CN103060366A

CN103060366A - Human blood coagulation factor IX mutant pichia pastoris expression vector and construction method and application thereof

Info

Publication number: CN103060366A
Application number: CN2012105699653A
Authority: CN
Inventors: 张同存; 周俊; 戴永刚; 王震宇; 吴尘宇; 成采莲; 唐文心
Original assignee: Wuhan University of Science and Engineering WUSE
Current assignee: Wuhan University of Science and Engineering WUSE
Priority date: 2012-12-25
Filing date: 2012-12-25
Publication date: 2013-04-24

Abstract

The invention discloses a human blood coagulation factor IX mutant pichia pastoris expression vector and a construction method and application thereof. The procedures of the construction method of the human blood coagulation factor IX mutant pichia pastoris expression vector includes that according to a hFIX gene sequence, the reverse transcription-polymerase chain reaction (RT-PCR) technology is used for cloning hFIX overall length complementary deoxyribonucleic acid (cDNA) from human hepatic cells, signal peptide mixed with yeast Alpha -factor and yeast expression plasmids pPIC9K-hFIX are constructed to express pichia pastoris, and then based on that the yeast expression plasmids pPICZ Alpha A-hFIX are constructed, four saccharomycetes hFIX high-activity mutants are constructed. Cruor activity of the achieved hFIX yeast expression vector is apparently higher than that of standard hFIX. One of the mutants is through 50-litre pilot scale test of fermentation, protein purification product secretory expression quantity is 702 milligrams/litre, so that a good foundation is laid for producing efficient hFIX products used for treating hemophilia B in a low cost and industrialized mode.

Description

HumanclottingfactorⅨ's mutant yeast expression vector and construction process and application

Technical field

The invention belongs to biology field.Be specifically related to humanclottingfactorⅨ's (hF IX) mutant yeast expression vector, the construction process that also relates to simultaneously humanclottingfactorⅨ's (hF IX) mutant yeast expression vector also relates to the application of humanclottingfactorⅨ's (hF IX) mutant yeast expression vector in producing hF IX albumen.

Background technology

The plasma thromboplastin component progress:

Plasma thromboplastin component is important short Rh factor in the blood coagulation " waterfall reaction ".It is mainly synthetic by hepatic parenchymal cells, is secreted in the peripheral blood with the form of proenzyme.After various internal and external factors activated the intrinsic coagulation reaction, plasma thromboplastin component was activated, and a series of coagulation cascade reaction occurs, and finally formed clot, thrombus, thereby reached the purpose of hemostasis.The intrinsic coagulation approach is started by the activation of factor XII in the reaction of blood coagulation waterfall.Work as vascular injury, when collegen filament exposed under the inner membrance, can activate XII was XII a, and then the activation XI is XI a.XI a activates the hF IX of IX a(activation when Ca2+ exists), IX a forms the further incitant X of mixture with the VIII a, the PF3 that activate, Ca2+ again.Xa and factor V, Ca2+ and PF3(thrombocyte the 3rd factor are the phosphatide on the platelet membrane) jointly form Prothrombin Complex Concent-, finally start zymoplasm and fibrinous formation.When some instructs the synthetic gene of plasma thromboplastin component that various sudden change occurs, plasma thromboplastin component can not normally synthesize, or resultant quantity reduces, or active decline, the capital is so that endogenic blood coagulation reaction is subject to impact in various degree, thereby cause active partial thromboplastin time (Activated Partial Thrombopla stin Time, APTT) time lengthening, cause a series of dysfunction of blood coagulation.This disease is exactly human haemophilia B (Hemophilia B).

Human haemophilia B claims again plasma thromboplastin component deficiency disease (Factor IX Defciency), the multimodal disease of Chris (Chris tmas Disease).It is one group owing to lack the caused sex-linked recessive hereditary disease of plasma thromboplastin component, X chromosome recessive inheritance, thereby be common in the male sex.The generation that causes haemophilia B mainly is unusual because instruct the gene of synthetic plasma thromboplastin component that insertion, inversion, disappearance and point mutation etc. have occured, and directly consequence is exactly that the plasma thromboplastin component amount of synthesizing reduces or activity decreased, and perhaps both have both.According to the plasma thromboplastin component activity be equivalent to standard activity per-cent (the hF IX: C), can be divided into light, heavy hemophilia neutralizes.

Treat clinically the method for heavy haemophilia B common be exactly plasma thromboplastin component input alternative medicine and gene therapy, side effect is large because gene therapy exists, the shortcoming of poor effect, in clinical application, still belong to experimental stage, replenish alternative medicine so methods for the treatment of commonly used mainly is thrombin.Clinical practice proves, replenishes the thrombin that lacks and be the hemorrhage effective measures of control hemophilia.The principle of alternative medicine is according to the transformation period of hF IX, stability, and hemorrhage severity, operation size and scope, selects targetedly suitable blood products, dosage and medication.Alternative medicine comprises the hF IX medicine (such as the Benef IX) that input fresh plasma (potassium hydroxide), cryoprecipitate Prothrombin Complex Concent-(containing factor IX, X, II, VII) and genetically engineered are produced etc.But the security of the thrombin that blood plasma and blood plasma are purified has been subject to very large query, and input is easy to infected by HIV, HBV, HCV and syphilis etc. repeatedly, has to report hemophilia people's various infection because blood transfusion causes of about 5%.Well select so the application recombinant blood coagulation factor is one, it has avoided the hidden danger that infects, but its fancy price and domestic restructuring hF IX Drug shortage are so that patient is very inconvenient in medication.

The encoding gene of hF IX is positioned at the long-armed end of X chromosome, and size is about 10kb, and the mRNA size of transcribing is about 2500bp.The hF IX is mainly synthetic by the liver parenchyma, and the synthetic hF IX of cell is comprised of 461 amino-acid residues, and free hF IX is comprised of 415 amino-acid residues of band signal peptide fragment not in the blood.The hF IX is strand glycoprotein, contain have an appointment 17% glycosylation modified, molecular size is not all 55-75kD according to degree of glycosylation.When intrinsic coagulation occured, it is converted into the hF IX of activation, and (the hF IX a).HF IX a is comprised of a light chain and a heavy chain, has serine protease.The normal concentration of plasma thromboplastin component is 3-5mg/L in the blood.

From existing data, the sudden change of the hF IX of most of report all can cause the reduction of its activity, thereby suffers from haemophilia B.Point mutation also is one of pathomechanism on the haemophilia B genetics.But, also have some amino acid whose change of report can strengthen its blood coagulation activity.When for example the 86th amino acid V (α-amino-isovaleric acid) in light chain Gla zone sported A (L-Ala), the specific coagulation activity can increase to original 2 times, and reason may be owing to strengthened ability with the combination of activated state plasma thromboplastin component; When the V107 in light chain EGF-2 zone sports A, and the binding ability of activated state platelet cofactor Ⅰ is about 36 times of wild-type, therefore suspects the activity that can improve plasma thromboplastin component; After the R338 in heavy chain lytic enzyme district sports A, can significantly change its protease activity and reach about original 2 times.Therefore, we have selected these several mutational sites that the hF IX is carried out mutation research.

The yeast expression vector progress:

The protein expression system that can express at present the maturation of recombinant protein mainly contains pichia pastoris phaff (Pichia.past oris) protein expression system, Chinese hamster ovary cell (Chinese hamster ovary celI) protein expression system and insect cell protein expression system etc., but relative merits are separately arranged.The Pichia.pastoris gene expression system becomes more perfect heterologous gene expression system substantially through the recent two decades development, has the high density fermentation of being easy to, and the expressing gene stable integration is in host genome.As eukaryote, pichia spp has many advantages of high eukaryotic expression system: such as Protein processing, folding, posttranslational modification etc.Moreover, during operation and E.coli and yeast saccharomyces cerevisiae simple equally.It is more faster, simple, cheap than other eukaryotic expression systems such as baculovirus or mammalian tissues cultivations, and expression level is higher.There is at present more than 300 kind of foreign protein to obtain effective expression at the Pichia.pastoris gene expression system, wherein efficiently express the various exogenous genes such as HBsAg, TNF, EGF, Tetanus Toxin Fragment C, genetic engineering antibody, be considered at present the most effective yeast expression system.

Applied wild-type hF IX yeast expression vector pPIC9K-hF IX molecular weight is larger in the research, 10000bp is arranged, with present point mutation technology, do not have a kind of Pfu and Taq enzyme to finish to extend so large plasmid, thereby we have made up simultaneously pPICZ α A-hF IX and have carried out point mutation.PPICZ α A carrier also is a kind of secretion type Pichi expression vector, and it only has 3600bp, also only has about 6000bp after adding the purpose fragment, and so the present Fast-Pfu enzyme following fragment of 8000bp that can increase accurately is comparative maturity on the mutating technology; Moreover signal peptide of yeast-factor of pPICZ α A partly contains the Xho1 site, and also there is the Not1 site in the downstream simultaneously, just in time can be connected into the goal gene that downcuts from the pPIC9K-hF IX; At last, pPICZ α A carrier has Zeocin resistance site, can be easy to screen with Zeocin, and can utilize Zeocin concentration different, filters out the multiple copied transformant.The simple point mutation accumulative is adopted in a plurality of point mutation in this part, is about to sequence verification, and the successful plasmid that suddenly change carries out the sudden change in other sites again, reach so step by step to accumulate the purpose of suddenling change.

Pichia spp pilot scale fermentation technical study progress:

The accumulation of pichia spp tunning can not produce toxic side effect to self, and the expression strain of pichia spp is easy to expand high density fermentation in enormous quantities to from shake-flask culture, does not affect the expression level of foreign gene.This has been doomed pichia spp and has had the great potential that can be used for high density fermentation.

Pilot process is an important step that connects research and development and produce, and is the important step that scientific and technological achievement transforms to productivity.For many years, pilot scale does not obtain enough attention in China, and " pilot scale is blank " phenomenon is more serious.Yet the success or failure of achievement industrialization depend primarily on the success or failure of pilot scale, and scientific and technological achievement is through pilot scale, the industrialization success ratio can reach 80%, and do not only have 30% through pilot scale industrialization success ratio, only have and passed through pilot scale and just can carry out volume production, the importance of visible pilot process.

Pichia spp is nearly ten years popular new efficient expression systems.At present, oneself has 220 kinds with the foreign gene to 2000 of this system's successful expression year, and wherein major part is pharmaceutical products, such as recombination human interleukin 6, carp growth hormone, Trx, thrombopoietin, human interleukin 11 etc.But utilize its expression level of the different foreign protein of Pichia anomala expression to differ greatly, the high 12g/L that reaches, the minimum level of only having lmg/L, differ and to reach 10000 times, the difference of this exogenous protein expression, the characteristic that is on the one hand foreign gene itself causes: on the other hand, fermentation condition has also measured extremely important effect to expression.

Carrying out a small amount of when expressing, shake-flask culture commonly used, because the potential of hydrogen of nutrient solution is uncontrollable, the hypoventilation of fermentation system and the suitableeest addition of carbon nitrogen are all uncontrollable, affected the real expression level of foreign gene, as use fermentor cultivation, the expression level of foreign protein can be than common shaking flask high 10 ~ 100 times (Wood andKomives, 1999).In the traditional zymotic industry, often need to adopt the strategy of high density fermentation to improve throughput.

In the fermentative production there be the main strategy that adopts: batch fermentation, continuously ferment and fed-batch fermentation, the batch fermentation operation is fairly simple, and fermentation period is short, has been widely used in the production of recombinant protein.Yet the batch fermentation process has obvious limitation, generally can not obtain highdensity culture.The production efficiency of cultured continuously is more much higher than batch fermentation, be suitable for macrocyclic production, also can realize high density fermentation, but relatively operate more complicated, easily microbiological contamination, and in the long-time culturing process, microorganism morphs easily, if adopt recombinant microorganism, then the stable danger of plasmid also is difficult to guarantee that this has also limited the application of continuously fermenting in industry.Oneself is successfully applied to the fed-batch fermentation technology in the fermentative production of penicillin, VITAMIN, amino acid and enzyme, and key is the control of supplying technics in the fed-batch fermentation process, and supplying technics is the microbiological manipulation metabolism, improve one of output flexibly and effectively means.Certainly, should determine the suitableeest feed supplement kind, feed supplement amount and feed supplement mode according to bacterial classification or culture condition.

Up to the present, developed the feeding strategy in the various fermenting processs, as: the accumulation of acetic acid in the fermenting process is controlled at some levels to dissolved oxygen; In order to obtain higher specific growth rate, can adopt the index feeding strategy; In order to obtain higher cell concn, can be controlled at predefined certain level to specific growth rate; In order to guarantee the stability of plasmid in the recombinant microorganism, the cell in the fermented liquid that allows that the concentration of glucose in the fermented liquid is controlled at a lower level or gap is in the glucose starvation, thereby reduces the specific growth rate of microorganism.Yet, because the fermentation of different microorganisms has different characteristics, for example when bread yeast is cultivated obtaining maximum thing amounts as target, and to give expression to target protein in the fermenting process in recombinant microorganism and prevent plasmid loss phenomenon etc. in the host cell.Therefore, be not that the control strategy of achieving success in a kind of microbial fermentation also is suitable in the fermentation of another kind of microorganism.Some scholars have carried out some trials and improvement to above method in the microorganisms fermenting process, also developed some new control of additive raw materials simultaneously.Feeding strategy commonly used has linear feed supplement, speed change feed supplement, index feed supplement and feedback control at present.Absorption or demand according to carbon nitrogen source are determined that feed rate, permanent pH stream add, permanent dissolved oxygen stream adds and are controlled fed-batch fermentation of microorganism etc. by neurone and fuzzy theory.

Chang-Chih chen in 2004 etc. study in the SL fermentation cylinder for fermentation Pichia yeast engineering KM71-76, substratum is improved, growth phase is the BMGY (containing 4% glycerine) of 2L, the control temperature is at 300C, the pH value is 6.0, stirring velocity is 800r/min, air flow is 2-3wm, when the unexpected fast rise of dissolved oxygen, batch cultivation stage finishes, collecting cell, again cell is suspended among the fresh BMMHY of 2L that contains 0.5% (v/v) methyl alcohol, then aseptic technique is returned fermentor tank and is induced the product enzyme, adopts methyl alcohol electrode MC-168 that methanol concentration is controlled at 0.5, and the phytase vigor is up to 4946U/mL.

The gloomy optimum result according to shake flask fermentation of Li Hong had carried out testing in l0L fermentor tank high density fermentation condition to the phytase generating engineering bacteria in 2005.Seed take kind of age as 16h, by 3% inoculum size inoculation, the growth phase optimal pH is 5.5, and the induction period optimal pH is 6.5, and dissolved oxygen is controlled at 30% ~ 40%, and the induced concentration of methyl alcohol is 10g/L.Add optimum with variable flow in fed-batch, constant speed feed supplement, three kinds of feed supplement modes of speed change feed supplement, the highest cell concentration OD600 reaches 70, and the highest enzyme work reaches 2.63 * 10 ⁵U/mL.

