CN103060364B - A recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof - Google Patents
A recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof Download PDFInfo
- Publication number
- CN103060364B CN103060364B CN201210579816.5A CN201210579816A CN103060364B CN 103060364 B CN103060364 B CN 103060364B CN 201210579816 A CN201210579816 A CN 201210579816A CN 103060364 B CN103060364 B CN 103060364B
- Authority
- CN
- China
- Prior art keywords
- streptomyces lydicus
- tennecetin
- lydicus
- natamycin
- regulating gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses a recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof. The construction method for the recombinant streptomyces lydicus producing natamycin includes a step of inducing a positive regulatory gene for the synthesis of natamycin into treptomyces lydicus as a host bacterium and screening to obtain a recombinant streptomyces lydicus with a natamycin yield higher than the host bacterium streptomyces lydicus. The positive regulatory gene for the synthesis of natamycin encodes proteins related in a) or b): a) a protein with the amino acid sequence shown in SEQ IDNo. 1; or b) derived proteins of a) which are related with natamycin synthesis and obtained via substitution and / or deletion and / or addition of one or several amino acid residues in the SEQ ID No. 1. The recombinant streptomyces lydicus of the invention has significantly improved natamycin producting and antibacterial capabilities compared to the wild-type streptomyces lydicus, and can be applied to food, bio-energy and feed additives and so on.
Description
Technical field
The present invention relates to genetic engineering bacterium and construction process thereof and application, particularly produce the restructuring streptomyces lydicus of tennecetin and construction process thereof and application.
Background technology
Along with the adjustment of main crops production and the change of planting type, the occurrence and harm of many crop fungal diseases is on the rise, as the pathogenic bacterias such as Cabbage Wilt Disease (Fusarium oxysporum f.sp.conglutinans), rhizoctonia cerealis (R.cerealis), Monilinia fructicola (M.fructicola), Botryosphaeria berengeriana f. sp (B.berengeriana), lily pine root fungus (F.oxysporum) harm also very serious (Geng Lihua etc., 2009).General chemical pesticide is all difficult to gather effect, and frequent use adds the resistance of pathogenic bacteria, pollutes ecotope, therefore urgently develops the large focus that new, environmentally friendly high-effective microorganism agricultural chemicals has become the field of disease biological and ecological methods to prevent plant disease, pests, and erosion in recent years.
Tennecetin (natamycin) is a kind of polyene macrolide antibiotics, and also claim pimaricin or natamycin (Pimaricin), molecular formula is C
33h
47o
13.Research report natamycin is to nearly all yeast, mould has resistance, that one has potential broad spectrum antimicrobicide, significantly can suppress cabbage oxysporum (F.oxysporumf.s.conglutinans), Glomerella cingulata bacterium (A.mali), Botrytis cinerea (B.cinerea), Botrytis cinerea (B.cinerea), cucumber fusarium axysporum (F.f.sp.cucumerinum), eggplant early epidemic germ (A.solani), botrytis cinerea (B.cinerea), Monilinia fructicola (M.fructicola), the growth of the pathogenic bacterias such as plum brown rot germ (M.fructicola), and not easily develop immunity to drugs, good application prospect (te Welscher et al. is shown in control fungal diseases of plants, 2008, Du et al., 2009, Sui Qin etc., 2007).In addition; natamycin is that China's approval uses one of only 2 kinds of biological food antiseptics (another is nisin, Nisin) as food preservatives, is also applied to clinical treatment; be used for the treatment of (Davidson andDoan, 1993 such as fungus-caused skin and mucosal infections; Cheng Liangying, 2010).
Summary of the invention
A technical problem to be solved by this invention is to provide the high restructuring streptomyces lydicus of tennecetin output and construction process thereof.
The method building restructuring streptomyces lydicus provided by the present invention, comprises and tennecetin is synthesized positive regulating gene and import screening in the streptomyces lydicus of Host Strains and obtain the step of tennecetin output higher than the restructuring streptomyces lydicus of described Host Strains;
Described tennecetin synthesis positive regulating gene is encoded following protein a) or b):
A) protein of aminoacid sequence as shown in SEQ ID No.1;
B) replacement of one or several amino-acid residue in SEQ ID No.1 and/or disappearance and/or interpolation are synthesized relevant by a) derivative protein to tennecetin.
Wherein, SEQ ID No.1 is made up of 192 amino-acid residues.
