr amplification product connection is converted into competent cell and order-checking;
(4) analytical sequence obtains having in sample the information of the microorganism of degraded hydrocarbon function under anaerobic condition.
In method of the present invention, the primer pair that step (2) adopts is specially:
Primer pair 1
Forward: CCNACCACNAAGCAYGG(SEQ ID NO:1),
Oppositely: TCGTCRTTGCCCCATTTIGGIGC(SEQ ID NO:2);
Primer pair 2
Forward: TCGAYGAYGGSTGCATGGA(SEQ ID NO:3),
Oppositely: TTCTGGTTYTTCTGCAC(SEQ ID NO:4);
Primer pair 3
Forward: GCAGTACAAYTCCTACACSACYGABATGGT(SEQ ID NO:5),
Oppositely: CCRTGCTTSGGRCCVGCCTGVCCGAA(SEQ ID NO:6).
Adopting respectively above-mentioned each primer pair is that sterilized water 12 μ L, 2 * Taq PCR master mix9 μ L, concentration are 12.5 μ molL to the reaction composition that the DNA of sample microorganism carries out pcr amplification
-1The forward of primer pair and the DNA2 μ L of each 1 μ L of reverse primer, sample microorganism.The DNA concentration of described sample microorganism is adjusted at 50ng μ L
-1The left and right.
Adopt above-mentioned primer pair to the response procedures that the DNA of sample microorganism carries out pcr amplification to be: a) 94 ° of C insulation 5min; B) 94 ° of C insulation 45s; C) 60 ° of C insulation 1min; D) 72 ° of C insulation 1min; E) repeat b) ~ d) 48 times; F) finish after 72 ° of C insulation 10min.
Brief description of drawings
Fig. 1 is pcr amplification product agarose gel electrophoresis figure.
Embodiment
The present invention is described in detail below in conjunction with specific embodiment.These embodiment just are used for explanation the present invention, do not consist of limitation of the scope of the invention.
Embodiment
The detection that has the microorganism of degraded hydrocarbon function under anaerobic condition in North China oil well production fluid sample (S1, S2, S3, S4)
1. the DNA of microorganism in the extraction sample
Adopt Axygen bacterial genomes DNA extraction test kit (Axygen Biosciences, Inc., the U.S.), the method for describing is to specifications extracted the DNA of North China Oilfield fluid produced by oil production well sample microorganism.
2. adopt respectively primer pair 1(forward: CCNACCACNAAGCAYGG, oppositely: TCGTCRTTGCCCCATTTIGGIGC), primer pair 2(forward: TCGAYGAYGGSTGCATGGA, oppositely: TTCTGGTTYTTCTGCAC) and primer pair 3(forward: GCAGTACAAYTCCTACACSACYGABATGGT, oppositely: CCRTGCTTSGGRCCVGCCTGVCCGAA) DNA of sample microorganism carried out pcr amplification.
1) pcr amplification reaction system
Utilize primer pair 1, primer pair 2 and 3 pairs of sample microbial DNAs of primer pair to carry out respectively pcr amplification, the pcr amplification reaction composing system is identical, comprises 12 μ L sterilized waters, and 9 μ L2 * Taq PCRmaster mix and concentration are 12.5 μ molL
-1Each 1 μ L of forward and reverse primer of primer pair, add at last the DNA2 μ L of microorganism in the sample of extraction.
2) pcr amplification reaction program
Utilize primer pair 1, primer pair 2 and primer pair 3 to carry out the PCR response procedures of sample microbial DNA amplification identical: a) 94 ° of C insulation 5min; B) 94 ° of C insulation 45s; C) 60 ° of C insulation 1min; D) 72 ° of C insulation 1min; E) repeat b) ~ d) 48 times; F) finish after 72 ° of C insulation 10min.
3) after pcr amplification reaction finishes, get 5 μ L PCR products, the sepharose with 1.0% carries out electrophoresis to be identified, takes pictures.The results are shown in Figure 1.