What tin was slow-witted in 2006, and Peng Yuanyi etc. have made preliminary study to phytase gene engineering bacteria (E-22) in SL fermentation cylinder for fermentation phytase generating condition.Result of study shows, inoculation 36h, inoculum size 10%, increase bacterium time 72h, fermented liquid pH6.0 liquid amount 10%, carried out no-feed supplement, feed supplement, gap stream and added the fermenting experiment that methyl alcohol, constant speed stream add methyl alcohol, it is effective that the result shows that gap feed supplement and constant speed miscarriage add the methyl alcohol enzyme, and the highest enzyme work can reach 235290U/mL.

At present, mainly concentrate on the shaking flask level for the technical study of High Cell Density And High Expression phytase, then on the basis of shaking flask, in fermentor tank, carry out amplification culture, but the play-by-play about zymotechnique is fewer on the fermentor tank level.Because the difference of shaking flask and fermentor cultivation condition is very large, the level of Pichia anomala expression foreign protein often can not accurately reflect its truth in fermentor tank in shake-flask culture, the expression in the still fermentor tank that we pay close attention to most.The optimal culture condition that obtains on the shaking flask level just provides some reference datas for the fermentor tank relevant parameter.Therefore in the production process of reality, on the basis of shaking flask, will be through the several times continuous amplification of fermentor tank, and all to pass through careful Study on Fermentation at every turn, simultaneously zymotechnique also should be improved according to the needs of downstream purification and the control of total production cost, be can be real the large-scale production that is applied to.Therefore, the technical study of fermentor tank is very important.

Summary of the invention

The object of the present invention is to provide humanclottingfactorⅨ's (hF IX) mutant yeast expression vector, by with the α-amino-isovaleric acid V in the corresponding site of hF IX-protein and arginine R respectively or simultaneously point mutation be L-Ala A, obtain altogether four kinds of mutant, these carriers are with the promotor of very strong and strict regulation and control, directly there is yeast-signal peptide to induce hypersecretion, the molecular size range of expressed albumen is suitable for yeast fermentation, usefulness is high, industrialization potential is large, resulting expressing protein activity is higher than the wild-type hFIX expression vector that same method is expressed far away, and common human serum extracts product.

Another object of the present invention has been to provide the construction process of humanclottingfactorⅨ's (hF IX) mutant yeast expression vector, the technology that relates to all is that present biology field is commonly used, simple to operate, used material is commercially available all can be obtained, and adopts very common culture technique just can carry out follow-up fermentation research.

A further object of the invention has been to provide the application of a kind of hF IX mutant yeast expression vector in producing hF IX albumen.Carrier provided by the invention, can in pichia pastoris phaff, efficiently express mutant hF IX albumen, while is for the cultivation characteristics of pichia spp, optimize its Chinese style fermentation condition, can realize mutant hF IX high reactivity, efficiently express, cheap production for treating haemophilia B medicine is laid a good foundation after doing.

To achieve these goals, the present invention takes following technical scheme:

The construction process of humanclottingfactorⅨ's (hF IX) mutant yeast expression vector, its step is as follows:

The structure of the clone of A.hF IX cDNA and cloning vector pTG19-hF IX: be L-02(Chinese Academy of Sciences typical case culture collection council Kunming cell bank from human foetus liver cell) extraction cell total rna, according to GENEBANK(NCBI) middle hF IX gene order (CCDS14666.1), primer p01s and the p01a(table 1 of the full length sequence of design human cloning wild-type hF IX), after order-checking, confirm the correct clone of sequence; Utilize TA clone's method (" molecular cloning laboratory manual " (third edition) [J. Pehanorm Brooker etc. is write, 2003, Beijing: Science Press]), be connected in the pTG19-T carrier (available from Invitrogen) with the T4 ligase enzyme; (available from sigma) filters out typical white colony through the IPTG-X-Gal-Amp-LB culture plate, extracts plasmid DNA, and aligned sequences filters out the connection product pTG19-hF IX plasmid that comprises right-on wild-type hF IX sequence.

The structure of B.pPIC9K-hF IX: design clone hF IX is primer p05s and the p05a(table 1 of band signal peptide sequence not), two ends add Xho I and Not I restriction endonuclease recognition sequence, take above-mentioned TA cloning vector pTG19-hF IX as template, the PCR subclone goes out the hF IX cDNA fragment of 1330bp, through Xho I and Not I double digestion, pPIC9K carrier (available from Invitrogen) is also through same double digestion simultaneously, behind the agarose gel electrophoresis, downcut the purpose band, purifying goal gene and carrier and order-checking are identified; With T4 ligase enzyme catenation sequence correct goal gene hF IX and carrier pPIC9K, in changing bacillus coli DH 5 (available from Wuhan University Chinese Typical Representative culture collection center) over to.Extract plasmid, with P07s(table 1) and P07a(table 1) primer carries out the PCR checking, screens rear gene order-checking with 5AOXs and the 3AOXa primer (table 1) that can clone total length hF IX again, the comparison target sequence filters out right-on bacterium, the extraction plasmid.

Table 1

The structure of C.pPICZ α A-hF IX: with pPIC9K-hF IX and pPICZ α A carrier (available from Invitrogen) simultaneously with Xho I and Not I double digestion, behind the agarose gel electrophoresis, downcut purpose band (1300bp of pPIC9K-hF IX and pPICZ α A3600bp), purifying goal gene and carrier are also measured content; After connecting with the T4 ligase enzyme, with P06s(table 1) and P05a(table 1) primer carries out PCR and verify, prove to obtain the purpose band; Then transform, carry out the double digestion checking with XhoI and N ot I, prove to obtain purpose band (1500bp) and carrier (5400bp) that pPICZ α A-hF IX plasmid namely successfully constructs.Extraction plasmid order-checking obtains right-only, does not contain the p PICZ α A-hF IX plasmid of the hF IX cDNA sequence of signal peptide, namely obtains a kind of wild-type Pichia anomala expression plasmid pPICZ α A-hF IX.

D. the structure of mutant plasmid (comprises pPICZ α A-hF IX-R338A, pPICZ α A-hF IX-V86A-R338A, pPIC Z α A-hF IX-V107A-R338A, pPICZ α A-hF IX-V86A-V107A-R338A), these mutant be characterised in that with the α-amino-isovaleric acid V in the corresponding site of hF IX-protein and arginine R respectively or simultaneously point mutation be L-Ala A, obtain altogether four kinds of mutant, be respectively:

1. the 338th R in the wild-type hFIX protein sequence is sported A and obtain pPICZ α A-hF IX-R338A;

2. 86 V and 338 R in the wild-type hFIX protein sequence are all sported A acquisition pPICZ α A-hF IX-V86A-R338A;

3. 107 V and 338 R in the wild-type hFIX protein sequence are all sported A acquisition pPICZ α A-hF IX-V107A-R338A;

4. 86 V, 107 V and 338 R in the wild-type hFIX protein sequence are all sported A acquisition pPICZ α A-hF IX-V86A-V107A-R338A.

According to the design of primers principle of site-directed point mutation, design two complementary primers (the three couples of mutant primer V86A1 and V86A2, V107A1 and V107A2, R338A1 and R338A2 sequence are asked for an interview table 2) in above-mentioned three mutational sites.The structure of pPICZ α A-hF IX-R338A mutant plasmid: take above-mentioned pPICZ α A-hF IX as template, add high-fidelity DNA polymerase and primer R338A1 and R338A2, the hF IX of synthetic sudden change-R338A sequence, then remove the not template of sudden change with the DpnI endonuclease reaction, make up mutant plasmid pPICZ α A-hF IX-R338A.To suddenly change is converted in the competent cell behind the product purification, transformed clone is carried out enzyme cut evaluation, gets the cloning and sequencing of identifying that size conforms to, and screening is increased in a large number with the clone that expected sequence conforms to fully, extracts the plasmid preservation.

The structure of pPICZ α A-hF IX-V86A-R338A: take pPICZ α A-hF IX-R338A as template, add high-fidelity DNA polymerase and primer V86A1 and V86A2, the hF IX of synthetic sudden change-V86A-R338A sequence, then remove the not template of sudden change with the DpnI endonuclease reaction, making up its sequence of mutant plasmid pPICZ α A-hF IX-V86A-R338A(is SEQ ID NO.21).To suddenly change is converted in the competent cell behind the product purification, transformed clone is carried out enzyme cut evaluation, gets the cloning and sequencing of identifying that size conforms to, and screening is increased in a large number with the clone that expected sequence conforms to fully, extracts the plasmid preservation.

The structure of pPICZ α A-hF IX-V107A-R338: take pPICZ α A-hF IX-R338A as template, add high-fidelity DNA polymerase and primer V107A1 and V107A2(table 2), the hF IX of synthetic sudden change-V107A-R338 sequence, then remove the not template of sudden change with the DpnI endonuclease reaction, making up its sequence of mutant plasmid pPICZ α A-hF IX-V107A-R338A(is SE Q ID NO.22).To suddenly change is converted in the competent cell behind the product purification, transformed clone is carried out enzyme cut evaluation, gets the cloning and sequencing of identifying that size conforms to, and screening is increased in a large number with the clone that expected sequence conforms to fully, extracts the plasmid preservation.

The structure of pPICZ α A-hF IX-V86A-V107A-R338A: take pPICZ α A-hF IX-V107A-R338A as template, add high-fidelity DNA polymerase and primer V86A1 and V86A2, the hF IX of synthetic sudden change-V86A-V107A-R338A sequence, then remove the not template of sudden change with Dpn I endonuclease reaction, making up its sequence of mutant plasmid pPICZ α A-hF IX-V86A-V107A-R338A(is SEQ ID NO.23).To suddenly change is converted in the competent cell behind the product purification, transformed clone is carried out enzyme cut evaluation, gets the cloning and sequencing of identifying that size conforms to, and screening is increased in a large number with the clone that expected sequence conforms to fully, extracts the plasmid preservation.

Table 2

V86A1	5·AACTGTGAAT TAGAT GCTAC ATGTAACATT AAG·3
		V86A2	5·CTTAATGTTA CATGT AGCAT CTAATTCACA GTT·3
V107A1	5·AGTGCTGATA ACAAG GCTGT TTGCTCCTGT ACT·3
		V107A2	5·AGTACAGGAG CAAAC AGCCT TGTTATCAGC ACT·3
R338A1	5·CGAGCCACAT GTCTT GCTTC TACAAAGTTC ACC·3
		R338A2	5·GGTGAACTTT GTAGA AGCAA GACATGTGGC TCG·3

The expression of four kinds of mutant h F IX in Pichia anomala expression and the detection of blood coagulation activity: activation pichia spp, and preparation yeast competence; Utilize electric shock instrument to change pPICZ α A-hF IX and above-mentioned four kinds of mutant carriers among the pichia pastoris phaff SMD1168 (available from Wuhan University Chinese Typical Representative culture collection center), screen with the YPD-Zeocin flat board, choose three single colony inoculations of typical case of clear-cut in the 50ml centrifuge tube that contains 5ml YPD, cultivate pichia spp, cultivated 12-14 hour for 280rpm30 ℃, conservation and Genomic PCR are identified, detect the expression of determining hF IX and mutant protein thereof with SDS-PAGE and Western Blotting, filter out the highest bacterial strain of expression amount, enlarged culturing, abduction delivering is collected expression product, and measures albumen.(the hFIX mutant that the cruor time extending of scarce hF IX blood plasma can be added is corrected to utilize the clotting time to correct experiment, with reference to [1] Kaczor DA, Bickford NN, and Triplett DA, " Evaluation of Different Mixin g Study Reagents and Dilution Effect in Lupus Anticoagulant Testing; " Am J Clin Pathol, 1991,95 (3): 408-11.) [2] Van Cott EM and Laposata M, " Coagulation; Fibrinolysis and Hypercoagulation; " Clinical Diagnosis and Management by Laboratory Methods, 20th ed, He nr JB, ed, New York, NY:WB Saunders Co, 2001,644-6.) carry out the mensuration of protein-active, confirmation has obtained the highly active wild-type hF IX of pichia spp and its sequence of mutant protein hF IX-R338A(is SEQ ID NO.16,), its sequence of hF IX-V86A-R338A(is SEQ ID NO.17), its sequence of hF IX-V107A-R338A(is SEQ ID NO.18), its sequence of hF IX-V86A-V107A-R338A(is SEQ ID NO.19), each mutant blood coagulation activity is followed successively by: 38.93%, 20.29%, 44.06%, 14.75%.

The application (select above-mentioned blood coagulation activity the highest mutant protein V107A-R338A carry out the application of pilot scale fermentation) of a kind of hF IX mutant yeast expression vector in producing the hF IX, its application process is:

Finish the middle trial production of the 50L fermentor tank of hFIX with Pichia yeast hFIX wild strain, and set up the pilot scale production technique circuit of a maturation.Shake-flask seed substratum YPD, fermention medium BMGY and BMMY add first the 28%(volume ratio before inoculation) ammoniacal liquor the pH value of this substratum is maintained about 5.5.Culture condition: the bacterial classification recovery is placed on 28 ℃ of activation culture 24h in the YPD liquid nutrient medium, coat YPD flat board (containing G418), cultivate 72h for 28 ℃, picking list bacterium colony places BMGY substratum 250rpm concussion to cultivate 24h, as seed liquor, tank is inoculated in the preparation during to OD600 ≈ 10.Use 50L fermentor tank optimization of fermentation conditions, adopt the methanol induction batch fermentation, find out its optimal conditions of fermentation, a large amount of preparations and purifying hFIX have realized the novel process of pilot scale fermentation, and are used for the research of blood coagulation activity.

The result shows, 13h after the fermentation beginning, and the thalline weight in wet base slowly increases, and is in the adaptive phase; Afterwards, thalline begins Fast Growth and enters exponential phase of growth, when fermenting 24h, fermented liquid begins to detect blood coagulation activity, along with the prolongation of fermentation time, blood coagulation activity strengthens, behind the 48h, the hFIX protein expression begins to enter plateau, blood coagulation activity increasess slowly, and to 72h, it is maximum that blood coagulation activity reaches, stop fermentation, the results culture supernatant.Can secrete a large amount of hFIX albumen with blood coagulation activity through methanol induction, under the condition of fermented liquid pH value 5.5, it is comparatively suitable that methanol induction was put tank in 72 hours, and its output can reach 558mgL, is about 4 times of shaking flask expression amount.3 batches of pilot scale fermentations, thalline A600 average reaches (482.23 ± 23.35), and hFIX expression amount average is (611.08 ± 33.68) mg/L.The logarithmic phase of thalline and stationary phase hFIX albumen great expression, the thalline weight in wet base reaches 429g/L, behind the 100h, pichia spp enters the paracme, protein expression stops substantially, the thalline weight in wet base descends obviously, protein content is substantially constant.Stop to 124h fermentation, record that protein content reaches 168g/L in the fermented liquid supernatant.Albumen through reversed-phase liquid chromatography purification Identification product purity is behind the purifying〉89%.Get the blood coagulation activity that sample 100 μ l after the separation and purification detect the fermentation supernatant, recording blood coagulation activity is 26.21.