In aforesaid method, the encoding sequence of described tennecetin synthesis positive regulating gene is the 433-1011 position of SEQ ID No.2.The sequence of described tennecetin synthesis positive regulating gene specifically can be the 14-1011 position of SEQ ID No.2.
Wherein, SEQ ID No.2 is made up of 1019 Nucleotide; 1-13 position is Nde I recognition site and protection base; 14-432 position is erythromycin resistant gene promoter-; 433-1011 position is the encoding sequence of tennecetin synthesis positive regulating gene, and 1012-1019 is EcoRI recognition site and protection base.
In aforesaid method, the described positive regulating gene that synthesized by tennecetin imports and comprises the steps: the expression vector of described tennecetin synthesis positive regulating gene to import in intestinal bacteria to obtain recombination bacillus coli as the streptomyces lydicus of Host Strains, more described recombination bacillus coli and the described streptomyces lydicus as Host Strains is carried out parents and engage and obtain described restructuring streptomyces lydicus; In the expression vector of described tennecetin synthesis positive regulating gene, the promotor starting described tennecetin synthesis positive regulating gene is erythromycin resistant gene promoter-.
In one embodiment of the invention, the nucleotide sequence of described erythromycin resistant gene promoter-is SEQ IDNo.3.
Wherein, SEQ ID No.3 is made up of 199 Nucleotide.
In an embodiment of the present invention, the expression vector of described tennecetin synthesis positive regulating gene is the recombinant expression vector obtained in the described erythromycin resistant gene promoter-downstream that described tennecetin synthesis positive regulating gene inserts pIB139, specifically by recombinant expression vector pIB139-slnM that NdeI and the EcoRI site that the DNA fragmentation shown in SEQ ID No.2 inserts pIB139 after NdeI and EcoRI enzyme is cut obtains.
In an embodiment of the present invention, the described streptomyces lydicus as Host Strains can be streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654, and described intestinal bacteria are demethylation E.coliET12567 (pUZ8002).
Another technical problem to be solved by this invention is to provide the restructuring streptomyces lydicus obtained by any one method above-mentioned.
Described restructuring streptomyces lydicus specifically can be streptomyces lydicus AM02, and it is numbered CGMCC No.6815 in registering on the books of China Committee for Culture Collection of Microorganisms's common micro-organisms center.
Another technical problem to be solved by this invention is to provide the purposes of described restructuring streptomyces lydicus.
Purposes provided by the present invention is following 1) or 2) or 3):
1) described restructuring streptomyces lydicus is producing the application in natamycin;
2) application of described restructuring streptomyces lydicus in preparation plant pathogenic fungi inhibitor;
3) described restructuring streptomyces lydicus is suppressing the application in fungal diseases of plants.
In above-mentioned application, described plant pathogenic fungi is following at least one: cabbage oxysporum (Fusariumoxysporum f.sp.conglutinans) and withered germ of water-melon (F. oxysporum f.sp.niveum); Described fungal diseases of plants is following at least one: the disease caused by cabbage oxysporum (Fusarium oxysporum f.sp.conglutinans) and the disease caused by withered germ of water-melon (F. oxysporumf.sp.niveum).
Experiment proves, streptomyces lydicus (Streptomyces lydicus) AM02 CGMCC No.6815 tennecetin output is about wild type strain streptomyces lydicus (Streptomyces lydicus) A02 CGMCCNo.1654 3 times (Fig. 3) on YEME substratum, fermention medium is about wild type strain streptomyces lydicus (Streptomyceslydicus) A02 CGMCC No.1654 2 times (Fig. 4).The bacteriostatic activity of streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 to cabbage oxysporum (Fusarium oxysporum f.sp.conglutinans) is 1.8 times of streptomyces lydicus (Streptomyces lydicus) A02 CGMCC No.1654, is 2.2 times of streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 to the bacteriostatic activity of withered germ of water-melon (F. oxysporum f.sp.niveum).Restructuring streptomyces lydicus of the present invention, there is the product tennecetin and bacteriostasis that significantly improve than wild-type, because tennecetin can as food preservative and fodder additives, therefore, restructuring streptomyces lydicus of the present invention can be applied to the aspects such as food, bioenergy and feed interpolation.