3. the amplified production connection is converted into competent cell and order-checking
Adopt Axygen glue to reclaim purification kit (Axygen Biosciences, Inc., the U.S.), the method that by specification is described is extracted amplification gained goal gene.Employing Takara company
Simple support agent box, the method that by specification is described is converted into the goal gene connection that extraction obtains in competent escherichia coli cell, cultivates the cell that connects after transforming, and then will cultivate the gained cell and send Nanjing Genscript Biotechnology Co., Ltd.'s order-checking.
1) primer pair 1 amplification S1 sample, check order after the amplified production connection is converted into competent escherichia coli cell, represents sequence A 11(SEQ ID NO:7):
TCGGCCACGGCCAACTGCGCCAAGATGGTGGAATACGCTCTTCT
AAACGGCTACGACCCGGTTGTTCAGATGCAGATGGGGCCAAAG
ACCGGCGATTCCGCCAAGTTCACGGACTTCGAGCAGCTTTTCGC
CGCGTGGGTGACCCAGATGGAATGGCTGACGAACACCCTGGTG
CGCACGGTGAACCTTGGCCGGTACAAGGACCCGGAATTCTACG
GCAGGCCCTTCCTCTCGGCCACATACGAGCGGGCGGTTGAATCG
GGCCTGGATGCGGTAAGCCCGGTGGGTGATCGCGGCAACTGCT
GGATAACCGGTTTCACATGGGTTGAAAACATAGACAGCCTGGCT
GCGGTTAAAAAGCTTGTTTTCGACGACAAAAAATACACCATGA
GCGAACTTCTGGAAGCCCTTCGCACCAACTGGGACGGCCGCGA
GCAGATGAGGCTCGATTTCGTGAATGCCCCCAAATGGGGCAAC
GACG
2) primer pair 2 amplification S3 samples, check order after the amplified production connection is converted into competent escherichia coli cell, represents sequence A 23(SEQ ID NO:8):
ATGGAACTTGGCCGGGACGCCTGTGAGCTTTCCGAGCAGCCCA
ACGGCTGGCATAATCCGATTACAACCGTTGTGGCGGCCAATTCC
CTGGTGGCTATCAAAAAACTGATTTATGATGATAAAAAGTACAC
CATGGGCCAGCTCATGAATGCCCTGAGGGCAAACTGGGAAGGC
TATGAAGAAATGCAGAAGGACTTTAAAAACGCTCCCAAGTGGG
GCAATGACGATGAATATTGCGACGCAATAATCAAGGCCTTTTATG
AGGATATCATCGGAGGAGAAATGAGCAAGATTACCAACTATTCG
GGAGGTCCGGTGCTTCCGGTGGGACAGGGTGTCGGGCTGTATAT
GGAAGTCGGATCGCGGACCGGCCCGACCCCTGACGGTCGATTC
GGAGGGGAAGCGGCAGATGACGGCGGGATTTCTCCTTATATGGG
TACGGACCATAAAGGGCCGACCGCGGTGCTGAGATCGGTATCA
AACGTGCAGAAAAACCAG
3) primer pair 3 amplification S2 samples, check order after the amplified production connection is converted into competent escherichia coli cell, represents sequence A 32(SEQ ID NO:9):
GAAGGGCGTCATCGCCGGCTTCCAGCGCGCATCAAGCGACCG
CAAGATCGTCGCCGCGGTGTTTACCGGCGTCGGCGACAAGGCC
TTCTGCACCGGTGGCAACACCGCCGAGTACGCCGTCTACTACTC
GCGCCGGCCCAATGAATACGGCGAGTACATGGACCTCTTCAACG
CCATGGTCGACGGCATCCTCAACTGCAAGAAGCCGGTGATCTGC
CGCGTGAACGGCATGCGCGTCGCCGGCGGCCAGGAGATCGGCA
TGGCCACCGACATCACCGTCACCTCCGACCTCGCCGTGC
4) primer pair 3 amplification S3 samples, check order after the amplified production connection is converted into competent escherichia coli cell, represents sequence A 33(SEQ ID NO:10):
CAAAGGCGTGATCCTCGCCTTCCGTGAGGCGAGCGCAGCGCGC
GACGTCGTCGCAGTGGTGTTTACCGGTGCCGGCGACAAGGCCTT
CTGCACCGGCGGAAATACCAAGGAATACGCCGAATATTACGCCG
GCAATCCGCAGGAATATCGCGGCTATATGCGGCTGTTCAACGACA
TGGTGTCAGCCATCCTGGGCTGCGACAAGCCCGTGATCTGCCGG
GTCAACGGCATGCGCATCGGCGGCGGCCAGGAAATCGGCATGG
CCTGCGATTTCACGATCGCGCAGGATCTGGCGCGC