The present invention compared with prior art has the following advantages and effect:

The activity of mutant hF IX-R338A, hF IX-V86A-R338A, hF IX-V107A-R338, hF IX-V86A-V107A-R338A all is higher than common thrombin in the invention, and wherein the activity of hF IX-V107A-R338 is the highest.Therefore, aspect the haemophilia B of hF IX mutant protein of the present invention due to exploitation hF IX genetic flaw very large using value will be arranged.The hF IX high reactivity mutant pichia spp carrier for expression of eukaryon of gained of the present invention, shaking flask expression amount high (generally all exist〉100mg/L level) and stablizing, as carry out fermentor tank production, output still has room for promotion.The Pichia anomala expression body that makes up has the high density fermentation of being easy to, the advantage of expressing gene stable integration in host genome, and also purifying process is simpler, and yield is higher.The many advantages that possess simultaneously the high eukaryotic expression systems such as general pichia spp: such as Protein processing, folding, posttranslational modification etc.Moreover, during operation and E.coli and yeast saccharomyces cerevisiae simple equally.It is more faster, cheap than other eukaryotic expression systems such as baculovirus or mammalian tissues cultivations, and construction process is simple, and expression level is higher, is considered at present the most effective yeast expression system as eukaryote.It is dangerous that its maximum advantage is to be applied to the human body virus-free infection, uses that safety, cost are low, non-immunogenicity and have no side effect etc.Therefore, the high reactivity mutant of the yeast expression hF IX that the present invention makes up is having larger value and significance aspect the development hF IX pharmaceutical grade protein, can realize the hF IX high reactivity, efficiently express, application is little with the human body toxic side effect, and the pilot scale fermentation technique of resulting various mutant hF IX secretion expression carriers is that later cheap production for treating haemophilia B medicine is laid a good foundation.

Description of drawings

Fig. 1 is a kind of wild-type hF IX plasmid construction schema.

Fig. 2 is clone's synoptic diagram of a kind of hF IX cDNA.

A: the cell total rna electrophorogram of extraction; B:RT-PCR amplification hF IX cDNA.Cell total rna can be seen at the very obvious purpose band in the position of 1500bp behind RT-PC R.Tentatively think the cDNA of hF IX total length.After it is cut glue and reclaim purifying, be connected in the pGT19-T cloning vector, transform, three mono-clonals of picking check order, and have obtained the cDNA sequence of right-on hF IX total length.

Fig. 3 is a kind of pPIC9K-hF IX plasmid construction checking.

The A:PCR checking, wherein 1-3 is three bacterium colonies; B:Xho1 and the checking of Not1 double digestion, wherein 1-2 is two bacterium colonies, diagram purpose band and carrier, the success of prompting pPIC9K-hF IX plasmid construction.

Fig. 4 is a kind of transformant Genomic PCR checking synoptic diagram.

Genomic PCR checking transformant.

A: the short primer checking obtains 500bp purpose band, and wherein 1-3 is the transformant numbering (3 strain candidate strain) that filters out;

B: the checking of total length primer obtains the purpose band of 1300bp, and wherein 1-3 is the transformant numbering.

Fig. 5 is a kind of hF IX expression of results synoptic diagram.

SDS-PAGE and Western Blot detect: SDS-PAGE electrophoresis and Western Blot detect protein expression.A:1-3 is sample number into spectrum, as seen in the position of 55KD an obvious protein band is arranged, and also can obtain more clearly band when being We stern Blot with the monoclonal antibody of hF IX, and position and immunogenicity all meet the characteristic of hF IX; B:1 is 24h, and 2 is 48h, and 3 is the induction time of 96h.The Western Blot result that C:A and B are corresponding.The target protein of as seen expressing in 48h is many, and the secretory volume of foreign protein is few, so determine that the expression time of bacterial strain the best of structure is 48h.Also can obtain more clearly band when again being Western Blot with the monoclonal antibody of hF IX simultaneously, prove that this locational albumen is the hF IX.

Fig. 6 is the SDS-PAGE electrophoresis synoptic diagram of each collection tube sample behind a kind of anion-exchange chromatography wash-out.

Wherein 1-11 is the collection tube numbering; The position of 55KD is the target protein that wash-out is collected.Near the 5th, 6,7 pipes sample target protein is more clear and foreign protein is less, and purification effect is better, the 1-2 pipe sample of the main peak left and right sides is collected dialysis, concentrated and freeze-drying.

Fig. 7 is the active typical curve synoptic diagram of a kind of hF IX.

As shown in the figure, surveying the clotting time with the Quality Control blood plasma of standard has obtained blood coagulation activity (the h IX: C) and the regression curve between the clotting time and equation, equation has been y=-12.7ln (x)+139.4, and degree of fitting is 0.993.Equation coincidence statistics principle.

Fig. 8 is the active synoptic diagram of a kind of yeast expression wild-type hF IX.

The yeast expression dried frozen aquatic products of wild-type hF IX is diluted to 5 μ g/ml with the sterilization tri-distilled water, measures its APTT time.The result as shown in the figure, the hF IX of expressing with pichia spp SMD1168 and pPIC9K-hF IX has activity, relatively there were significant differences (P＜0.05) for the expression supernatant of empty carrier.The hF IX that proof is expressed has certain blood coagulation activity, hF IX: C=5.5%.

Fig. 9 is a kind of hF IX mutant plasmid construction process synoptic diagram.

Figure 10 is a kind of checking of pPICZ α A-hF IX plasmid.A:Xho I and the checking of Not I double digestion, wherein 1-2 is two single bacterium colonies; Diagram purpose band (1500bp) and carrier (5400bp), the success of prompting pPICZ α A-hF IX plasmid construction.The B:PCR checking, wherein 1-2 is two single bacterium colonies.

Figure 11 is a kind of order-checking synoptic diagram of pPICZ α A-hF IX mutant plasmid.

Order-checking through the goal gene complete sequence filters out the plasmid that only has the purpose site mutation, and the gene order of the standard mesh in the gene library compares, as shown in the figure, various mutant plasmids until all suddenly change site after becoming design, mutational site.A-D is respectively pPICZ α A-hF IX-R338A, V86A-R338A, V107A-R338A, V86A-V107A-R338A.Figure 12 is the transformant Genomic PCR screening after a kind of mutant plasmid changes thalline over to.Wherein 1-5 is respectively SMD1168-hF IX-R338A, V86A-V107A, V86A-R338A, V107A-R338A, V86A-V107A-R338A.Being shown in desired location has the purpose band, proves various mutant plasmids of changing over to of bacterial strain success and integrating, and the bacterial strain that changes empty plasmid over to does not all have the purpose band.

Figure 13 is that a kind of SDS-PAGE electrophoresis and Western Blot detect various mutant proteins expression synoptic diagram.

A: mutants which had is expressed supernatant SDS-PAGE electrophorogram.Wherein 1-5 is respectively hF IX-R338A, V86A-V107A, V86A-R338A, V107A-R338A, V86A-V107A-R338A; B: be corresponding Western Bl ot detected result, can obtain more clearly band when being Western Blot with the monoclonal antibody of hF IX and every kind of mutant protein among the figure, because position and immunogenicity all meet the characteristic of hF IX, can assert tentatively that various mutant hF IX have obtained expression; C: SDS-PAGE electrophoresis detection behind the various mutant protein purifying.Wherein 1-5 is respectively hF IX-R338A, V86A-V107A, V86A-R338A, V107A-R338A, V86A-V107A-R338A.Be showed no obvious foreign protein band after various mutant protein samples are purified.

Figure 14 is that a kind of mutant hF IX albumen is diluted to SDS-PAGE electrophoresis detection behind the 5 μ gml

Wherein 3-8 is respectively hF IX-R338A, V86A-V107A, V86A-R338A, V107A-R338A, V86A-V107A-R338A.The dried frozen aquatic products of various mutant hF IX is diluted to 5 μ g/ml with the sterilization tri-distilled water, determines the concentration of various mutant with the SDS-PAGE electrophoresis, as shown in the figure, sample concentration does not have significant difference between the various mutant.

Figure 15 is relatively synoptic diagram of several mutant hF IX albumen procoagulant activities.

Shown in the figure A table, the various hF IX of expressing with pichia spp SMD1168 all have procoagulant activity, and relatively all there were significant differences (P＜0.05) for the expression supernatant of empty carrier.In hF IX-R338A, V86A-V107A, V86A-R338A, V107A-R338A, four mutant of V86A-V107A-R338A, it is minimum that the activity of V107A-R338A is up to 44.06%, V86A activity, is 5.71%.The result of each mutant procoagulant activity is relatively shown in figure B: R338A is significantly greater than V86A-R338A; V107A-R338A is significantly greater than R338A; V86A-V107A-R338A significantly less than V107A-R338A but and V86A-R338A without significant difference.

Embodiment

Embodiment 1:

The construction process of wild-type and the high-expression vector of mutant hF IX in pichia spp comprises the following steps:

Table 1

The primer title	Primer sequence
		P01s	5'-GG GGATCCTAGCAAAGGTTATGCAGCGCGT-3′
P01a	5'-GG CTTAAGTTCAGGCACCTTACTTCATCCC-3'
		P05a	5'-GG GCGGCCGCATTAGTTAGTGAGAGGCCC-3'
P05s	5'-GG GAATTCTATAATTCAGGTAAATTGGAAGAGTT-3'
		P06s	5'-GG CTCGAGAAAAGAGAGTATAATTCAGGTAAATTGG-3'
P07s	5'-CAAGGTGGTTTGCTCCTGTA-3'
		P07a	5'-TAGCTGCATTGTAGTTGTGGTG-3'
5AOXs	5′-GACTGGTTCCAATTGACAAGC-3′
		3AOXa
	5′-GCAAATGGCATTCTGACATCC-3′

1. total RNA extracts:

(1) be L-02(Chinese Academy of Sciences typical case culture collection council Kunming cell bank from human foetus liver cell) the extraction cell total rna, the Trizol reagent that adds 1.3ml, with homogenizer homogenate 10min, to all sparing into pasty state liquid, all move in the 1.5ml EP pipe.

(2) room temperature (20-25 ℃, below identical) is placed 5-10min, 12000rpm, 4 ℃ of centrifugal 15min.

(3) draw the middle level transparent liquid, be not drawn onto the impurity of levels.The liquid drawn as in another EP pipe, is added the chloroform of 0.2ml, softly put upside down mixing 10 times, room temperature is placed 2-3min.

(4) 12000rpm, 4 ℃ of centrifugal 10min.

(5) draw supernatant liquid and place another EP pipe, add the equal-volume chloroform, mixing is 5-10 time gently, and room temperature is placed 2-3min.

(6) 12000rpm, 4 ℃ of centrifugal 10min.

(7) supernatant of absorption about 80% adds 500 μ l Virahols to another EP pipe, and fully mixing is put into-20 ℃ of 1-2h.

(8) 12000rpm, 4 ℃ of centrifugal 15min.

(9) abandon supernatant, with 75%(dehydrated alcohol/water, volume ratio) ethanol and each washing of dehydrated alcohol 1ml once, the dried ethanol of room temperature control.

(10) the DEPC water of adding 65 μ l, fully dissolution precipitation.After the packing in-80 ℃ of preservations.

2.hF the clone of IX and pTG19-hF IX plasmid construction:

(1) reverse transcription of cell total rna: reaction system 10 μ l add 10 * RT Butter1 μ l, MgCl successively ₂(25mM) 2 μ l, RNase Inhibitor(40U/ μ l) 0.25 μ l, each 10mM of dNTP Mixture() 1 μ l, Oligo d T primer (2.5pmol/ μ l) 0.5 μ l, AMV enzyme (5U/ μ l) 1 μ l, cell total rna (about 3 μ g) 5 μ l add DEP C-H ₂O to 10 μ l.Reaction conditions: 30 ℃ of effect 10min, 42 ℃ of effect 60min, 4 ℃ save backup.

(2) cell hF IX full-length cDNA amplification: reaction system 25 μ l, add successively 5 * PCR Buffer5 μ l, each 0.1 μ l of 10mM dNTP Mixture, primer p01s(table 1) (50 μ m) 0.25 μ l, primer p01a(table 1) (50 μ m) 0.25 μ l, Ex-Taq enzyme 0.12 μ l, RT-PCR product 5 μ l add DEPC-H ₂O to 25 μ l.Reaction conditions: behind 94 ℃ of effect 10min, with 94 ℃ of 30s, 55.6 ℃ of 30s, 72 ℃ of 1min45s act on 35 circulations; Extend 10min with 72 ℃ at last, obtaining fragment is the hF IX full length cDNA sequence (Fig. 2) of 1500bp, and 4 ℃ save backup.

(3) above-mentioned hF IX cell full-length cDNA product is carried out agarose gel electrophoresis, and under ultraviolet lamp, with scalpel the band of 1500bp position is cut out (about 300mg gel), put into 1.5ml EP pipe, the purifying gel, reclaim the DNA(concrete grammar and see that the sepharose of following DNA reclaims), and quantitatively.

(4) make up linked system: 10 * T4 ligase enzyme Buffer(can only freeze thawing 3 times) 2.5 μ l, pTG19-T carrier DN A0.03pmol, goal gene fragment (PCR product) 0.3pmol, T4 ligase enzyme (350U/ μ l) 1 μ l adds sterilization tri-distilled water to 25 μ l.16 ℃ are spent the night.

(5) system after will spending the night all joins in the E.coli competent cell of 100 μ l, carries out conversion operation, is coated onto in the IPTG-X-Gal-Amp-LB culture plate.

Cultivate 14-18h for (6) 37 ℃.As transforming and successful connection, sample panel can grow white colony about 80% and about 20% blue colonies.

(7) white colony of three well-growns of picking, clear-cut on each plank is put into the 50ml triangular flask that contains the 10ml substratum, 220rpm shake-flask culture 14-18h.

(8) extract the plasmid order-checking, the comparison target sequence filters out right-on bacterium and carries out conservation.

3.DNA sepharose reclaim:

The DNA band that (1) will reclaim with scalpel under the ultraviolet lamp cuts out (about 300mg, to cut respectively greater than 300mg and to put into), put into 1.5ml EP pipe, the every 100mg gel of sol B uffer(that adds in the test kit (Promega Wizard SV gel and PCR Clean-up System) adds 300 μ l).

(2) 55 ℃ of water-baths were put upside down once, until glue dissolves fully in per 3 minutes.

(3) liquid behind the colloidal sol is added in the DNA adsorption column in the mentioned reagent box, the centrifugal 15s of 11000rpm, with the liquid after centrifugal again upper prop, centrifugal twice again, namely a sample is crossed pillar three times, the last centrifugal 1min of 11000rpm.

(4) the washing Buffer500 μ l in the adding test kit in centrifugal column, the centrifugal 15s of 11000rpm repeats twice, and last is all over the centrifugal 1min of 11000rpm.

(5) open the lid of centrifugal column, 5min volatilizees totally alcohol fully.

(6) sleeve pipe with the centrifugal column outside abandons, and puts the 1.5ml EP pipe that mark is good.

(7) the wash-out Buffer30-50 μ l in the test kit is joined on the film of centrifugal column bottom center, hatch 10min for 37 ℃, 11000rpm, centrifugal 1min.

(8) liquid after centrifugal is joined on the film of centrifugal column bottom center again, hatch 10min for 37 ℃, the centrifugal 2min of 11000rpm preserves sample for-20 ℃.