Biomaterial information
Classification And Nomenclature: streptomyces lydicus (Streptomyces lydicus)
Strain number: AM02
Preservation mechanism: China Committee for Culture Collection of Microorganisms's common micro-organisms center
Preservation mechanism is called for short: CGMCC
Address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City
Preservation date: on November 12nd, 2012
Register on the books numbering in preservation center: CGMCC No.6815
Describe the present invention in detail below in conjunction with specific embodiment, these embodiments are used for understanding instead of restriction the present invention.
Accompanying drawing explanation
Fig. 1 is that NdeI and the EcoRI enzyme of pIB139-slnM cuts result.
Wherein, swimming lane M is DNA molecular amount standard, and 1 is pIB139-slnM.
Fig. 2 is the electrophoretogram that apramycin resistance PCR verifies transformant.
Fig. 3 is streptomyces lydicus (Streptomyces lydicus) AM02 and the tennecetin Yield compari@of streptomyces lydicus (Streptomyceslydicus) A02 in YEME substratum.
Fig. 4 is streptomyces lydicus (Streptomyces lydicus) AM02 and streptomyces lydicus (Streptomyceslydicus) A02 tennecetin Yield compari@in the fermentation medium.
Fig. 5 is that the bacteriostatic activity of streptomyces lydicus (Streptomyces lydicus) AM02 and streptomyces lydicus (Streptomyceslydicus) A02 compares.
Pathogenic bacteria in A is cabbage oxysporum, left side be streptomyces lydicus (Streptomyces lydicus) A02 to the inhibition zone of cabbage oxysporum, right side is that streptomyces lydicus (Streptomyces lydicus) AM02 is to the inhibition zone of cabbage oxysporum.
Pathogenic bacteria in B is withered germ of water-melon, left side be streptomyces lydicus (Streptomyces lydicus) A02 to the inhibition zone of withered germ of water-melon, right side is that streptomyces lydicus (Streptomyces lydicus) AM02 is to the inhibition zone of withered germ of water-melon.
Fig. 6 A is separated spectrogram the HPLC first time of streptomyces lydicus active result.
Fig. 6 B is separated spectrogram the HPLC third time of streptomyces lydicus active result.
Fig. 7 is the UV scanning collection of illustrative plates of tennecetin sample.
Fig. 8 is the infrared absorption spectrum of tennecetin sample.
Fig. 9 A is the high resolution mass spectrum figure (negative ion) of tennecetin sample.
Fig. 9 B is the high resolution mass spectrum figure (positive ion) of tennecetin sample.
Figure 10 A is the carbon-13 nmr spectra (500MHz) of tennecetin sample.
Figure 10 B is the proton nmr spectra (500MHz) of tennecetin sample.
Embodiment
Following embodiment is convenient to understand the present invention better, but does not limit the present invention.Experimental technique in following embodiment, if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Streptomyces expression vector pIB139(Christopher J.Wilkinson in following embodiment, et al.Increasingthe Efficiency of Heterologous Promoters in Actinomycetes.J.Mol.Microbiol.Biotechnol. (2002) 4 (4): 417426.) public can obtain from Beijing City Agriculture and Forestry Institute, to repeat the application's experiment.
Demethylation E.coliET12567 (pUZ8002) (Sun-Uk Choi in following embodiment, Chang-KwonLee, Yong-Il Hwang, Hiroshi Kinoshita, and Takuya Nihira (2004) Cloning and FunctionalAnalysis by Gene Disruption of a Gene Encoding a γ-Butyrolactone Autoregulator Receptorfrom Kitasatospora setae.JOURNAL OF BACTERIOLOGY, 186:34233430.) public can obtain from Beijing City Agriculture and Forestry Institute, to repeat the application's experiment.
Pathogenic bacteria cabbage oxysporum (Fusarium oxysporum f.sp.conglutinans) in following embodiment and withered germ of water-melon (F.oxysporumf.sp.niveum) (Sui Qin, Liu Weicheng, Qiu Jiyan, Liu Ting, Pan Zhengyan, Liu Xuemin. the antimicrobial spectrum of Streptomyces lydicus A02 and the stability of bacteriostatic activity thereof. plant protection, 2007,33 (5) 67-71; Lu Caige, Liu Weicheng, Liu Ting, Dong Dan, Zhang Taotao, Liu Dewen. streptomyces lydicus A01 active metabolite is to the restraining effect of cabbage oxysporum and mechanism thereof. