CN103088110A - Composition, reagent kit and method for oil material detection - Google Patents
Composition, reagent kit and method for oil material detection Download PDFInfo
- Publication number
- CN103088110A CN103088110A CN2011103351970A CN201110335197A CN103088110A CN 103088110 A CN103088110 A CN 103088110A CN 2011103351970 A CN2011103351970 A CN 2011103351970A CN 201110335197 A CN201110335197 A CN 201110335197A CN 103088110 A CN103088110 A CN 103088110A
- Authority
- CN
- China
- Prior art keywords
- pcr
- present
- composition
- oil plant
- test kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a composition for detecting an oil material by using a PCR-suspension chip method, wherein the composition comprises a pair of general primers and 7 probes. The invention further relates to a reagent kit for detecting the oil material by using the PCR-suspension chip method, wherein the kit contains the composition. The present invention further relates to the PCR-suspension chip method for oil material detection, and an application of the PCR-suspension chip method in oil material detection. The PCR-suspension chip method has characteristics of high throughput, high sensitivity, rapidness, high reliability and the like, and provides a new molecular biology method for oil material detection.
Description
Technical field
The invention belongs to biological technical field, particularly, the present invention relates to detect for the PCR-suspension chip method composition and the test kit of oil plant, detect PCR-suspension chip method and the application in detecting oil plant thereof of oil plant.
Background technology
Present global edible oil consumption is mainly take vegetables oil as main, and nearly ten years basic keeps year demand and consume amplification of 5% left and right.China is second-biggest-in-the-world edible oil country of consumption, is also world oil seed production big country.Edible oil is wide in variety, because the difference of oil plant and complete processing is divided into more than 20 kind, mainly comprise the high-grade edible oils such as soybean oil, peanut oil, sunflower seed oil, sesame oil, rapeseed oil, palm wet goods oil with common edible and Camellia oil, sweet oil, Thistle oil, raisin seed oil.Along with the consumers demand of edible vegetable oil becomes more diverse, sectionalization and superior, require government department to strengthen standard and management intensity to edible oil market, to ensure consumer's interests, promote the sound development of edible oil industry.Edible oil standard does not describe some quality index and the detection method that the human consumer extremely is concerned about at present.Wherein, edible oil kind sign verity problem is particularly outstanding in high-end edible oil.
Vegetalitas oil plant crop varieties is various, and processing intensity is large and step is many, and quality problems are intricate, has determined that the edible oil detection has larger technical difficulty.At present, molecular Biological Detection means (for example, regular-PCR method, Multiplex PCR, multiple real time fluorescence PCR method and chip detecting method etc.) have in the detection of edible oil materials comparatively widely to be used, but remains in certain defective.Regular-PCR method commonly used is once tested and can only be detected a kind of composition, and easily produces false negative and crossed contamination phenomenon.Multiplex PCR is once tested the composition that detects usually less than five kinds, and because needs mix primer many, the phase mutual interference easily occurs, the impact judgement.Multiple real time fluorescence PCR is subject to the restriction of amount of fluorescence, exists between fluorescence and disturbs.Chip detecting method need to all design its special primer to every kind of target component, operates more loaded down with trivial details.Traditional probe hybridization technology is because of needs washing step repeatedly, and analytical results is affected by background easily, and because the optical signalling to elements collection detects, does not add up, and the reliability of result is low.
Therefore, seek the study hotspot that easy, accurate, efficient, reliable molecular biology for detection becomes this field.
PCR-suspending chip technology is the emerging a kind of detection technique of technical field of molecular biology, this technology is that PCR and suspension chip system are combined with, at first the target gene in sample is carried out pcr amplification, then have the target-gene sequence of microballoon in sample of probe to be combined coupling by solution hybridization, the integration by Flow Cytometry and enzyme marking detecting technology detects simultaneously to the plurality of target composition in sample.Wherein, the core technology of suspension chip system is " multi-functional many indexs Synchronization Analysis system " (Flexible Multiple Analyte Profiling, be called for short xMap) technology, it uses the 5.5um macromolecular material microballoon of 100 kinds of special different colour code codings.a kind of probe that can catch the respective objects molecule of the microballoon mark of each coding, choose microballoon several or that 100 kinds of marks of as many as are good wantonly and mix target molecule effect to be detected in rear and sample, then under driving, liquid stream passes through one by one a fine silica tube, two bundle different wave length laser detect each microballoon, which kind of molecule what thereby the colour code coding of beam of laser detection microballoon was distinguished the microballoon kind also and then determined detection is, another bundle laser detection is carried out quantitatively with fluorescent mark on target molecule that probe is combined, by Computer Analysis and typical curve match, directly provide the molecular weight of each target molecule.
PCR-suspending chip technology has following particular advantages:
(1), high-throughput, the microballoon for the suspending chip utilization has 100 kinds at present, can carry out qualitative and quantitative analysis for the multiple different target molecule in same sample simultaneously.
(2), good reproducibility, the different sorts microballoon mixes after mark respectively, then is distributed into aliquot, is used for detecting each sample respectively, the character of each aliquot is in full accord.
(3), highly sensitive, suspension chip system uses microballoon as reaction carriers, increased the reactant contact area, each microsphere surface is with 100 kinds of different colour codes, and with covalent linkage coupling oligonucleotide probe, probe density is high, the signal that produces is strong, use fluoroscopic examination, amplified reaction signal, sensitivity improves greatly.
(4), fast, can complete the detection to the PCR product in 1 hour.
(5), reliability is high, present technique is carried out statistical study with supporting software after a plurality of microballoon fluorescent signals are detected separately, makes detected result more accurately and reliably.
At present, there is no the report that uses PCR-suspending chip technology for detection oil plant.
Summary of the invention
One object of the present invention is, is provided for the composition that the PCR-suspension chip method detects oil plant.
Another object of the present invention is, is provided for the test kit that the PCR-suspension chip method detects oil plant.
A further object of the present invention is, is provided for detecting the PCR-suspension chip method of oil plant.
A further object of the present invention is, the application of PCR-suspension chip method in detecting oil plant is provided.
For the foregoing invention purpose, the invention provides following technical scheme:
The present inventor has designed universal primer and specific oligonucleotide probe for detection of oil plant for the Chloroplast rbcL Gene of vegetalitas oil plant crop.
On the one hand, the invention provides a kind of composition that detects oil plant for the PCR-suspension chip method, described composition comprise 1 pair of universal primer to 7 probes, described universal primer is comprised of upstream primer and downstream primer, the nucleotides sequence of described upstream primer is classified as shown in SEQ ID No.1, the nucleotides sequence of described downstream primer is classified as shown in SEQ ID No.2, the nucleotides sequence of described probe is classified as shown in SEQ ID No.3-9, wherein, 5 ' end of described downstream primer is marked with vitamin H, and 5 ' end of described probe is connected with 20 T bases that use is amido modified.
Particularly, the nucleotide sequence of above-mentioned primer and probe is respectively:
SEQ ID No.1 (upstream primer): 5 ' TTGGCAGCATTCCGAGTAAC 3 ';
SEQ ID No.2 (downstream primer): 5 ' AGTAAACATGTTAGTAACAG 3 ';
SEQ ID No.3 (olive probe): 5 ' CCATATTGAGCCCGTTCCTG 3 ';
SEQ ID No.4 (peanut probe): 5 ' CCGGTTGCTGGCGAAGAAAA 3 ';
SEQ ID No.5 (vegetable seed probe): 5 ' CCAGGAGAAGAAACTCAATT 3 ';
SEQ ID No.6 (sesame probe): 5 ' CCGGTTCCTGGAGAAACAGA 3 ';
SEQ ID No.7 (soybean probe): 5 ' CCTGTTGCTGGGGAAGAAAA 3 ';
SEQ ID No.8 (sunflower seeds probe): 5 ' TGGACTTGAGCCTGTTCCTG 3 ';
SEQ ID No.9 (corn probe): 5 ' CCCGTTCCTGGGGACCCAGA 3 '.
On the other hand, the invention provides a kind of test kit that detects oil plant for the PCR-suspension chip method, wherein, described test kit comprises composition of the present invention.
According to test kit of the present invention, wherein, described test kit also comprises working instructions, and the pcr amplification condition that provides in described specification sheets is: 95 ℃ of denaturation 10min; 95 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, totally 35 circulations; 72 ℃ are extended 5min; 4 ℃ of preservations; The hybridization conditions that described specification sheets provides is 95 ℃ of sex change 5min, 60 ℃ of hybridization 15min.