4.pPIC9K-hF the structure of IX plasmid (Fig. 1):

(1) the band signal peptide fragment not take pTG19-hF IX plasmid as template pcr amplification hF IX, primer 5` end is introduced Xho1 and the restricted double enzyme site of Not1.Reaction system: 10 * PCR Buffer2 μ l, MgCl ₂(25mM) 0.8 μ l, dNT P (10mM) 0.2 μ l, pTG19-hFIX plasmid 1 μ g, upstream primer p06s(table 1) (10 μ m) 0.6 μ l, downstream primer p05a(table 1) (10 μ m) 0.6 μ l, Ex-Taq enzyme 0.125 μ l (5U/ μ l) adds sterilization tri-distilled water to 20 μ l.94 ℃ of sex change 10min of reaction conditions, then with 94 ℃ of 30s, 55.6 ℃ of 30s, 35 circulations of 72 ℃ of 1min45s amplifications are extended 10min with 72 ℃ at last.

(2) the pTG-19hF IX that hF IX cDNA is made up from top 2 is downcut with the restriction enzyme Xho1 that designs and Not1, and the pPIC9K expression vector also cuts with same enzyme simultaneously.It is as follows that enzyme is cut system: 10 * T4 enzyme is cut Buf fer2 μ l, and each 1 μ l of Xho1 and Not1 contains the plasmid vector DNA50 μ g/5 μ g of goal gene, adds sterilization tri-distilled water to 20 μ l.37 ℃ of reaction 4-8h, with the system of react adding sample-loading buffer, 1%(agar Icing Sugar/water then, weight/volume, below identical) agarose gel electrophoresis.

(3) downcut the purpose band, purifying goal gene and carrier are also measured content.

(4) structure of linked system: 10 * T4 ligase enzyme Buffer2.5 μ l, pPIC9K carrier DNA 0.03pmol, above-mentioned endonuclease bamhi 0.3pmol, T4 ligase enzyme (350U/ μ l) 1 μ l adds sterilization tri-distilled water to 25 μ l.16 ℃ are spent the night.

(5) system after will spending the night all joins in the E.coli competent cell of 100 μ l, carries out conversion operation, is coated onto in the Amp-LB culture plate.

Cultivate 14-18h for (6) 37 ℃.As transforming and successful connection, sample panel can grow some white colonies.

(8) extract plasmid, with P07s(table 1) and P07a(table 1) primer carries out PCR checking (Fig. 3), again with cloning the 5AOXs(table 1 of total length hF IX) and 3AOXa(table 1) primer screens rear gene order-checking, the comparison target sequence filters out right-on bacterium (expression plasmid pPIC9K-hF IX) and carries out conservation (Fig. 4).

5.pPICZ the structure of α A-hF IX:

(1) with pPIC9K-hF IX and pPICZ α A carrier (available from invitrogen) simultaneously with XhoI and NotI double digestion: enzyme is cut system, 10 * T4 enzyme is cut Buffer2 μ l, XhoI and NotI be 1 μ l respectively, contains the plasmid vector DNA50 μ g/5 μ g of goal gene, adds sterilization tri-distilled water to 20 μ l.37 ℃ of reaction 4-8h add sample-loading buffer with the system of having reacted, then with 1% agarose gel electrophoresis.

(2) 37 ℃ of reaction 4-8h.The system of having reacted is added sample-loading buffer, 1% agarose gel electrophoresis.

(3) downcut purpose band (1300bp of pPIC9K-hF IX and pPICZ α A3600bp), purifying goal gene and carrier are also measured content.

(8) extract plasmid, Xho1 and Not1 double digestion checking (Figure 10), and with P06s(table 1) and P05a(table 1) primer carries out the PCR checking and carry out gene order-checking, the comparison target sequence filters out right-on bacterium (expression plasmid pPICZ α A-hF IX) and carries out conservation.

6. the structure of mutant plasmid (Fig. 9): the structure of mutant plasmid (comprising pPICZ α A-hF IX-R338A, pPICZ α A-V86A-R338A, pPICZ α A-V107A-R338A, pPICZ α A-V86A-V107A-R338A), these mutant be characterised in that with the α-amino-isovaleric acid V in the corresponding site of hF IX-protein and arginine R respectively or simultaneously point mutation be L-Ala A, be about in the wild-type hFIX protein sequence the 338th R and sport A and obtain pPICZ α A-hF IX-R338A; Simultaneously 86 V and 338 R are all sported A acquisition pPICZ α A-hF IX-V86A-R338A; Simultaneously 107 V and 338 R are all sported A acquisition pPICZ α A-hF IX-V107A-R338A; Simultaneously 86 V, 107 V and 338 R are all sported A acquisition pPICZ α A-hF IX-V86A-V107A-R338A.According to the design of primers principle of site-directed point mutation, design two complementary primers (the three couples of mutant primer V86A1 and V86A2, V107A1 and V107A2, R338A1 and R338A2 sequence are asked for an interview table 2) in above-mentioned three mutational sites.The structure of pPICZ α A-hF IX-R338A mutant plasmid: take above-mentioned pPICZ α A-hF IX as template, add high-fidelity DNA polymerase and primer R338A1 and R338A2(table 2), the hF IX of synthetic sudden change-R338A sequence, then remove the not template of sudden change with the DpnI endonuclease reaction, make up mutant plasmid pPICZ α A-hF IX-R338A.To suddenly change is converted in the competent cell behind the product purification, transformed clone is carried out enzyme cut evaluation, gets the cloning and sequencing of identifying that size conforms to, and screening is increased in a large number with the clone that expected sequence conforms to fully, extracts the plasmid preservation.The structure of pPICZ α A-hF IX-V86A-R338A: take pPICZ α A-hF IX-R338A as template, add high-fidelity DNA polymerase and primer V86A1 and V86A2(table 2), the hF IX of synthetic sudden change-V86A-R338A sequence, then remove the not template of sudden change with the DpnI endonuclease reaction, make up mutant plasmid pPICZ α A-hF IX-V86A-R338A.To suddenly change is converted in the competent cell behind the product purification, transformed clone is carried out enzyme cut evaluation, gets the cloning and sequencing of identifying that size conforms to, and screening is increased in a large number with the clone that expected sequence conforms to fully, extracts the plasmid preservation.The structure of pPICZ α A-hF IX-V107A-R338: take pPICZ α A-hF IX-R338A as template, add high-fidelity DNA polymerase and primer V107A1 and V107A2(table 2), the hF IX of synthetic sudden change-V107A-R338 sequence, then remove the not template of sudden change with the DpnI endonuclease reaction, make up mutant plasmid pPICZ α A-hF IX-V107A-R338A.To suddenly change is converted in the competent cell behind the product purification, transformed clone is carried out enzyme cut evaluation, gets the cloning and sequencing of identifying that size conforms to, and screening is increased in a large number with the clone that expected sequence conforms to fully, extracts the plasmid preservation.The structure of pPICZ α A-hF IX-V86A-V107A-R338A: take pPICZ α A-hF IX-V107A-R338A as template, add high-fidelity DNA polymerase and primer V86A1 and V86A2(table 2), the hF IX of synthetic sudden change-V86A-V107A-R338A sequence, then remove the not template of sudden change with the DpnI endonuclease reaction, make up mutant plasmid pPICZ α A-hF IX-V86A-V107A-R338A.To suddenly change is converted in the competent cell behind the product purification, transformed clone is carried out enzyme cut evaluation, gets the cloning and sequencing (Figure 11) of identifying that size conforms to, and screening is increased in a large number with the clone that expected sequence conforms to fully, extracts the plasmid preservation.Concrete reaction conditions is as follows.

(1) primer of two complementations of each mutant design, primer length is generally 25-45 base.Sequence sees the following form.

Table 2

(2) site-directed point mutation reaction.System is as follows: 10 * Pfu Buffer5 μ l, MgCl ₂(50mM) 1.5 μ l, two complementary primer mixing solutionss (each 100 μ M), 3 μ l, dNTP (10mM) 1.3 μ l, template plasmid 0.5ug, Fast Pfu enzyme 1 μ l adds DEPC water to 50 μ l.Reaction conditions: 95 ℃ of 2min, with 95 ℃ of 20s, 60 ℃ of 20s, 22 circulations of 68 ℃ of 6min effects, 72 ℃ are extended 5min, put 4 ℃ of preservations.

(3) DpnI endonuclease reaction system.System is as follows: 10 * DpnI Buffer6 μ l, DpnI (10U/ μ l) 2 μ, site-directed point mutation reaction system 50 μ l, stoning sour water 2 μ l.Reaction conditions: 37 ℃ of 2h, put 4 ℃ of preservations.

(4) product that will suddenly change carries out purifying according to the requirement of PCR purification kit specification sheets.

(5) transform, choose clone identification: the transformation efficiency of competence bacterium must be at least 10 ⁷More than, otherwise be difficult to obtain the clone.Usually can add all sudden change products after through Dpn I digestion and purifying in per 100 μ l competence bacteriums.Working method (Huang Peitang translates, molecular cloning experiment guide, the 3rd edition) according to the transformed competence colibacillus bacterium operates, way by centrifugal concentrating before coated plate, bacterium after all are converted all is applied to and contains on the suitable antibiotic flat board overnight incubation.Usually can obtain the clone below 50.For the clone who obtains, can choose first the little enzyme of taking out of clone and cut evaluation.Whether conform to expected results with the size of inserting segment in the size of the plasmid confirming to obtain and the plasmid.Getting 3-5 enzyme cuts and identifies that correct clone removes order-checking, the mutant clon whether clone who obtains with final affirmation expects.Can obtain the mutant clon of an expection among usually about per 2 clones.But sometimes also may because of random factor, can check order 3-5 and clone the mutant clon that just obtains an expection.

7. the electricity of pichia spp SMD1168 transforms:

(1) SMD1168 is preserved bacterial strain (available from Wuhan University Chinese Typical Representative culture collection center) in YPD flat board line activation, cultivate 48h for 30 ℃.

(2) choose a clear-cut with sterilizing toothpick, typical single colony inoculation is cultivated pichia spp in the 50ml centrifuge tube that contains 5ml YPD, cultivates 12-14h for 280rpm30 ℃.

(3) get the above-mentioned culture of 0.05-0.25ml, inoculation contains the 1L shaking flask of 250ml YPD substratum, and overnight growth is also monitored its OD600 at any time, to OD600=1.3～1.5.

(4) 4 ℃, the centrifugal 5min collecting cell of 1500g is with the aqua sterilisa suspension cell of 250ml precooling.

(5) as above (4) are centrifugal, with the aqua sterilisa suspension cell of 125ml precooling.

(6) as above centrifugal (4) are with the 1M sorbyl alcohol suspension cell of 10ml precooling.

(7) as above centrifugal (4) are with the 1M sorbyl alcohol suspension cell of 0.5ml precooling, to the about 1ml of final volume.

(8) with 1.5ml EP pipe packing cell suspension, every part of 80 μ l.Being used for immediately electricity transforms.

(9) get the above-mentioned cell of 80 μ l and mix with 5-20 μ g linearizing DNA (being dissolved in 5-10 μ l TE), change the 0.2cm electricity revolving cup of precooling over to, place 5min on ice.

(10) will shock by electricity the cup put into

In the multi-functional cell electroporation instrument, use 1500V, 5ms shocks by electricity.

(11) electric shock is put into ice after finishing immediately, adds in the sorbyl alcohol (1M) of 1ml precooling, content is transferred in the 1.5ml EP pipe of sterilization.

(12) the centrifugal 5min of 1500g, with supernatant sucking-off 600 μ l, remaining usefulness has been cut gently mixing 10 times of most advanced and sophisticated rifle head.All be applied on the MD flat board.

Cultivated 2～5 days until transformant grows for (13) 30 ℃.Each about 10～30.

Each transformant that (14) will grow is chosen with toothpick and is equipped with in the 5ml MD substratum 50ml Erlenmeyer flask, cultivates 48h with 280rpm30 ℃.Extract plasmid, the transformant that can grow after PCR checking (Figure 12) is correct adds 400 μ l glycerine conservations and numbering with 600 μ l bacterium liquid.

8. screen the multiple copied transformant:

(1) containing respectively G4184.0mg/ml, 5.0mg/ml, the YPD flat board bottom of 6.0mg/ml draws 7 * 7 grid and numbering with marking pen.

Numbering during (2) according to the transformant conservation is drawn 5 μ l conservation bacterium liquid points contain G418 every kind of concentration dull and stereotyped the numbering on the corresponding position of YPD.

Cultivated 2 days and observed at any time for (3) 30 ℃, the transformant numbering that the record growth is fast.The numbering of the bacterial strain that will grow at the plank of the highest G418 concentration in the 4th day is carried out record.

9.hF the abduction delivering of IX:

(1) picking mono-clonal is seeded to (250ml shaking flask) among 25ml BMGY or the YPD, and 28-30 ℃, 250-300rpm shakes to OD600=2～6 (logarithmic phase, approximately 16-18 hour).

(2) the centrifugal 5min of room temperature 1500-3000rpm, collecting cell is removed supernatant, to OD600=1.0, carries out abduction delivering (approximately 100-200ml) with BMMY (containing 1% methyl alcohol, volume/volume) re-suspended cell.In the 1L shaking flask, add above-mentioned culture, add a cover two-layer sterile gauze or cheese cloth, put into the continued growth of 250-300rpm shaking table.

(3) per 24 hours, add methyl alcohol to final concentration and be 1% and induce continuing.Check the amount of substratum, guarantee correctly to add methyl alcohol, because the Evaporation meeting reduces the volume of substratum.

(4) at each following time point, get 1ml substratum to 1～5ml centrifuge tube.The Best Times (12h, 24h, 48h, 72h) that these samples are used for analyzing expression level and determine to induce rear collecting cell.Room temperature centrifugal 2～3min(Fig. 5 of horizontal centrifuge maximum speed of revolution).

(5) induce end after, supernatant is transferred in the single pipe, preserve 4 ℃, cell precipitation is stored in-80 ℃ until begin to detect.

(6) come the protein expression correct (Figure 13,14) of check analysis supernatant and cell precipitation with coomassie brilliant blue staining, SDS-PAGE, Western Blot method.

10. protein purification:

A. dialysis:

(1) the yeast expression product 40ml11000rpm * 15min with 48h is centrifugal, gets supernatant, abandons precipitation.

(2) filter of supernatant with 0.45 μ m filtered.

(3) dialysis tubing is boiled 30min with boiling bag liquid, clean and immersion 2h with distilled water.The upper clip of folder at one end with the sample dialysis tubing of packing into, drains air, again the clip of the upper the other end of folder with funnel.

The dialysis tubing that (4) sample will be housed is put into the 3L large beaker of 100mM Tris (PH=8.8) damping fluid that fills 2L, beaker is put on the magnetic stirring apparatus again and is at the uniform velocity stirred, and speed is suitable so that dialysis tubing is rotated to be gently.

(5) 4 ℃ are stirred 24h, and every 6h changes a 100mM Tris (PH=8.8) damping fluid.4 ℃ of taking-up dialysis tubings are for subsequent use after finishing.

B. anion exchange chromatography (Fig. 6):

(1) dress post: pillar is cleaned and complete drying with distilled water, and vertical folder is on iron stand.Anionite-exchange resin adds 100mM Tris (PH=8.8) damping fluid, stirs, and puts into vacuum drier with the vacuum pump 30min that bleeds.Stir, disposable pouring in the pillar, and in pillar, fill it up with damping fluid.

(2) balance: wash pillar with 100mM Tris (PH=8.8) damping fluid with Peak Flow Rate, damping fluid will be expired post all the time.For the first time need 2h, need later on to get final product about 40min.Simultaneously will be with the absorbance furnishing 0 of protein detection instrument (280nm wavelength).At last the solution face is adjusted to and just exposed the post bed, close constant flow pump.

(3) upper prop: draw sample with connector bend dropping tube, slowly pasting column wall and adding.Open constant flow pump, with the speed upper prop of 2ml/min, the sample solution face is adjusted to just exposed the post bed at last, close constant flow pump.

(4) wash-out: the NaCl solution dilution of 2M is become 1.5M, 1M, 0.5M, 0.2M, 0.1M.From low concentration solution, add first the NaCl solution of 0.1M, draw with connector bend dropping tube, slowly pasting column wall and adding.Open the speed wash-out of constant flow pump 1ml/min, open simultaneously protein detection instrument, registering instrument and automatic collector, record is also collected, and every 3min collects a pipe.Merge main peak several pipes on every side, 4 ℃ for subsequent use.

C. dialysis: the method with above-mentioned A is replaced by PBS with solution system.

D. concentrated:

(1) dialysis tubing is put into large porcelain dish, sprinkled uniformly one deck PEG-20000 on each is equipped with the dialysis tubing of sample, large porcelain dish a little tilts.

(2) 4 ℃ of placements, every 1h sprinkles uniformly one deck PEG-20000 again and puts upside down the mixing dialysis tubing, until the solution in the dialysis tubing reduces about 75%.

E. vacuum-freeze-dry:

(3) sample is packed in the triangular flask into ice-bound mouthful ,-80 ℃ of freezing spending the night.

(4) put into immediately the vacuum-freeze-dry machine after taking out and carry out vacuum-freeze-dry.

(5) on ice with spoon with on the bottle wall and the bottom freeze-drying after protein powder scrape and mix, packing, the sealing ,-80 ℃ of preservations.

F. detection, quantitative:

Lyophilized powder is made into the protein solution of 20mg/ml with tri-distilled water, with its purity of SDS-PAGE electrophoresis detection, and with coagulating

The glue analysis software carries out sxemiquantitative.

11. the extraction of Yeast genome:

(1) will cultivate 2-3 days bacterium liquid 1ml as in the 1.5ml EP pipe, the centrifugal 2min of 14000rpm collects thalline.

(2) supernatant is outwelled, added 1ml PBS suspension thalline, washing.The centrifugal 2min of 14000rpm collects thalline and repeats this step once.

(3) thalline finally is dissolved in the 100 μ l TE solution.

(4) the EP pipe is put on the buoy, taken out rear being placed on rapidly on the rotation concussion instrument and shake 3min.

(5) rapidly as in-80 ℃ of refrigerators, place 30min.

(6) take out the rear boiling water boiling 10min that is placed on rapidly, be placed on rapidly on the rotation concussion instrument and shake 3min.

(7) after temperature is down to room temperature, the centrifugal 5min of 14000rpm gets honest and upright and thrifty 100 μ l, namely contains Yeast genome in the supernatant.

12.hF the mensuration of IX procoagulant activity:

(1) except CaCl ₂Solution is outside 37 ℃ of water-bath preheatings, and all the other reagent, sample all place frozen water.

(2) production standard curve (Fig. 7): the Quality Control blood plasma of normal blood coagulation is done 1/5,1/10,1/20,1/40/ with the diluent I, 1/80,1/160 doubling dilution, the hF IX that it is corresponding: C percentage activity is 200%, 100%, 50%, 25%, 12.5%, 6.25%.

(3) make up blood coagulation and measure system: APTT reagent, each concentration dilution Quality Control blood plasma, each 100 μ l of blood plasma of lacking the hF IX are mixed add in small test tube, place through steeping acid, in the autoclaved small test tube, hatch 10min for 37 ℃.

(4) add rapidly CaCl ₂Solution 100 μ l start stopwatch simultaneously, shake small test tube with 1-2 time/second frequency in water-bath, when observing when occurring solidifying, and immediately stand-by time and record.

(5) take different extent of dilution normal plasma hF IX: the C percentage is active in X, and corresponding setting time (second) is Y, makes linear regression equation according to statistical method, and equation is: Y=blogX+a namely gets typical curve.

(6) with sample with same diluted hF IX to the concentration of 5mgL, substitute 100% active normal plasma with this, measure after the same method setting time.

(7) each sample measurement is three times, bring the typical curve equation into and do statistical study, the various hF IX mutant of expressing with pichia spp SMD1168 of obtaining a result all have procoagulant activity (Figure 15), and relatively all there were significant differences (P＜0.05) for the expression supernatant of empty carrier.Wherein the activity of hF IX-V107A-R338A is up to 44.06%, and the hF IX of sudden change is not minimum, is 5.5%(Fig. 8).

Embodiment 2:

The application of hF IX pichia spp high reactivity mutant expression vector in producing humanclottingfactorⅨ's albumen comprises the following steps:

1. seed activation and cultivation

(1) recovery bacterial classification: will be kept at that the hFIX wild-type Pichia anomala expression bacterial classification about 1ml takes out from-80 ℃ of refrigerators in the cryopreservation tube of good seal, room temperature is slowly dissolved, and takes out 200ul and add 28 ℃ of 250rpm concussions of 200mL YPD liquid nutrient medium cultivation 24h in super clean bench.

(2) bacterial strain screening: sampling detects the OD600 value, observe the bacteria growing situation, the OD value all can be carried out bacterial screening in 2 ~ 6 scopes, the bacterium liquid of getting different extension rates is coated with bacterium, be applied to respectively YPD flat board (adding or do not add the G418 of 2000ugml), after 28 ℃ of thermostat containers are observed 72h, screen.

(3) amplification culture: the bacterium colony of mono-clonal growth in the picking YPD flat board, put into 10ml BMGY substratum, 28 ℃, 250rpm concuss are cultivated 24h to OD600 and are worth and kept sample for subsequent use at about 5 o'clock.The inoculation sample is to l0ml BMGY substratum, and with aseptic air-permeable envelope sealing, 24h is cultivated in 28 ℃ of 250rpm concussions.Judge the thalli growth situation according to thalline OD value and visual inspection thalline color, detect the OD600 value and take a sample in the clean platform of 2 ~ 6 wide-ultras that color is faint yellow the best, it is excessively old to cross dark explanation thalli growth, and it is not enough to cross the bright thalli growth density of elementary introduction; The sample 2ml that obtains is added in the 200ml BMGY substratum, and 24h is cultivated in 28 ℃ of 250rpm concussions; After cultivating 24h, get 20ml and add in the 2L BMGY substratum, the determining of 28 ℃ of fermentation optimal phs: pichia spp all can be grown in the scope of pH value 3.0 ~ 7.0, still when the fermentation expression foreign protein, according to the physico-chemical property of foreign protein, its expression amount is subjected to fermented liquid pH value to affect larger.General secretory protein is optimum value at pH value 5-6, expresses the high protein amount of wild-type hFIX for determining methanol induction, the selection optimal ph, and secure ph is each 200ml of BMGY substratum of 4.5,5.0,5.5,6.0.

Fermentation culture stage: get in the 200ml BMGY substratum that each 1ml of above-mentioned bacterium liquid adds four kinds of different pH values, 28 ℃, 225rpm are cultivated 30h, then change the BMMY nutrient solution over to and carry out the methanol induction expression.

The abduction delivering stage: above-mentioned zymophyte other low-temperature centrifugation of midnight (1500rpm) 10min is abandoned supernatant, get secure ph and be each 10ml of BMMY substratum of 4.5,5.0,5.5,6.0, the corresponding adding, blow open with suction pipe; Repeat to wash bacterium 3 times, then add respectively each 200mL of BMMY substratum of corresponding pH value, carry out methanol induction and express, 30 ℃, 225rpm concussion cultivation 72h.Every 6h sampling 1 time, the centrifuging and taking supernatant is used for SDS-PAGE and identifies that every 24h adds 1 time by final concentration 1% methyl alcohol, until 72h stops fermentation.Fermented liquid is taken out, and then room temperature centrifugal (12000rpm) 10min carries out SDS-PAGE with 4 samples.The result shows, after the hFIX methanol induction is expressed when pH5.5 the fermentation expression amount the highest.

2.50L tank fermentation:

1. calibration equipment: pH electrode, the dissolved oxygen electrode (in the time of 28 ℃, carrying out) of calibration fermentor tank, the traffic alignment of the line crawl pump of going forward side by side.

2. prepare 20L lower concentration basis salt culture medium and l0g tryptone, add the 50L fermentor tank, 121 ℃, 30min autoclaving substratum, fermentor tank and pipeline.

3. in fermentor tank after medium sterilization and the cooling, set temperature (28 ℃), rotating speed are that the parameter that (600rpm), gas pass into speed 1.0vvm, air mixer is 3.0.Regulate the pH value to 5.5 of basic salt culture medium with ammoniacal liquor.40ml vitamin H stock solution is added in aseptic technique.

4. mouth is inoculated at the fermentor tank top and opened, with alcohol swab burning sterilization, then pour rapidly above-mentioned seed liquor into fermentor tank, close immediately the inoculation mouth, extinguish the alcohol swab of burning around covering.The beginning fermentor cultivation, this is that glycerine is cultivated the amplification thalline for the fs, the setting of fermentor tank parameter is respectively stirring velocity 600rpm, tank internal pressure 10psi, 28 ℃ of temperature are kept DO value (dissolved oxygen) more than 20%, pass in case of necessity pure oxygen.

5. after the fermentation beginning, can produce a large amount of bubbles in the tank, add defoamer, bubble collapse stops to add defoamer immediately.OD600 and wet cell weight are surveyed in every 6h sampling of this stage 1 time, analyze the Yeast Growth state, and sampling OD600 is 0.089 behind the upper tank, and weight in wet base is 5.7g/L, and naked eyes and Microscopic observation bacterium liquid are got rid of living contaminants, and stayed supernatant.

7. behind about 6h, the DO value progressively rises; Weight in wet base is 15.3gL behind about 12h, and the DO value rises to 800rpm 50% ~ 60% with stirring velocity 600rpm; Weight in wet base is 62.9g/L behind about 18h, finds that DO about 80%, illustrates that glycerine is in consumption state in the substratum; About 20h left and right sides weight in wet base is 172g/L, finds that the DO value 20% ~ 30%, illustrates that glycerine is in not enough state in the substratum, determines to lead to low stream pure oxygen, and the DO value is gone up to about 40 ~ 50%; About about 24h, the thalline weight in wet base reaches 180gL, and the DO value increases to 80 ~ 100% gradually, and approach exhaustion of glycerine is described in the substratum, changes over to and replenishes the glycerine stage with the further raising cell density stage.

8. will contain 1.2%PTM1(v/v) 50% glycerine add with the stream rate of acceleration of 15ml/h/L by peristaltic pump, add in the glycerine process, the DO value can not be lower than 30%, can guarantee oxygen supply by improving mixing speed and logical pure oxygen.

9. about 30h, the thalline weight in wet base reaches 230 ~ 250g/L, stops to add glycerine, and the DO value goes back up to rapidly 100%, illustrates that glycerine exhausts, continues to keep " glycerine is hungry " state of 30min, changes the methanol induction expression phase over to.

3. the expression of methanol induction hFIX

1. after methanol induction begins, every 6h sampling 1 time, survey OD600 and wet cell weight and the electrophoresis detection protein content that keeps sample and change.Monitor simultaneously DO value and fermented liquid temperature and judge that methyl alcohol is whether excessive and (stop mending the variation of methyl alcohol observation DO value, if after stopping mending methyl alcohol, the DO value in 1min ascensional range greater than 10%, illustrate that carbon source is limited, otherwise illustrate that methyl alcohol is excessive), if carbon source is limited, then accelerate to mend the speed of methyl alcohol, if the excessive speed of mending methyl alcohol that then should slow down of methyl alcohol is until suitable speed.

2. will contain 1.2%PTM1(v/v) methyl alcohol join abduction delivering in the fermentor tank with the initial rate of 3 ~ 4mL/h/L, DO maintains between 20 ~ 40%, so that yeast adapts to the environment take methyl alcohol as sole carbon source.During this period, the DO value becomes unstable, it is larger to fluctuate, and leads to low stream oxygen, behind the environment of yeast adaptation take methyl alcohol as sole carbon source, it is stable that the DO value namely keeps, continue to keep this low rate and increase progressively and add methyl alcohol, until speed reaches 10 ~ 12mL/h/L, utilize the double optimization of oxygen-supply quantity and methyl alcohol additional amount to keep DO stable, this process need l0h, the thalline weight in wet base reaches 320g/L.

3. the constant rate of adding methyl alcohol is 10 ~ 12mL/h/L, and DO keeps 20h between 30 ~ 40%.The speed of adding methyl alcohol is increased to 16～18mL/h/L, and DO keeps 20h between 20 ~ 40%.During this period, add the ammonium sulfate 500mL of 30% saturation ratio, to replenish the nitrogenous source in the tank, Effective Raise expressing quantity.

5. behind the methanol induction 50h, speed is descended step by step by 16 ~ 18mL/h/L, rely on the optimization of oxygen-supply quantity to keep DO between 20 ~ 40%, as methanol induction 60h, methyl alcohol is down to the initial rate of 3 ~ 4mL/h/L, detects the thalline weight in wet base and reaches 360g/L.

6. with the initial rate abduction delivering of methyl alcohol 3 ~ 4mL/h/L to 72h, detect the thalline weight in wet base oneself near 438g/L, finish fermentation.

4. optimization induction time, and under the processing condition of having optimized, stablize 3 batches of pilot scale fermentations.The result determines that the suitableeest induction time is 72h; 3 batches of pilot scale fermentations, thalline A600 average reaches (427.23 ± 32.16), and thalline weight in wet base average reaches (438.33 ± 9.07) g/l, and hFIX expression amount average is (558.00 ± 27.57) mg/L.13h after the fermentation beginning, the thalline weight in wet base slowly increases, and is in the adaptive phase; Afterwards, thalline begins Fast Growth and enters exponential phase of growth, when fermenting 24h, fermented liquid begins to detect blood coagulation activity, along with the prolongation of fermentation time, blood coagulation activity strengthens, behind the 48h, the hFIX protein expression begins to enter plateau, blood coagulation activity increasess slowly, and to 72h, it is maximum that blood coagulation activity reaches, stop fermentation, the results culture supernatant.The logarithmic phase of thalline and stationary phase hFIX albumen great expression, behind the 100h, pichia spp enters the paracme, protein expression stops substantially, the thalline weight in wet base descends obviously, protein content is substantially constant.Stop to 124h fermentation, the lowry method records that protein content reaches 168gL in the fermented liquid supernatant.

5. the separation and purification of pichia spp wild-type hFIX secreting, expressing engineering bacteria pilot scale fermentation product

The 40L fermented liquid is removed thalline through Plate Filtration, collect the about 37L of supernatant liquor.Supernatant liquor is processed by the tubular fibre column chromatography again, with a small amount of thalline that may sneak in the thorough removal fermented supernatant fluid and the foreign protein of macromolecule, the hollow fiber column aperture of selecting is 200kDa, obtains after treatment about 35L clarification fermented supernatant fluid.

The anion column chromatography: upper column volume is 5L, with the 6L sample liquid with the Tris-HCl damping fluid (20mM) as the balance liquid dilute sample to 18L, the pH value is transferred to 7.5, the liquid that penetrates that keeps each loading, loading is 3 times repeatedly, complete with last loading, the loading flow velocity transfers to 200mL/min, balance liquid is carried out gradient with the Tris-HC1 damping fluid (20mM) that contains 1M NaCI to be mixed, 0 ~ 1M NaCI linear gradient elution, flow velocity 500mL/min collects sample, use the freeze drier freeze-drying, make lyophilized powder 61.2g.Utilize Reversed-phase liquid chromatography to identify that product purity reaches more than 80%.

6. fermented liquid and lyophilized powder molecular weight of albumen are identified

Get the centrifugal 10min of 10ml abduction delivering fermented liquid 5000rpm/min, get supernatant liquor and carry out 15%SDS-PAGE analysis confirmation hFIX molecular weight.0.05g the hFIX lyophilized powder is dissolved in the 100ml deionized water, uses the vibration of vibration vortex mixer to mix 10min, gets this solution and carries out the 15%SDS-PAGE analysis, confirms molecular weight product between 40 ~ 57kDa, 55kDa conforms to the hFIX molecular weight of albumen.

7. the fermented liquid blood coagulation activity detects

Get the blood coagulation activity that sample 100 μ l after the separation and purification detect the fermentation supernatant, recording blood coagulation activity is 26.21.

SEQUENCE LISTING

＜110〉Wuhan University Of Technology

＜120〉humanclottingfactorⅨ's mutant yeast expression vector and construction process and application

＜130〉humanclottingfactorⅨ's mutant yeast expression vector and construction process and application

<160> 23

<170> Patent In version 3.5

<210> 1

<211> 30

<212> DNA

＜213〉artificial sequence

<400> 1

ggggatccta gcaaaggtta tgcagcgcgt 30

<210> 2

<211> 30

<212> DNA

＜213〉artificial sequence

<400> 2

ggcttaagtt caggcacctt acttcatccc 30

<210> 3

<211> 29

<212> DNA

＜213〉artificial sequence

<400> 3

gggcggccgc attagttagt gagaggccc 29

<210> 4

<211> 36

<212> DNA

＜213〉artificial sequence

<400> 4

ggctcgagaa agaggtataa ttcaggtaaa ttgg 34

<210> 5

<211> 20

<212> DNA

＜213〉artificial sequence

<400> 5

caaggtggtt tgctcctgta 20

<210> 6

<211> 22

<212> DNA

＜213〉artificial sequence

<400> 6

tagctgcatt gtagttgtgg tg 22

<210> 7

<211> 21

<212> DNA

＜213〉artificial sequence

<400> 7

gactggttcc aattgacaag c 21

<210> 8

<211> 21

<212> DNA

＜213〉artificial sequence

<400> 8

gcaaatggca ttctgacatc c 21

<210> 9

<211> 33

<212> DNA

＜213〉artificial sequence

<400> 9

aactgtgaat tagatgctac atgtaacatt aag 33

<210> 10

<211> 33

<212> DNA

＜213〉artificial sequence

<400> 10

cttaatgtta catgtagcat ctaattcaca gtt 33

<210> 11

<211> 33

<212> DNA

＜213〉artificial sequence

<400> 11

agtgctgata acaaggctgt ttgctcctgt act 33

<210> 12

<211> 33

<212> DNA

＜213〉artificial sequence

<400> 12

agtacaggag caaacagcct tgttatcagc act 　　　33

<210> 13

<211> 33

<212> DNA

＜213〉artificial sequence

<400> 13

cgagccacat gtcttgcttc tacaaagttc acc 　　　33

<210> 14

<211> 33

<212> DNA

＜213〉artificial sequence

<400> 14

ggtgaacttt gtagaagcaa gacatgtggc tcg 　　33

<210> 15

<211> 34

<212> DNA

＜213〉artificial sequence

<400> 15

gggaattctataattcaggtaaattggaagagtt 34

<210> 16

<211> 415

<212> PRT

＜213〉artificial sequence

<400> 16

Tyr Asn Ser Gly Lys Leu Glu Glu Phe Val Gln Gly Asn Leu Glu Arg

1 5 10 15

Glu Cys Met Glu Glu Lys Cys Ser Phe Glu Glu Ala Arg Glu Val Phe

20 25 30

Glu Asn Thr Glu Arg Thr Thr Glu Phe Trp Lys Gln Tyr Val Asp Gly

35 40 45

Asp Gln Cys Glu Ser Asn Pro Cys Leu Asn Gly Gly Ser Cys Lys Asp

50 55 60

Asp Ile Asn Ser Tyr Glu Cys Trp Cys Pro Phe Gly Phe Glu Gly Lys

65 70 75 80

Asn Cys Glu Leu Asp Val Thr Cys Asn Ile Lys Asn Gly Arg Cys Glu

85 90 95

Gln Phe Cys Lys Asn Ser Ala Asp Asn Lys Val Val Cys Ser Cys Thr

100 105 110

Glu Gly Tyr Arg Leu Ala Glu Asn Gln Lys Ser Cys Glu Pro Ala Val

115 120 125

Pro Phe Pro Cys Gly Arg Val Ser Val Ser Gln Thr Ser Lys Leu Thr

130 135 140

Arg Ala Glu Thr Val Phe Pro Asp Val Asp Tyr Val Asn Ser Thr Glu

145 150 155 160

Ala Glu Thr Ile Leu Asp Asn Ile Thr Gln Ser Thr Gln Ser Phe Asn

165 170 175

Asp Phe Thr Arg Val Val Gly Gly Glu Asp Ala Lys Pro Gly Gln Phe

180 185 190

Pro Trp Gln Val Val Leu Asn Gly Lys Val Asp Ala Phe Cys Gly Gly

195 200 205

Ser Ile Val Asn Glu Lys Trp Ile Val Thr Ala Ala His Cys Val Glu

210 215 220

Thr Gly Val Lys Ile Thr Val Val Ala Gly Glu His Asn Ile Glu Glu

225 230 235 240

Thr Glu His Thr Glu Gln Lys Arg Asn Val Ile Arg Ile Ile Pro His

245 250 255

His Asn Tyr Asn Ala Ala Ile Asn Lys Tyr Asn His Asp Ile Ala Leu

260 265 270

Leu Glu Leu Asp Glu Pro Leu Val Leu Asn Ser Tyr Val Thr Pro Ile

275 280 285

Cys Ile Ala Asp Lys Glu Tyr Thr Asn Ile Phe Leu Lys Phe Gly Ser

290 295 300

Gly Tyr Val Ser Gly Trp Gly Arg Val Phe His Lys Gly Arg Ser Ala

305 310 315 320

Leu Val Leu Gln Tyr Leu Arg Val Pro Leu Val Asp Arg Ala Thr Cys

325 330 335

Leu Ala Ser Thr Lys Phe Thr Ile Tyr Asn Asn Met Phe Cys Ala Gly

340 345 350

Phe His Glu Gly Gly Arg Asp Ser Cys Gln Gly Asp Ser Gly Gly Pro

355 360 365

His Val Thr Glu Val Glu Gly Thr Ser Phe Leu Thr Gly Ile Ile Ser

370 375 380

Trp Gly Glu Glu Cys Ala Met Lys Gly Lys Tyr Gly Ile Tyr Thr Lys

385 390 395 400

Val Ser Arg Tyr Val Asn Trp Ile Lys Glu Lys Thr Lys Leu Thr

405 410 415

<210> 17

<211> 415

<212> PRT

＜213〉artificial sequence

<400> 17

Tyr Asn Ser Gly Lys Leu Glu Glu Phe Val Gln Gly Asn Leu Glu Arg

1 5 10 15

Glu Cys Met Glu Glu Lys Cys Ser Phe Glu Glu Ala Arg Glu Val Phe

20 25 30

Glu Asn Thr Glu Arg Thr Thr Glu Phe Trp Lys Gln Tyr Val Asp Gly

35 40 45

Asp Gln Cys Glu Ser Asn Pro Cys Leu Asn Gly Gly Ser Cys Lys Asp

50 55 60

Asp Ile Asn Ser Tyr Glu Cys Trp Cys Pro Phe Gly Phe Glu Gly Lys

65 70 75 80

Asn Cys Glu Leu Asp Ala Thr Cys Asn Ile Lys Asn Gly Arg Cys Glu

85 90 95

Gln Phe Cys Lys Asn Ser Ala Asp Asn Lys Val Val Cys Ser Cys Thr

100 105 110

Glu Gly Tyr Arg Leu Ala Glu Asn Gln Lys Ser Cys Glu Pro Ala Val

115 120 125

Pro Phe Pro Cys Gly Arg Val Ser Val Ser Gln Thr Ser Lys Leu Thr

130 135 140

Arg Ala Glu Thr Val Phe Pro Asp Val Asp Tyr Val Asn Ser Thr Glu

145 150 155 160

Ala Glu Thr Ile Leu Asp Asn Ile Thr Gln Ser Thr Gln Ser Phe Asn

165 170 175

Asp Phe Thr Arg Val Val Gly Gly Glu Asp Ala Lys Pro Gly Gln Phe

180 185 190

Pro Trp Gln Val Val Leu Asn Gly Lys Val Asp Ala Phe Cys Gly Gly

195 200 205

Ser Ile Val Asn Glu Lys Trp Ile Val Thr Ala Ala His Cys Val Glu

210 215 220

Thr Gly Val Lys Ile Thr Val Val Ala Gly Glu His Asn Ile Glu Glu

225 230 235 240

Thr Glu His Thr Glu Gln Lys Arg Asn Val Ile Arg Ile Ile Pro His

245 250 255

His Asn Tyr Asn Ala Ala Ile Asn Lys Tyr Asn His Asp Ile Ala Leu

260 265 270

Leu Glu Leu Asp Glu Pro Leu Val Leu Asn Ser Tyr Val Thr Pro Ile

275 280 285

Cys Ile Ala Asp Lys Glu Tyr Thr Asn Ile Phe Leu Lys Phe Gly Ser

290 295 300

Gly Tyr Val Ser Gly Trp Gly Arg Val Phe His Lys Gly Arg Ser Ala

305 310 315 320

Leu Val Leu Gln Tyr Leu Arg Val Pro Leu Val Asp Arg Ala Thr Cys

325 330 335

Leu Ala Ser Thr Lys Phe Thr Ile Tyr Asn Asn Met Phe Cys Ala Gly

340 345 350

Phe His Glu Gly Gly Arg Asp Ser Cys Gln Gly Asp Ser Gly Gly Pro

355 360 365

His Val Thr Glu Val Glu Gly Thr Ser Phe Leu Thr Gly Ile Ile Ser

370 375 380

Trp Gly Glu Glu Cys Ala Met Lys Gly Lys Tyr Gly Ile Tyr Thr Lys

385 390 395 400

Val Ser Arg Tyr Val Asn Trp Ile Lys Glu Lys Thr Lys Leu Thr

405 410 415

<210> 18

<211> 415

<212> PRT

＜213〉artificial sequence

<400> 18

Tyr Asn Ser Gly Lys Leu Glu Glu Phe Val Gln Gly Asn Leu Glu Arg

1 5 10 15

Glu Cys Met Glu Glu Lys Cys Ser Phe Glu Glu Ala Arg Glu Val Phe

20 25 30

Glu Asn Thr Glu Arg Thr Thr Glu Phe Trp Lys Gln Tyr Val Asp Gly

35 40 45

Asp Gln Cys Glu Ser Asn Pro Cys Leu Asn Gly Gly Ser Cys Lys Asp

50 55 60

Asp Ile Asn Ser Tyr Glu Cys Trp Cys Pro Phe Gly Phe Glu Gly Lys

65 70 75 80

Asn Cys Glu Leu Asp Val Thr Cys Asn Ile Lys Asn Gly Arg Cys Glu

85 90 95

Gln Phe Cys Lys Asn Ser Ala Asp Asn Lys Ala Val Cys Ser Cys Thr

100 105 110

Glu Gly Tyr Arg Leu Ala Glu Asn Gln Lys Ser Cys Glu Pro Ala Val

115 120 125

Pro Phe Pro Cys Gly Arg Val Ser Val Ser Gln Thr Ser Lys Leu Thr

130 135 140

Arg Ala Glu Thr Val Phe Pro Asp Val Asp Tyr Val Asn Ser Thr Glu

145 150 155 160

Ala Glu Thr Ile Leu Asp Asn Ile Thr Gln Ser Thr Gln Ser Phe Asn

165 170 175

Asp Phe Thr Arg Val Val Gly Gly Glu Asp Ala Lys Pro Gly Gln Phe

180 185 190

Pro Trp Gln Val Val Leu Asn Gly Lys Val Asp Ala Phe Cys Gly Gly

195 200 205

Ser Ile Val Asn Glu Lys Trp Ile Val Thr Ala Ala His Cys Val Glu

210 215 220

Thr Gly Val Lys Ile Thr Val Val Ala Gly Glu His Asn Ile Glu Glu

225 230 235 240

Thr Glu His Thr Glu Gln Lys Arg Asn Val Ile Arg Ile Ile Pro His

245 250 255

His Asn Tyr Asn Ala Ala Ile Asn Lys Tyr Asn His Asp Ile Ala Leu

260 265 270

Leu Glu Leu Asp Glu Pro Leu Val Leu Asn Ser Tyr Val Thr Pro Ile

275 280 285

Cys Ile Ala Asp Lys Glu Tyr Thr Asn Ile Phe Leu Lys Phe Gly Ser

290 295 300

Gly Tyr Val Ser Gly Trp Gly Arg Val Phe His Lys Gly Arg Ser Ala

305 310 315 320

Leu Val Leu Gln Tyr Leu Arg Val Pro Leu Val Asp Arg Ala Thr Cys

325 330 335

Leu Ala Ser Thr Lys Phe Thr Ile Tyr Asn Asn Met Phe Cys Ala Gly

340 345 350

Phe His Glu Gly Gly Arg Asp Ser Cys Gln Gly Asp Ser Gly Gly Pro

355 360 365

His Val Thr Glu Val Glu Gly Thr Ser Phe Leu Thr Gly Ile Ile Ser

370 375 380

Trp Gly Glu Glu Cys Ala Met Lys Gly Lys Tyr Gly Ile Tyr Thr Lys

385 390 395 400

Val Ser Arg Tyr Val Asn Trp Ile Lys Glu Lys Thr Lys Leu Thr

405 410 415

<210> 19

<211> 415

<212> PRT

＜213〉artificial sequence

<400> 19

Tyr Asn Ser Gly Lys Leu Glu Glu Phe Val Gln Gly Asn Leu Glu Arg

1 5 10 15

Glu Cys Met Glu Glu Lys Cys Ser Phe Glu Glu Ala Arg Glu Val Phe

20 25 30

Glu Asn Thr Glu Arg Thr Thr Glu Phe Trp Lys Gln Tyr Val Asp Gly

35 40 45

Asp Gln Cys Glu Ser Asn Pro Cys Leu Asn Gly Gly Ser Cys Lys Asp

50 55 60

Asp Ile Asn Ser Tyr Glu Cys Trp Cys Pro Phe Gly Phe Glu Gly Lys

65 70 75 80

Asn Cys Glu Leu Asp Ala Thr Cys Asn Ile Lys Asn Gly Arg Cys Glu

85 90 95

Gln Phe Cys Lys Asn Ser Ala Asp Asn Lys Ala Val Cys Ser Cys Thr

100 105 110

Glu Gly Tyr Arg Leu Ala Glu Asn Gln Lys Ser Cys Glu Pro Ala Val

115 120 125

Pro Phe Pro Cys Gly Arg Val Ser Val Ser Gln Thr Ser Lys Leu Thr

130 135 140

Arg Ala Glu Thr Val Phe Pro Asp Val Asp Tyr Val Asn Ser Thr Glu

145 150 155 160

Ala Glu Thr Ile Leu Asp Asn Ile Thr Gln Ser Thr Gln Ser Phe Asn

165 170 175

Asp Phe Thr Arg Val Val Gly Gly Glu Asp Ala Lys Pro Gly Gln Phe

180 185 190

Pro Trp Gln Val Val Leu Asn Gly Lys Val Asp Ala Phe Cys Gly Gly

195 200 205

Ser Ile Val Asn Glu Lys Trp Ile Val Thr Ala Ala His Cys Val Glu

210 215 220

Thr Gly Val Lys Ile Thr Val Val Ala Gly Glu His Asn Ile Glu Glu

225 230 235 240

Thr Glu His Thr Glu Gln Lys Arg Asn Val Ile Arg Ile Ile Pro His

245 250 255

His Asn Tyr Asn Ala Ala Ile Asn Lys Tyr Asn His Asp Ile Ala Leu

260 265 270

Leu Glu Leu Asp Glu Pro Leu Val Leu Asn Ser Tyr Val Thr Pro Ile

275 280 285

Cys Ile Ala Asp Lys Glu Tyr Thr Asn Ile Phe Leu Lys Phe Gly Ser

290 295 300

Gly Tyr Val Ser Gly Trp Gly Arg Val Phe His Lys Gly Arg Ser Ala

305 310 315 320

Leu Val Leu Gln Tyr Leu Arg Val Pro Leu Val Asp Arg Ala Thr Cys

325 330 335

Leu Ala Ser Thr Lys Phe Thr Ile Tyr Asn Asn Met Phe Cys Ala Gly

340 345 350

Phe His Glu Gly Gly Arg Asp Ser Cys Gln Gly Asp Ser Gly Gly Pro

355 360 365

His Val Thr Glu Val Glu Gly Thr Ser Phe Leu Thr Gly Ile Ile Ser

370 375 380

Trp Gly Glu Glu Cys Ala Met Lys Gly Lys Tyr Gly Ile Tyr Thr Lys

385 390 395 400

Val Ser Arg Tyr Val Asn Trp Ile Lys Glu Lys Thr Lys Leu Thr

405 410 415

<210> 20

<211> 4847

<212> DNA

＜213〉artificial sequence

<400> 20

agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag 60

gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt 120

tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc 180

agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta 240

acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta 300

tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg 360

agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct 420

gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg 480

ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcggca taccgtttgt 540

cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct 600

ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct 660

ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact 720

gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat 780

atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt 840

actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga 900

caacttgaga agatcaaaaa acaactaatt attcgaaacg atgagatttc cttcaatttt 960

tactgctgtt ttattcgcag catcctccgc attagctgct ccagtcaaca ctacaacaga 1020

agatgaaacg gcacaaattc cggctgaagc tgtcatcggt tactcagatt tagaagggga 1080

tttcgatgtt gctgttttgc cattttccaa cagcacaaat aacgggttat tgtttataaa 1140

tactactatt gccagcattg ctgctaaaga agaaggggta tctctcgaga aagaggtata 1200

attcaggtaa attggaagag tttgttcaag ggaaccttga gagagaatgt atggaagaaa 1260

agtgtagttt tgaagaagca cgagaagttt ttgaaaacac tgaaagaaca actgaatttt 1320

ggaagcagta tgttgatgga gatcagtgtg agtccaatcc atgtttaaat ggcggcagtt 1380

gcaaggatga cattaattcc tatgaatgtt ggtgtccctt tggatttgaa ggaaagaact 1440

gtgaattaga tgtaacatgt aacattaaga atggcagatg cgagcagttt tgtaaaaata 1500

gtgctgataa caaggtggtt tgctcctgta ctgagggata tcgacttgca gaaaaccaga 1560

agtcctgtga accagcagtg ccatttccat gtggaagagt ttctgtttca caaacttcta 1620

agctcacccg tgctgagact gtttttcctg atgtggacta tgtaaattct actgaagctg 1680

aaaccatttt ggataacatc actcaaagca cccaatcatt taatgacttc actcgggttg 1740

ttggtggaga agatgccaaa ccaggtcaat tcccttggca ggttgttttg aatggtaaag 1800

ttgatgcatt ctgtggaggc tctatcgtta atgaaaaatg gattgtaact gctgcccact 1860

gtgttgaaac tggtgttaaa attacagttg tcgcaggtga acataatatt gaggagacag 1920

aacatacaga gcaaaagcga aatgtgattc gaattattcc tcaccacaac tacaatgcag 1980

ctattaataa gtacaaccat gacattgccc ttctggaact ggacgaaccc ttagtgctaa 2040

acagctacgt tacacctatt tgcattgctg acaaggaata cacgaacatc ttcctcaaat 2100

ttggatctgg ctatgtaagt ggctggggaa gagtcttcca caaagggaga tcagctttag 2160

ttcttcagta ccttagagtt ccacttgttg accgagccac atgtcttgct tctacaaagt 2220

tcaccatcta taacaacatg ttctgtgctg gcttccatga aggaggtaga gattcatgtc 2280

aaggagatag tgggggaccc catgttactg aagtggaagg gaccagtttc ttaactggaa 2340

ttattagctg gggtgaagag tgtgcaatga aaggcaaata tggaatatat accaaggtat 2400

cccggtatgt caactggatt aaggaaaaaa caaagctcac ttaatgaaag atggatttcc 2460

aaggttaatt cattggaatt gaaaattaac agggcctctc actaactaat gcggccgcca 2520

gctttctaga acaaaaactc atctcagaag aggatctgaa tagcgccgtc gaccatcatc 2580

atcatcatca ttgagtttgt agccttagac atgactgttc ctcagttcaa gttgggcact 2640

tacgagaaga ccggtcttgc tagattctaa tcaagaggat gtcagaatgc catttgcctg 2700

agagatgcag gcttcatttt tgatactttt ttatttgtaa cctatatagt ataggatttt 2760

ttttgtcatt ttgtttcttc tcgtacgagc ttgctcctga tcagcctatc tcgcagctga 2820

tgaatatctt gtggtagggg tttgggaaaa tcattcgagt ttgatgtttt tcttggtatt 2880

tcccactcct cttcagagta cagaagatta agtgagacct tcgtttgtgc ggatccccca 2940

cacaccatag cttcaaaatg tttctactcc ttttttactc ttccagattt tctcggactc 3000

cgcgcatcgc cgtaccactt caaaacaccc aagcacagca tactaaattt tccctctttc 3060

ttcctctagg gtgtcgttaa ttacccgtac taaaggtttg gaaaagaaaa aagagaccgc 3120

ctcgtttctt tttcttcgtc gaaaaaggca ataaaaattt ttatcacgtt tctttttctt 3180

gaaatttttt tttttagttt ttttctcttt cagtgacctc cattgatatt taagttaata 3240

aacggtcttc aatttctcaa gtttcagttt catttttctt gttctattac aacttttttt 3300

acttcttgtt cattagaaag aaagcatagc aatctaatct aaggggcggt gttgacaatt 3360

aatcatcggc atagtatatc ggcatagtat aatacgacaa ggtgaggaac taaaccatgg 3420

ccaagttgac cagtgccgtt ccggtgctca ccgcgcgcga cgtcgccgga gcggtcgagt 3480

tctggaccga ccggctcggg ttctcccggg acttcgtgga ggacgacttc gccggtgtgg 3540

tccgggacga cgtgaccctg ttcatcagcg cggtccagga ccaggtggtg ccggacaaca 3600

ccctggcctg ggtgtgggtg cgcggcctgg acgagctgta cgccgagtgg tcggaggtcg 3660

tgtccacgaa cttccgggac gcctccgggc cggccatgac cgagatcggc gagcagccgt 3720

gggggcggga gttcgccctg cgcgacccgg ccggcaactg cgtgcacttc gtggccgagg 3780

agcaggactg acacgtccga cggcggccca cgggtcccag gcctcggaga tccgtccccc 3840

ttttcctttg tcgatatcat gtaattagtt atgtcacgct tacattcacg ccctcccccc 3900

acatccgctc taaccgaaaa ggaaggagtt agacaacctg aagtctaggt ccctatttat 3960

ttttttatag ttatgttagt attaagaacg ttatttatat ttcaaatttt tctttttttt 4020

ctgtacagac gcgtgtacgc atgtaacatt atactgaaaa ccttgcttga gaaggttttg 4080

ggacgctcga aggctttaat ttgcaagctg gagaccaaca tgtgagcaaa aggccagcaa 4140

aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct 4200

gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa 4260

agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg 4320

cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcaatgctca 4380

cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa 4440

ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg 4500

gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg 4560

tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg 4620

acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc 4680

tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag 4740

attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac 4800

gctcagtgga acgaaaactc acgttaaggg attttggtca tgagatc 4847

<210> 21

<211> 4847

<212> DNA

＜213〉artificial sequence

<400> 21

agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag 60

gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt 120

tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc 180

agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta 240

acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta 300

tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg 360

agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct 420

ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcggca taccgtttgt 540

cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct 600

ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct 660

ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact 720

gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat 780

atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt 840

actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga 900

caacttgaga agatcaaaaa acaactaatt attcgaaacg atgagatttc cttcaatttt 960

tactgctgtt ttattcgcag catcctccgc attagctgct ccagtcaaca ctacaacaga 1020

agatgaaacg gcacaaattc cggctgaagc tgtcatcggt tactcagatt tagaagggga 1080

tttcgatgtt gctgttttgc cattttccaa cagcacaaat aacgggttat tgtttataaa 1140

tactactatt gccagcattg ctgctaaaga agaaggggta tctctcgaga aagaggtata 1200

attcaggtaa attggaagag tttgttcaag ggaaccttga gagagaatgt atggaagaaa 1260

agtgtagttt tgaagaagca cgagaagttt ttgaaaacac tgaaagaaca actgaatttt 1320

ggaagcagta tgttgatgga gatcagtgtg agtccaatcc atgtttaaat ggcggcagtt 1380

gcaaggatga cattaattcc tatgaatgtt ggtgtccctt tggatttgaa ggaaagaact 1440

gtgaattaga tgctacatgt aacattaaga atggcagatg cgagcagttt tgtaaaaata 1500

gtgctgataa caaggtggtt tgctcctgta ctgagggata tcgacttgca gaaaaccaga 1560

agtcctgtga accagcagtg ccatttccat gtggaagagt ttctgtttca caaacttcta 1620

agctcacccg tgctgagact gtttttcctg atgtggacta tgtaaattct actgaagctg 1680

aaaccatttt ggataacatc actcaaagca cccaatcatt taatgacttc actcgggttg 1740

ttggtggaga agatgccaaa ccaggtcaat tcccttggca ggttgttttg aatggtaaag 1800

ttgatgcatt ctgtggaggc tctatcgtta atgaaaaatg gattgtaact gctgcccact 1860

gtgttgaaac tggtgttaaa attacagttg tcgcaggtga acataatatt gaggagacag 1920

aacatacaga gcaaaagcga aatgtgattc gaattattcc tcaccacaac tacaatgcag 1980

ctattaataa gtacaaccat gacattgccc ttctggaact ggacgaaccc ttagtgctaa 2040

acagctacgt tacacctatt tgcattgctg acaaggaata cacgaacatc ttcctcaaat 2100

ttggatctgg ctatgtaagt ggctggggaa gagtcttcca caaagggaga tcagctttag 2160

ttcttcagta ccttagagtt ccacttgttg accgagccac atgtcttgct tctacaaagt 2220

tcaccatcta taacaacatg ttctgtgctg gcttccatga aggaggtaga gattcatgtc 2280

aaggagatag tgggggaccc catgttactg aagtggaagg gaccagtttc ttaactggaa 2340

ttattagctg gggtgaagag tgtgcaatga aaggcaaata tggaatatat accaaggtat 2400

cccggtatgt caactggatt aaggaaaaaa caaagctcac ttaatgaaag atggatttcc 2460

aaggttaatt cattggaatt gaaaattaac agggcctctc actaactaat gcggccgcca 2520

gctttctaga acaaaaactc atctcagaag aggatctgaa tagcgccgtc gaccatcatc 2580

atcatcatca ttgagtttgt agccttagac atgactgttc ctcagttcaa gttgggcact 2640

tacgagaaga ccggtcttgc tagattctaa tcaagaggat gtcagaatgc catttgcctg 2700

agagatgcag gcttcatttt tgatactttt ttatttgtaa cctatatagt ataggatttt 2760

ttttgtcatt ttgtttcttc tcgtacgagc ttgctcctga tcagcctatc tcgcagctga 2820

tgaatatctt gtggtagggg tttgggaaaa tcattcgagt ttgatgtttt tcttggtatt 2880

tcccactcct cttcagagta cagaagatta agtgagacct tcgtttgtgc ggatccccca 2940

cacaccatag cttcaaaatg tttctactcc ttttttactc ttccagattt tctcggactc 3000

cgcgcatcgc cgtaccactt caaaacaccc aagcacagca tactaaattt tccctctttc 3060

ttcctctagg gtgtcgttaa ttacccgtac taaaggtttg gaaaagaaaa aagagaccgc 3120

ctcgtttctt tttcttcgtc gaaaaaggca ataaaaattt ttatcacgtt tctttttctt 3180

gaaatttttt tttttagttt ttttctcttt cagtgacctc cattgatatt taagttaata 3240

aacggtcttc aatttctcaa gtttcagttt catttttctt gttctattac aacttttttt 3300

acttcttgtt cattagaaag aaagcatagc aatctaatct aaggggcggt gttgacaatt 3360

aatcatcggc atagtatatc ggcatagtat aatacgacaa ggtgaggaac taaaccatgg 3420

ccaagttgac cagtgccgtt ccggtgctca ccgcgcgcga cgtcgccgga gcggtcgagt 3480

tctggaccga ccggctcggg ttctcccggg acttcgtgga ggacgacttc gccggtgtgg 3540

tccgggacga cgtgaccctg ttcatcagcg cggtccagga ccaggtggtg ccggacaaca 3600

ccctggcctg ggtgtgggtg cgcggcctgg acgagctgta cgccgagtgg tcggaggtcg 3660

tgtccacgaa cttccgggac gcctccgggc cggccatgac cgagatcggc gagcagccgt 3720

gggggcggga gttcgccctg cgcgacccgg ccggcaactg cgtgcacttc gtggccgagg 3780

agcaggactg acacgtccga cggcggccca cgggtcccag gcctcggaga tccgtccccc 3840

ttttcctttg tcgatatcat gtaattagtt atgtcacgct tacattcacg ccctcccccc 3900

acatccgctc taaccgaaaa ggaaggagtt agacaacctg aagtctaggt ccctatttat 3960

ttttttatag ttatgttagt attaagaacg ttatttatat ttcaaatttt tctttttttt 4020

ctgtacagac gcgtgtacgc atgtaacatt atactgaaaa ccttgcttga gaaggttttg 4080

ggacgctcga aggctttaat ttgcaagctg gagaccaaca tgtgagcaaa aggccagcaa 4140

aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct 4200

gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa 4260

agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg 4320

cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcaatgctca 4380

cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa 4440

ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg 4500

gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg 4560

tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg 4620

acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc 4680

tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag 4740

attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac 4800

gctcagtgga acgaaaactc acgttaaggg attttggtca tgagatc 4847

<210> 22

<211> 4847

<212> DNA

＜213〉artificial sequence

<400> 22

agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag 60

gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt 120

tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc 180

agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta 240

acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta 300

tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg 360

agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct 420

gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg 480

ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcggca taccgtttgt 540

cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct 600

ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct 660

ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact 720

gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat 780

atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt 840

actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga 900

caacttgaga agatcaaaaa acaactaatt attcgaaacg atgagatttc cttcaatttt 960

tactgctgtt ttattcgcag catcctccgc attagctgct ccagtcaaca ctacaacaga 1020

agatgaaacg gcacaaattc cggctgaagc tgtcatcggt tactcagatt tagaagggga 1080

tttcgatgtt gctgttttgc cattttccaa cagcacaaat aacgggttat tgtttataaa 1140

tactactatt gccagcattg ctgctaaaga agaaggggta tctctcgaga aagaggtata 1200

attcaggtaa attggaagag tttgttcaag ggaaccttga gagagaatgt atggaagaaa 1260

agtgtagttt tgaagaagca cgagaagttt ttgaaaacac tgaaagaaca actgaatttt 1320

ggaagcagta tgttgatgga gatcagtgtg agtccaatcc atgtttaaat ggcggcagtt 1380

gcaaggatga cattaattcc tatgaatgtt ggtgtccctt tggatttgaa ggaaagaact 1440

gtgaattaga tgtaacatgt aacattaaga atggcagatg cgagcagttt tgtaaaaata 1500

gtgctgataa caaggctgtt tgctcctgta ctgagggata tcgacttgca gaaaaccaga 1560

agtcctgtga accagcagtg ccatttccat gtggaagagt ttctgtttca caaacttcta 1620

agctcacccg tgctgagact gtttttcctg atgtggacta tgtaaattct actgaagctg 1680

aaaccatttt ggataacatc actcaaagca cccaatcatt taatgacttc actcgggttg 1740

ttggtggaga agatgccaaa ccaggtcaat tcccttggca ggttgttttg aatggtaaag 1800

ttgatgcatt ctgtggaggc tctatcgtta atgaaaaatg gattgtaact gctgcccact 1860

gtgttgaaac tggtgttaaa attacagttg tcgcaggtga acataatatt gaggagacag 1920

aacatacaga gcaaaagcga aatgtgattc gaattattcc tcaccacaac tacaatgcag 1980

ctattaataa gtacaaccat gacattgccc ttctggaact ggacgaaccc ttagtgctaa 2040

acagctacgt tacacctatt tgcattgctg acaaggaata cacgaacatc ttcctcaaat 2100

ttggatctgg ctatgtaagt ggctggggaa gagtcttcca caaagggaga tcagctttag 2160

ttcttcagta ccttagagtt ccacttgttg accgagccac atgtcttgct tctacaaagt 2220

tcaccatcta taacaacatg ttctgtgctg gcttccatga aggaggtaga gattcatgtc 2280

aaggagatag tgggggaccc catgttactg aagtggaagg gaccagtttc ttaactggaa 2340

ttattagctg gggtgaagag tgtgcaatga aaggcaaata tggaatatat accaaggtat 2400

cccggtatgt caactggatt aaggaaaaaa caaagctcac ttaatgaaag atggatttcc 2460

aaggttaatt cattggaatt gaaaattaac agggcctctc actaactaat gcggccgcca 2520

gctttctaga acaaaaactc atctcagaag aggatctgaa tagcgccgtc gaccatcatc 2580

atcatcatca ttgagtttgt agccttagac atgactgttc ctcagttcaa gttgggcact 2640

tacgagaaga ccggtcttgc tagattctaa tcaagaggat gtcagaatgc catttgcctg 2700

agagatgcag gcttcatttt tgatactttt ttatttgtaa cctatatagt ataggatttt 2760

ttttgtcatt ttgtttcttc tcgtacgagc ttgctcctga tcagcctatc tcgcagctga 2820

tgaatatctt gtggtagggg tttgggaaaa tcattcgagt ttgatgtttt tcttggtatt 2880

tcccactcct cttcagagta cagaagatta agtgagacct tcgtttgtgc ggatccccca 2940

cacaccatag cttcaaaatg tttctactcc ttttttactc ttccagattt tctcggactc 3000

cgcgcatcgc cgtaccactt caaaacaccc aagcacagca tactaaattt tccctctttc 3060

ttcctctagg gtgtcgttaa ttacccgtac taaaggtttg gaaaagaaaa aagagaccgc 3120

ctcgtttctt tttcttcgtc gaaaaaggca ataaaaattt ttatcacgtt tctttttctt 3180

gaaatttttt tttttagttt ttttctcttt cagtgacctc cattgatatt taagttaata 3240

aacggtcttc aatttctcaa gtttcagttt catttttctt gttctattac aacttttttt 3300

acttcttgtt cattagaaag aaagcatagc aatctaatct aaggggcggt gttgacaatt 3360

aatcatcggc atagtatatc ggcatagtat aatacgacaa ggtgaggaac taaaccatgg 3420

ccaagttgac cagtgccgtt ccggtgctca ccgcgcgcga cgtcgccgga gcggtcgagt 3480

tctggaccga ccggctcggg ttctcccggg acttcgtgga ggacgacttc gccggtgtgg 3540

tccgggacga cgtgaccctg ttcatcagcg cggtccagga ccaggtggtg ccggacaaca 3600

ccctggcctg ggtgtgggtg cgcggcctgg acgagctgta cgccgagtgg tcggaggtcg 3660

tgtccacgaa cttccgggac gcctccgggc cggccatgac cgagatcggc gagcagccgt 3720

gggggcggga gttcgccctg cgcgacccgg ccggcaactg cgtgcacttc gtggccgagg 3780

agcaggactg acacgtccga cggcggccca cgggtcccag gcctcggaga tccgtccccc 3840

ttttcctttg tcgatatcat gtaattagtt atgtcacgct tacattcacg ccctcccccc 3900

acatccgctc taaccgaaaa ggaaggagtt agacaacctg aagtctaggt ccctatttat 3960

ttttttatag ttatgttagt attaagaacg ttatttatat ttcaaatttt tctttttttt 4020

ctgtacagac gcgtgtacgc atgtaacatt atactgaaaa ccttgcttga gaaggttttg 4080

ggacgctcga aggctttaat ttgcaagctg gagaccaaca tgtgagcaaa aggccagcaa 4140

aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct 4200

gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa 4260

agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg 4320

cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcaatgctca 4380

cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa 4440

ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg 4500

gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg 4560

tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg 4620

acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc 4680

tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag 4740

attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac 4800

gctcagtgga acgaaaactc acgttaaggg attttggtca tgagatc 4847

<210> 23

<211> 4847

<212> DNA

＜213〉artificial sequence

<400> 23

agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag 60

gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt 120

tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc 180

agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta 240

acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta 300

tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg 360

agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct 420

gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg 480

ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcggca taccgtttgt 540

cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct 600

ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct 660

ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact 720

gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat 780

atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt 840

actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga 900

caacttgaga agatcaaaaa acaactaatt attcgaaacg atgagatttc cttcaatttt 960

tactgctgtt ttattcgcag catcctccgc attagctgct ccagtcaaca ctacaacaga 1020

agatgaaacg gcacaaattc cggctgaagc tgtcatcggt tactcagatt tagaagggga 1080

tttcgatgtt gctgttttgc cattttccaa cagcacaaat aacgggttat tgtttataaa 1140

tactactatt gccagcattg ctgctaaaga agaaggggta tctctcgaga aagaggtata 1200

attcaggtaa attggaagag tttgttcaag ggaaccttga gagagaatgt atggaagaaa 1260

agtgtagttt tgaagaagca cgagaagttt ttgaaaacac tgaaagaaca actgaatttt 1320

ggaagcagta tgttgatgga gatcagtgtg agtccaatcc atgtttaaat ggcggcagtt 1380

gcaaggatga cattaattcc tatgaatgtt ggtgtccctt tggatttgaa ggaaagaact 1440

gtgaattaga tgctacatgt aacattaaga atggcagatg cgagcagttt tgtaaaaata 1500

gtgctgataa caaggctgtt tgctcctgta ctgagggata tcgacttgca gaaaaccaga 1560

agtcctgtga accagcagtg ccatttccat gtggaagagt ttctgtttca caaacttcta 1620

agctcacccg tgctgagact gtttttcctg atgtggacta tgtaaattct actgaagctg 1680

aaaccatttt ggataacatc actcaaagca cccaatcatt taatgacttc actcgggttg 1740

ttggtggaga agatgccaaa ccaggtcaat tcccttggca ggttgttttg aatggtaaag 1800

ttgatgcatt ctgtggaggc tctatcgtta atgaaaaatg gattgtaact gctgcccact 1860

gtgttgaaac tggtgttaaa attacagttg tcgcaggtga acataatatt gaggagacag 1920

aacatacaga gcaaaagcga aatgtgattc gaattattcc tcaccacaac tacaatgcag 1980

ctattaataa gtacaaccat gacattgccc ttctggaact ggacgaaccc ttagtgctaa 2040

acagctacgt tacacctatt tgcattgctg acaaggaata cacgaacatc ttcctcaaat 2100

ttggatctgg ctatgtaagt ggctggggaa gagtcttcca caaagggaga tcagctttag 2160

ttcttcagta ccttagagtt ccacttgttg accgagccac atgtcttgct tctacaaagt 2220

tcaccatcta taacaacatg ttctgtgctg gcttccatga aggaggtaga gattcatgtc 2280

aaggagatag tgggggaccc catgttactg aagtggaagg gaccagtttc ttaactggaa 2340

ttattagctg gggtgaagag tgtgcaatga aaggcaaata tggaatatat accaaggtat 2400

cccggtatgt caactggatt aaggaaaaaa caaagctcac ttaatgaaag atggatttcc 2460

aaggttaatt cattggaatt gaaaattaac agggcctctc actaactaat gcggccgcca 2520

gctttctaga acaaaaactc atctcagaag aggatctgaa tagcgccgtc gaccatcatc 2580

atcatcatca ttgagtttgt agccttagac atgactgttc ctcagttcaa gttgggcact 2640

tacgagaaga ccggtcttgc tagattctaa tcaagaggat gtcagaatgc catttgcctg 2700

agagatgcag gcttcatttt tgatactttt ttatttgtaa cctatatagt ataggatttt 2760

ttttgtcatt ttgtttcttc tcgtacgagc ttgctcctga tcagcctatc tcgcagctga 2820

tgaatatctt gtggtagggg tttgggaaaa tcattcgagt ttgatgtttt tcttggtatt 2880

tcccactcct cttcagagta cagaagatta agtgagacct tcgtttgtgc ggatccccca 2940

cacaccatag cttcaaaatg tttctactcc ttttttactc ttccagattt tctcggactc 3000

cgcgcatcgc cgtaccactt caaaacaccc aagcacagca tactaaattt tccctctttc 3060

ttcctctagg gtgtcgttaa ttacccgtac taaaggtttg gaaaagaaaa aagagaccgc 3120

ctcgtttctt tttcttcgtc gaaaaaggca ataaaaattt ttatcacgtt tctttttctt 3180

gaaatttttt tttttagttt ttttctcttt cagtgacctc cattgatatt taagttaata 3240

aacggtcttc aatttctcaa gtttcagttt catttttctt gttctattac aacttttttt 3300

acttcttgtt cattagaaag aaagcatagc aatctaatct aaggggcggt gttgacaatt 3360

aatcatcggc atagtatatc ggcatagtat aatacgacaa ggtgaggaac taaaccatgg 3420

ccaagttgac cagtgccgtt ccggtgctca ccgcgcgcga cgtcgccgga gcggtcgagt 3480

tctggaccga ccggctcggg ttctcccggg acttcgtgga ggacgacttc gccggtgtgg 3540

tccgggacga cgtgaccctg ttcatcagcg cggtccagga ccaggtggtg ccggacaaca 3600

ccctggcctg ggtgtgggtg cgcggcctgg acgagctgta cgccgagtgg tcggaggtcg 3660

tgtccacgaa cttccgggac gcctccgggc cggccatgac cgagatcggc gagcagccgt 3720

gggggcggga gttcgccctg cgcgacccgg ccggcaactg cgtgcacttc gtggccgagg 3780

agcaggactg acacgtccga cggcggccca cgggtcccag gcctcggaga tccgtccccc 3840

ttttcctttg tcgatatcat gtaattagtt atgtcacgct tacattcacg ccctcccccc 3900

acatccgctc taaccgaaaa ggaaggagtt agacaacctg aagtctaggt ccctatttat 3960

ttttttatag ttatgttagt attaagaacg ttatttatat ttcaaatttt tctttttttt 4020

ctgtacagac gcgtgtacgc atgtaacatt atactgaaaa ccttgcttga gaaggttttg 4080

ggacgctcga aggctttaat ttgcaagctg gagaccaaca tgtgagcaaa aggccagcaa 4140

aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct 4200

gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa 4260

agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg 4320

cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcaatgctca 4380

cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa 4440

ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg 4500

gtaagacacg acttatcgcc actggcagca gccactggta acaggattag cagagcgagg 4560

tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta cactagaagg 4620

acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc 4680

tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg caagcagcag 4740

attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac ggggtctgac 4800

gctcagtgga acgaaaactc acgttaaggg attttggtca tgagatc 4847

Claims

1. plasmid pPICZ α A-hF IX-R338A who separates restructuring, its sequence is shown in the SEQ ID NO.20.

2. plasmid pPICZ α A-hF IX-V86A-R338A who separates restructuring, its sequence is shown in the SEQ ID NO.21.

3. plasmid pPICZ α A-hF IX-V107A-R338A who separates restructuring, its sequence is shown in the SEQ ID NO.22.

4. plasmid pPICZ α A-hF IX-V86A-V107A-R338A who separates restructuring, its sequence is shown in the SEQ ID NO.23.

5. the albumen hF IX-R338A of the described plasmid expression of claim 1, its sequence is shown in the SEQ ID NO.16.

6. the albumen hF IX-V86A-R338A of the described plasmid expression of claim 2, its sequence is shown in the SEQ ID NO.17.

7. the albumen hF IX-V107A-R338A of the described plasmid expression of claim 3, its sequence is shown in the SEQ ID NO.18.

8. the albumen hF IX-V86A-V107A-R338A of the described plasmid expression of claim 4, its sequence is shown in the SEQ ID NO.19.

9. claim 1 or 2 or the 3 or 4 described plasmids application in producing hF IX albumen.