5) primer pair 3 amplification S4 samples, check order after the amplified production connection is converted into competent escherichia coli cell, represents sequence A 34(SEQ ID NO:11):
ATGGAGCTCTTCAACAACATGGTCGACTCCATCCTCACGTGCAA
GAAGCCCGTCATCTGCCGGGTGAACGGCATGAGGGTCGCCGGC
GGGCAGGAAATCGGCCTGGCGTGCGACATCGCTATCGCCTCCG
ACCTCGCCATC
4. sequential analysis
With the database search program blast(based on sequence similarity of gained sequence results in the U.S. state-run biotechnology information center (NCBI) exploitation
Http:// blast.ncbi.com) upper compare of analysis, the information that obtains having in test sample the microorganism of degraded hydrocarbon function under anaerobic condition is as follows:
1) primer pair 1 amplification S1 sample, check order after the amplified production connection is converted into competent escherichia coli cell, represents sequence A 11.Through the sequence alignment analysis, sequence A 11 is in protein level and Desulfatibacillum alkenivorans AK-01 similarity 83%, and this bacterium is the microorganism of alkane of can under anaerobic degrading.This bacterium clone number of S1 sample detection is 23, and always cloning number is that 23(sees Table 1), the microorganism that shows the alkane of under anaerobic degrading in the S1 sample is all such bacterium.
Adopt primer pair 1 amplification S3 sample and S4 sample, amplified production represents that the sequencing result of sequence is with the S1 sample.For the S3 sample, the clone's number that such bacterium detected is 24, and always cloning number is that 26(sees Table 1), in the microorganism of the alkane of under anaerobic degrading in calculating S3 sample, such bacterium relative abundance is 92.3%.For the S4 sample, such bacterium clone number being detected is 28, and always cloning number is that 28(sees Table 1), calculating under anaerobic the degrade microorganism of alkane of S4 sample is all such bacterium.
2) primer pair 2 amplification S3 samples, check order after the amplified production connection is converted into competent escherichia coli cell, represents sequence A 23.Through the sequence alignment analysis, above-mentioned sequence shows in protein level and Desulfobacula toluolica similarity 81% microorganism that has the aromatic hydrocarbon of can under anaerobic degrading in reservoir media.The S3 sample detection, such bacterium clone number is 30, always cloning number is that 30(sees Table 1), show that in the microorganism of the aromatic hydrocarbon of under anaerobic degrading in the S3 sample be all such bacterium.
Adopt primer pair 2 amplification S4 samples, amplified production represents that the sequencing result of sequence is with the S3 sample, such bacterium clone number of S4 sample detection is 25, and always cloning number is that 25(sees Table 1), the microorganism that shows the aromatic hydrocarbon of under anaerobic degrading in the S4 sample is all such bacterium.