According to test kit of the present invention, wherein, described test kit also comprises as the DNA of the target oil plant of standard substance with as the aseptic double-distilled water of negative control.
According to test kit of the present invention, wherein, described test kit also comprises the reagent that extracts for sample DNA and the reagent that is used for pcr amplification reaction.
On the one hand, the invention provides a kind of PCR-suspension chip method that detects oil plant again, wherein, described method comprises uses composition of the present invention or test kit.
According to method of the present invention, wherein, described method also comprises the step of using primer of the present invention to carry out pcr amplification and use probe of the present invention to hybridize.
According to method of the present invention, wherein, described pcr amplification condition is: 95 ℃ of denaturation 10min; 95 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, totally 35 circulations; 72 ℃ are extended 5min; 4 ℃ of preservations.
According to method of the present invention, wherein, described hybridization conditions is: 95 ℃ of sex change 5min, 60 ℃ of hybridization 15min.
According to method of the present invention, it specifically comprises the steps:
(1), extract the DNA profiling of detected sample;
(2), carry out biotin labeling for downstream primer 5 ' end of the present invention;
(3), use the downstream primer that is marked with vitamin H that upstream primer of the present invention and described step (2) obtain to carry out pcr amplification for the DNA profiling that described step (1) obtains;
(4), 5 ' end for probe of the present invention connects 20 T bases that use is amido modified;
(5), the probe and the microballoon that described step (4) are obtained carry out coupling;
(6), the pcr amplification product that the probe that is coupled to microballoon that described step (5) is obtained and described step (3) obtain is hybridized;
(7), employing xMap technology is carried out qualitative and quantitative for the DNA of target component.
According to aforesaid method, wherein, the coupling of described step (5) middle probe and microballoon is undertaken by following operation: resuspended microballoon on the vortex instrument, get 50 μ L (6.25 * 10
5Individual) microballoon is in the 1.5mL centrifuge tube, and the centrifugal 2min of 10000 * g abandons supernatant, and with the 50 resuspended microballoons of μ L 0.1M MES damping fluid (pH4.5), thoroughly vortex disperses microballoon, adds the 0.05nmol probe.Add the EDC solution (10mg/mL) of the fresh preparation of 2.5uL to microballoon, abundant mixing, the room temperature lucifuge is hatched 30min, then repeats once this step operation.Respectively wash (the centrifugal 1min of 15000 * g) once with 1mL 0.02%Tween-20 and 1mL 0.1%SDS respectively, use at last the 75 resuspended microballoons of μ L TE damping fluid, 4 ℃ keep in Dark Place.
Also on the one hand, the invention provides the application of PCR-suspension chip method in detecting oil plant.
Preferably, according to application of the present invention, composition of the present invention or test kit have wherein been used.
Preferably, according to application of the present invention, wherein, described oil plant is olive, peanut, vegetable seed, sesame, soybean, sunflower seeds and corn.
PCR-suspending chip technology of the present invention is for Chloroplast rbcL Gene fragment 1 pair of universal primer of design and 7 oligonucleotide probes, by pcr amplification target dna fragment, then coupling there are the microballoon of 7 oligonucleotide probes and amplified production to hybridize, detect with suspension chip system, 7 kinds of different oil plant compositions that can comprise in to sample in experiment once carry out rapid detection.The PCR-suspending chip technology that the present invention sets up is except having high-throughput, good reproducibility, highly sensitive, quick and high reliability, due to only with 1 pair of universal primer, help other the unknown vegetalitas oil plant compositions in test sample, can come further broaden application scope by designing more probe at an easy rate.
Description of drawings
Fig. 1 uses the universal primer of the present invention's design to the agarose gel electrophoresis figure of the pcr amplification product of each sample DNA profiling.M is molecular weight standard, and 1-19 is respectively the pcr amplification product of following oil plant: 1: corn; 2: Semen Brassicae campestris; 3: soybean; 4: Fructus oleae europaeae; 5: peanut; 6: oily sunflower seeds; 7: sesame; 8: common sunflower seeds; 9: cottonseed; 10: pine nut; 11: cashew nut; 12: wheat; 13: rice; 14: mustard; 15: celery; 16; Camellia; 17: pig; 18: sheep; 19: blank.
Embodiment
The present invention is further illustrated below by the mode of embodiment, but the present invention is not limited only to following examples.
Term used in the present invention " oil plant " refers to that grease makes the vegetable raw material that uses in industry.
PCR-suspending chip technology of the present invention has designed 1 pair of universal primer and 7 specific oligonucleotide probes for Chloroplast rbcL Gene.This technology can be identified following seven kinds of edible oil materials: olive, peanut, vegetable seed, sesame, soybean, sunflower seeds and corn.
It will be recognized by those skilled in the art that PCR-suspending chip technology of the present invention is not limited only to detect the oil plant composition in edible oil, relate in the field (biological example diesel oil) of appliable plant oil plant for all and all can use.
Laboratory apparatus and reagent
Main detecting instrument used in the present invention is as follows:
Micropipet (10 μ L, 100 μ L, 1000 μ L, Eppendorf, Germany), PCR instrument (Eppendorf, Germany), high speed tabletop centrifuge (Pico17 type, Thermo, Germany), high speed disintegrator (IKA-WEARKE, Germany), suspension chip system (2100 types, Biorad, the U.S.).
Main detection reagent used in the present invention is as follows:
Chloroform, Virahol are purchased from respectively Beijing six directions and lead to company; The DNA extraction test kit
Available from U.S. Promega; Taqman polysaccharase reagent Hotstar is available from German Qiagen; The designed universal primer of the present invention is to (comprising the downstream primer shown in the upstream primer shown in SEQ ID No.1 and SEQ ID No.2, wherein downstream primer is marked with vitamin H) and 7 oligonucleotide probes (its nucleotides sequence is shown in SEQ ID No.3-SEQ ID No.9, and 5 ' end of these probes is connected with 20 T bases that use is amido modified) synthetic by the handsome bio tech ltd in Beijing.
Embodiment
The present embodiment is verified specificity, sensitivity, repeatability and the actual effect that detects of PCR-suspending chip technology of the present invention by following test.
Detecting step is as follows:
1, sample DNA template extraction:
(1) carry out DNA profiling for target detect oil plant leaf of Fructus oleae europaeae, soybean, corn, peanut, sesame, vegetable seed, common sunflower seeds and oily sunflower seeds respectively and extract, carry out DNA profiling for other object of reference cottonseeds, pine nut, cashew nut, wheat, rice, mustard, celery, camellia, sheep, pig and blank (sterilized water) simultaneously and extract.Particularly, get each sample of 200mg, clay into power with high speed disintegrator, adopt the DNA extraction test kit to extract DNA with reference to the specification sheets of manufacturers.
(2) the oil plant DNA profiling stoste with said extracted is diluted to respectively 10ng/ μ l, 1ng/ μ l, 0.1ng/ μ l, 10pg/ul, 1pg/ul, 0.1pg/ul and 0.01pg/ul with sterilized water respectively, is used for analyzing the absolute sensitivity of PCR-suspending chip technology of the present invention.
(3) oil plant (Fructus oleae europaeae, corn, oily sunflower seeds, soybean, corn, soybean, sesame and peanut) the DNA profiling stoste with said extracted is diluted to 10ng/ μ l with sterilized water respectively, and Fructus oleae europaeae and corn, oily sunflower seeds and soybean, corn and soybean, sesame and peanut DNA profiling are carried out proportioning according to certain volume ratio respectively prepare respective mixtures (wherein, the DNA profiling mixture of Fructus oleae europaeae and corn is respectively 100%, 90%, 70%, 50%, 30% and 0% for the volume ratio by Fructus oleae europaeae; The DNA profiling mixture of oil sunflower seeds and soybean is respectively 100%, 90%, 70%, 50%, 30% and 0% for the volume ratio by oily sunflower seeds; The DNA profiling mixture of corn and soybean is respectively 100%, 90%, 70%, 50%, 30% and 0% for the volume ratio by corn; The DNA profiling mixture of sesame and peanut is respectively 100%, 90%, 70%, 50%, 30% and 0% for the volume ratio by sesame), for the relative sensitivity of analyzing PCR-suspending chip technology of the present invention.
(4) oil plant (Fructus oleae europaeae, corn, oily sunflower seeds, soybean, corn, soybean, sesame and peanut) the DNA profiling stoste with said extracted is diluted to 10ng/ μ l with sterilized water respectively, and get respectively three parts and carry out repeated experiments, with the stability of checking PCR-suspending chip technology of the present invention.
(5) the 7 parts of edible oil standard samples (being respectively sunflower seed oil, peanut oil, sweet oil, soybean oil, sesame oil, rapeseed oil, Semen Maydis oil) for this laboratory preparation use respectively the DNA extraction test kit to extract DNA profiling, are used for analyzing the actual detection effect of PCR-suspending chip technology of the present invention.
2, pcr amplification:
(1), pcr amplification system: cumulative volume is 25ul, wherein comprises: 1 * Multi HotStart Buffer (does not contain Mg
2+), 1.5mM MgCl
2, 200nM dNTP mixture, each 200nM of upstream and downstream primer (wherein downstream primer 5 ' end biotin labeling), 1U Multi HotStart archaeal dna polymerase, the DNA profiling of 50ng is supplied volume to 25ul with the distilled water of sterilization.
(2), pcr amplification parameter: 95 ℃ of denaturation 10min; 95 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, totally 35 circulations; 72 ℃ are extended 5min; 4 ℃ of preservations.
3, pcr amplification product analysis:
The agarose gel electrophoresis of pcr amplification product use 2% detects.
Probe and the microballoon that 4, will be connected with the amido modified T base of 20 use carry out coupling, and concrete operations are following to be carried out: resuspended microballoon on the vortex instrument, get 50 μ L (6.25 * 10
5Individual) microballoon is in the 1.5mL centrifuge tube, and the centrifugal 2min of 10000 * g abandons supernatant, and with the 50 resuspended microballoons of μ L 0.1M MES damping fluid (pH4.5), thoroughly vortex disperses microballoon, adds the 0.05nmol probe.Add the EDC solution (10mg/mL) of the fresh preparation of 2.5uL to microballoon, abundant mixing, the room temperature lucifuge is hatched 30min, then repeats once this step operation.Respectively wash (the centrifugal 1min of 15000 * g) once with 1mL 0.02%Tween-20 and 1mL 0.1%SDS respectively, use at last the 75 resuspended microballoons of μ L TE damping fluid, 4 ℃ keep in Dark Place.
5, be coupled to the probe of microballoon and the pcr amplification product of above-mentioned acquisition is hybridized for above-mentioned, the hybridization condition is: 95 ℃ of sex change 5min, 60 ℃ of hybridization 15min.
6, adopt the xMap technology to carry out qualitative and quantitative for the DNA of target component: will hybridize product and forward in aseptic suction filtration plate, and drain, and record simultaneously hybridization system corresponding aperture position.SA-PE is diluted to 4ng/ul with 1 * TE, and every hole adds 50ul, the first concussion of 1100rpm lucifuge 2min, then 450rpm incubated at room 5min; Drain the suction filtration plate, then wash three times with 100ul TE, carry out resuspended with 100ul TE at last.The suction filtration plate is inserted instrument carry out reading.
Experimental result is shown in table 1-5 and Fig. 1.
As shown in Figure 1, Fructus oleae europaeae, soybean, corn, peanut, sesame, vegetable seed, 7 kinds of oil plants of sunflower seeds (common sunflower seeds and oily sunflower seeds) all obtain and the product of expecting fragment length identical (246bp) by increasing.In addition, cottonseed, pine nut, cashew nut, wheat, rice, mustard, celery, camellia sample also increase and obtain the purpose fragment.And sheep, pig, blank all amplification to the product of 246bp.
PCR-suspending chip technology of the present invention the results are shown in following table 1 for the specificity that 7 kinds of oil plants detect.
Table 1: the specificity result that PCR-suspending chip technology of the present invention detects for 7 kinds of oil plants
A:MFI-Bkgd represents that the fluorescent value MFI of sample deducts the fluorescent value of background
Adopt the suspending chip technology, with mixture of microspheres, 19 samples (leaf of Fructus oleae europaeae, soybean, corn, peanut, sesame, vegetable seed, common sunflower seeds, oily sunflower seeds, cottonseed, pine nut, cashew nut, wheat, rice, mustard, celery, camellia, sheep, pig and blank) are detected after 7 probes are coupled to microballoon.As shown in table 1,7 kinds of oil plant compositions all produce stronger fluorescent signal, and Fructus oleae europaeae, soybean, corn, peanut, sunflower seeds, vegetable seed, sesame are respectively 813,1095,1091,2301,2894.5 and 1818 (oily sunflower seeds and common sunflower seedss), 1573,1323.Corresponding blank signal is respectively 8,10,6,5,9,10,10.Corresponding negative sample highest signal value is respectively 102 (corns), 65 (corns), 10 (vegetable seed), 17 (cashew nuts), 50 (wheats), 50 (mustard), 7 (vegetable seed).The criterion that it should be noted that positive signal in testing process should be avoided false positive, namely will get rid of negative sample fully, again can not standard configuration is too high and affect detection sensitivity.The present invention sets up respectively as lower threshold value each probe: 1) peanut: higher than 4 times of blank signals; 2) vegetable seed: higher than 8 times of blank signals; 3) sesame: higher than 2 times of blank signals; 4) corn: higher than 3 times of blank signals; 5) sunflower seeds: higher than 8 times of blank signals; 6) soybean: higher than 2 times of blank signals and higher than 2 times of maize dna signals; 7) olive: higher than 10 times of blank signals and higher than 2 times of maize dna signals.According to above-mentioned criterion, present method has good specificity to 7 kinds of target oil plant compositions.
Those skilled in the art should be appreciated that setting up of described threshold value is based on following consideration: 1) at present not have the unified mathematic(al) mode of fixing can reference aspect the threshold set-up of the detection method that relates to nucleic acid hybridization; 2) mainly judgement empirical according to the experimenter of the method for bibliographical information, setting threshold under the prerequisite that considers method specificity and sensitivity; 3) present, in the bibliographical information about suspension chip method, 2 times of the blank value is comparatively common establishing method, but these reports are mostly for every kind of Composition Design Auele Specific Primer, and present method adopts universal primer that large-scale oil plant composition is increased, and needs suitably to improve threshold value; 4) experimental result, the assurance threshold value is taken into account simultaneously sensitivity and is reached the detection demand greater than the maximum of negative sample; 5) in actual applications, along with the increase of negative sample kind, can suitably adjust threshold value according to whether false positive occurring.
PCR-suspending chip technology of the present invention the results are shown in following table 2 for the absolute sensitivity that 7 kinds of oil plants detect, and positive signal criterion is with above described.
Table 2: the absolute sensitivity detected result of PCR-suspending chip technology of the present invention to 7 kinds of oil plants
As shown in table 2, according to criterion mentioned above, except Fructus oleae europaeae, the detection sensitivity of all the other oil plants all reaches 1pg/ μ l, and the Fructus oleae europaeae detection sensitivity is 10pg/ μ l, confirms that the sensitivity of the method is fine.
PCR-suspending chip technology of the present invention the results are shown in following table 3 for the relative sensitivity that 7 kinds of oil plants detect, and positive signal criterion is with above described.
Table 3: PCR-suspending chip technology of the present invention is to mixing the relative sensitivity detected result of oil plant
As shown in table 3, each oil plant composition that mixes in oil plant all detects positive signal at minimum proportional limit (30%), confirms that the sensitivity of PCR-suspension chip method of the present invention is fine, can detect for heterogeneity in different fuel mixtures.
The experimental result of verifying the stability of PCR-suspending chip technology of the present invention is shown in following table 4.
Table 4: 3 repeated experiments results that PCR-suspending chip technology of the present invention detects for 7 kinds of oil plants
As shown in table 4, use PCR-suspending chip technology of the present invention to detect for 7 kinds of oil plants and carried out repeated experiments 3 times, found that the variation lines number average lower than 10%, reach the common variation coefficient requirement of present suspending chip method, show that PCR-suspension chip method of the present invention has satisfactory stability.
PCR-suspending chip technology of the present invention is shown in following table 5 for the actual detection effect of 7 parts of edible oil standard samples in this laboratory.
Table 5: PCR-suspending chip technology of the present invention is for the detected result of 7 parts of edible oil standard samples
As shown in table 5, adopt PCR-suspending chip technology of the present invention that 7 parts of edible oil standard samples of this laboratory preparation are detected, all samples all detects corresponding oil plant composition, and other compositions do not detected, show that PCR-suspending chip method of the present invention is respond well for the detection of oil plant.
Although the specific embodiment of the present invention is described, those skilled in the art will appreciate that under the prerequisite that does not depart from scope of the present invention or spirit and can carry out multiple change and modification to the present invention.Thereby, this invention is intended to contain all these changes and modification of dropping in claims and coordinator scope thereof.
Claims (10)
1. one kind is used for the composition that the PCR-suspension chip method detects oil plant, it is characterized in that, described composition comprises 1 pair of universal primer and 7 probes, described universal primer is comprised of upstream primer and downstream primer, the nucleotides sequence of described upstream primer is classified as shown in SEQ ID No.1, the nucleotides sequence of described downstream primer is classified as shown in SEQ ID No.2, the nucleotides sequence of described probe is classified as shown in SEQ ID No.3-9, wherein, 5 ' end of described downstream primer is marked with vitamin H, and 5 ' end of described probe is connected with 20 T bases that use is amido modified.
2. one kind is used for the test kit that the PCR-suspension chip method detects oil plant, it is characterized in that, described test kit comprises composition claimed in claim 1.
3. test kit according to claim 2, is characterized in that, described test kit also comprises working instructions, and the pcr amplification condition that provides in described specification sheets is: 95 ℃ of denaturation 10min; 95 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, totally 35 circulations; 72 ℃ are extended 5min; 4 ℃ of preservations; The hybridization conditions that described specification sheets provides is: 95 ℃ of sex change 5min, 60 ℃ of hybridization 15min.
4. a PCR-suspension chip method that detects oil plant, is characterized in that, described method comprises that right to use requires 1 described composition or the described test kit of claim 2 or 3.
5. method according to claim 4, is characterized in that, described method comprises that also right to use requires 1 described primer to carry out the step that pcr amplification and right to use require 1 described probe to hybridize.
6. method according to claim 5, is characterized in that, described pcr amplification condition is: 95 ℃ of denaturation 10min; 95 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, totally 35 circulations; 72 ℃ are extended 5min; 4 ℃ of preservations.
7. method according to claim 5, is characterized in that, described hybridization conditions is: 95 ℃ of sex change 5min, 60 ℃ of hybridization 15min.
8.PCR-the application of suspension chip method in detecting oil plant.
9. application according to claim 8, is characterized in that, wherein used composition claimed in claim 1 or the described test kit of claim 2 or 3.
10. application according to claim 9, is characterized in that, described oil plant is olive, peanut, vegetable seed, sesame, soybean, sunflower seeds and corn.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110335197.0A CN103088110B (en) | 2011-10-28 | 2011-10-28 | Composition, reagent kit and method for oil material detection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110335197.0A CN103088110B (en) | 2011-10-28 | 2011-10-28 | Composition, reagent kit and method for oil material detection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103088110A true CN103088110A (en) | 2013-05-08 |
| CN103088110B CN103088110B (en) | 2015-04-29 |
Family
ID=48201236
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110335197.0A Expired - Fee Related CN103088110B (en) | 2011-10-28 | 2011-10-28 | Composition, reagent kit and method for oil material detection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103088110B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108103156A (en) * | 2018-02-08 | 2018-06-01 | 苏州百源基因技术有限公司 | For detecting the specific primer of sunflower DNA and probe and real-time fluorescence quantitative PCR kit |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1858249A (en) * | 2006-03-21 | 2006-11-08 | 中国科学院武汉病毒研究所 | Method for detecting bird flue virus H5N1 subtype based on liquid phase chip |
-
2011
- 2011-10-28 CN CN201110335197.0A patent/CN103088110B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1858249A (en) * | 2006-03-21 | 2006-11-08 | 中国科学院武汉病毒研究所 | Method for detecting bird flue virus H5N1 subtype based on liquid phase chip |
Non-Patent Citations (5)
| Title |
|---|
| LI Y，ET AL: "Species-Specific Identifivation of Seven Vegetable Oils Based on Suspension Bead Array", 《J AGRIC FOOD CHEM》, vol. 60, no. 9, 22 February 2012 (2012-02-22), pages 2362 - 2367 * |
| YAJUN WU，ET AL: "PCR-CE-SSCP applied to detect cheap oil blended in olive oil", 《EUR FOOD RES TECHNOL》, no. 233, 17 June 2011 (2011-06-17), pages 313 - 324, XP019928825, DOI: doi:10.1007/s00217-011-1520-y * |
| ZHANG L，ET AL: "The Gene MT3-B can differentiate palm oil from other Oil Samples", 《J. AGRIC. FOOD CHEM.》, vol. 16, 31 December 2009 (2009-12-31), pages 7227 - 7232 * |
| 文海燕等: "基于通用引物PCR以及多重PCR方法的五种生物恐怖细菌悬浮芯片检测模型的建立以及初步评价", 《自主创新与持续增长第十一届中国科协年会》, 31 December 2009 (2009-12-31), pages 2415 - 2426 * |
| 罗渊等: "5种虫媒病毒悬浮芯片检测方法的建立", 《解放军医学杂志》, vol. 33, no. 6, 30 June 2008 (2008-06-30), pages 708 - 711 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108103156A (en) * | 2018-02-08 | 2018-06-01 | 苏州百源基因技术有限公司 | For detecting the specific primer of sunflower DNA and probe and real-time fluorescence quantitative PCR kit |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103088110B (en) | 2015-04-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103397101B (en) | A kind of fluorescent marker gene composite amplification method simultaneously identifying goat, sheep, pig and duck source property | |
| CN112094948B (en) | Application of target gene combination in African swine fever virus detection and kit | |
| He et al. | Development and optimization of an efficient method to detect the authenticity of edible oils | |
| CN102559868B (en) | Method for qualitative and quantitative detection of multiple target nucleotide sequences with single tube | |
| CN101392302B (en) | Flu/human avian influenza virus detection gene chip and production method and use | |
| CN102605106B (en) | Triple-fluorescence PCR (Polymerase Chain Reaction) detection method and kit for Nosema bombycis (Nb), Bombyx mori Nuclear Polyhedrosis Virus (BmNPV) and Bombyx mori Densovirus (BmDNV), as well as primers and probes | |
| CN107385071A (en) | Molecular labeling primer and application for Kiwi berry mill mountain system row Male cultivar identification | |
| CN103911447B (en) | Detect plasmodial primer, probe and method | |
| Wu et al. | PCR-CE-SSCP applied to detect cheap oil blended in olive oil | |
| Zhang et al. | PCR-CE-SSCP used to authenticate edible oils | |
| CN107287291A (en) | A kind of double labelling nucleic acid detection method interacted based on g C3N4 and CdTe/CdS quantum dots | |
| CN113718063A (en) | Multi-chip digital PCR primer, kit and detection method for simultaneously detecting ASFV, PCV2 and PRV viruses | |
| CN201280550Y (en) | Micro-pore panel apparatus for high flux gene detection and parting | |
| CN107338318A (en) | Molecular labeling Geo101 primers and application for Kiwi berry mill mountain system row Male cultivar identification | |
| CN103911441A (en) | Genetic analysis method based on capillary electrophoresis and SSR fluorescence labeling for rice | |
| CN114457180B (en) | MNP core primer combination for molecular identification of kiwi variety and application thereof | |
| CN109385488B (en) | Multiplex PCR (polymerase chain reaction) primer, method and kit for simultaneously detecting three kinds of toxigenic fungi polluted by traditional Chinese medicinal materials | |
| CN112852988A (en) | Microdroplet digital PCR detection method for simultaneously detecting penicillium and fusarium | |
| CN103088110B (en) | Composition, reagent kit and method for oil material detection | |
| CN102559919B (en) | Real-time PCR (Polymerase Chain Reaction) detection method of buffalo components in food and feed | |
| CN105349705A (en) | Aquatic product common virus detection kit | |
| CN111394497B (en) | Specific primer, probe, kit and method for detecting barley components | |
| CN103589797A (en) | SNP (single nucleotide polymorphism) genotyping method and application thereof | |
| CN103290118B (en) | Real-time fluorescent PCR (polymerase chain reaction) detection kit for non-deletion type alpha thalassemia | |
| CN112877460A (en) | Transgenic component high-throughput screening method, detection kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150429 Termination date: 20181028 |