3) primer pair 3 amplification S2 samples, check order after the amplified production connection is converted into competent escherichia coli cell, represents sequence A 32.Through the sequence alignment analysis, above-mentioned sequence shows in protein level and Azoarcus toluvorans similarity 87% microorganism that has the aromatic hydrocarbon of can under anaerobic degrading in reservoir media.Such bacterium of S2 sample detection clone number is 14, and always cloning number is that 26(sees Table 1), show that the relative abundance of such bacterium in the microorganism of the aromatic hydrocarbon of under anaerobic degrading in the S2 sample is 53.8%.
4) primer pair 3 amplification S3 samples, check order after the amplified production connection is converted into competent escherichia coli cell, represents sequence A 33.Through the sequence alignment analysis, above-mentioned sequence shows in protein level and Thauera chlorobenzoica similarity 90% microorganism that has the aromatic hydrocarbon of can under anaerobic degrading in reservoir media.Such bacterium clone number of S3 sample detection is 8, and always cloning number is that 21(sees Table 1), in the microorganism of the aromatic hydrocarbon of under anaerobic degrading in calculating S3 sample, the relative abundance of such bacterium is 38.1%.
5) primer pair 3 amplification S4 samples, check order after the amplified production connection is converted into competent escherichia coli cell, represents sequence A 34.Through the sequence alignment analysis, above-mentioned sequence is in protein level and Desulfobacterium aniline DSM4660 similarity 87%, such bacterium clone number of S4 sample detection is 15, total clone's number is that 27(sees Table 1), in the microorganism of the aromatic hydrocarbon of under anaerobic degrading in calculating S4 sample, the relative abundance of such bacterium is 55.6%.
Table 1 anaerobism alkane degradation gene library clone number
(annotate: " ND " expression does not detect)
Claims (3)
1. the method for microorganism that detection has degraded hydrocarbon function under anaerobic condition, is characterized in that comprising the steps:
(1) extract the DNA of sample microorganism;
(2) adopt respectively primer pair 2 shown in primer pair 1, SEQ ID NO:3 and SEQ ID NO:4 shown in SEQ ID NO:1 and SEQ ID NO:2 in sequence table, and the DNA of 3 pairs of sample microorganisms of primer pair shown in SEQ ID NO:5 and SEQ ID NO:6 carries out pcr amplification;
(3) the pcr amplification product connection is converted into competent cell and order-checking;
(4) analytical sequence obtains having in sample the information of the microorganism of degraded hydrocarbon function under anaerobic condition.
2. detection according to claim 1 has the method for microorganism of degraded hydrocarbon function under anaerobic condition, and wherein the reaction composition of the described pcr amplification of step (2) is that sterilized water 12 μ L, 2 * TaqPCR master mix9 μ L, concentration are 12.5 μ molL
-1The forward of primer pair and the DNA2 μ L of each 1 μ L of reverse primer, sample microorganism.
3. detection according to claim 1 has the method for microorganism of degraded hydrocarbon function under anaerobic condition, and wherein the response procedures of the described pcr amplification of step (2) is: a) 94 ° of C insulation 5min; B) 94 ° of C insulation 45s; C) 60 ° of C insulation 1min; D) 72 ° of C insulation 1min; E) repeat b) ~ d) 48 times; F) finish after 72 ° of C insulation 10min.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310022349.0A CN103088134B (en) | 2013-01-22 | 2013-01-22 | Method for detecting microorganism with hydrocarbon degradation function under anaerobic conditions |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310022349.0A CN103088134B (en) | 2013-01-22 | 2013-01-22 | Method for detecting microorganism with hydrocarbon degradation function under anaerobic conditions |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103088134A true CN103088134A (en) | 2013-05-08 |
| CN103088134B CN103088134B (en) | 2014-07-30 |
Family
ID=48201261
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310022349.0A Active CN103088134B (en) | 2013-01-22 | 2013-01-22 | Method for detecting microorganism with hydrocarbon degradation function under anaerobic conditions |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103088134B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101864488A (en) * | 2010-05-30 | 2010-10-20 | 大庆石油管理局 | Method for monitoring advantageous flora in microbial enhanced oil recovery |
-
2013
- 2013-01-22 CN CN201310022349.0A patent/CN103088134B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101864488A (en) * | 2010-05-30 | 2010-10-20 | 大庆石油管理局 | Method for monitoring advantageous flora in microbial enhanced oil recovery |
Non-Patent Citations (3)
| Title |
|---|
| 任随周等: "石油降解菌的分离鉴定及石油污染土壤的细菌多样性", 《生态学报》 * |
| 崔丽虹等: "石油烃降解菌的筛选与鉴定", 《生物技术通报》 * |
| 郝旭光等: "PCR-酶切技术在石油烃降解菌筛选鉴定中的应用", 《环境工程学报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103088134B (en) | 2014-07-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Barnhart et al. | Investigation of coal-associated bacterial and archaeal populations from a diffusive microbial sampler (DMS) | |
| Sivagurunathan et al. | Batch fermentative hydrogen production by enriched mixed culture: combination strategy and their microbial composition | |
| Guo et al. | Methylotrophic methanogenesis governs the biogenic coal bed methane formation in Eastern Ordos Basin, China | |
| Shelton et al. | Environmental drivers of differences in microbial community structure in crude oil reservoirs across a methanogenic gradient | |
| CN103981259A (en) | Analysis method for diversity of microbes and abundance of species in coal seam water | |
| CN101570786B (en) | Method for identifying structure of yeast colony of Daqu starter or fermented grain of distilled spirit by using denaturing gradient electrophoresis | |
| CN102154453A (en) | Microbiological natural gas exploration method based on molecular biological method | |
| Al‐Mailem et al. | Capabilities and limitations of DGGE for the analysis of hydrocarbonoclastic prokaryotic communities directly in environmental samples | |
| CN103882105A (en) | Method for measuring content of saturated hydrocarbon-degrading gene AlkB in petroleum-contaminated soil | |
| Smith et al. | Effect of an algal amendment on the microbial conversion of coal to methane at different sulfate concentrations from the Powder River Basin, USA | |
| CN103088133B (en) | Detection method for sulfate reducing bacteria | |
| CN105018343B (en) | Ortho states microorganism oil gas and the automation sample processing device and Automation workstation of hydrate exploration technology | |
| Perkins et al. | Comparative 16S rRNA gene surveys of granular sludge from three upflow anaerobic bioreactors treating purified terephthalic acid (PTA) wastewater | |
| Fan et al. | Isolation of acetoin-producing Bacillus strains from Japanese traditional food—natto | |
| CN107686849A (en) | A kind of method for promoting oil reservoir petrochina hydrocarbon anaerobic degradation methane phase | |
| CN103088134B (en) | Method for detecting microorganism with hydrocarbon degradation function under anaerobic conditions | |
| CN104975090A (en) | Method for automatically detecting abundance of butane oxidizing bacteria | |
| CN105018609A (en) | Automatic detection method of abundance of methane-oxidizing bacteria | |
| Xiao et al. | Selective enrichment of clostridium spp. by nutrition control from SiHe coal geological microbial communities | |
| Xingbiao et al. | Influences of microbial community structures and diversity changes by nutrients injection in Shengli oilfield, China | |
| Vojtková et al. | Phenotypic characterization of Pseudomonas bacteria isolated from polluted sites of Ostrava, Czech Republic | |
| CN104745709B (en) | A kind of primer and quantitative detecting method for detecting the food new sphingomonas bacteria of resin | |
| CN103966330B (en) | The detection method of a kind of methane phase bubble bacterium | |
| Ellis | Utilizing municipal and industrial wastes for the production of bioproducts: from metagenomics to bioproducts | |
| CN104152576A (en) | Fast quantitative detection method for methanogenic archaea in oil-water well output liquid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |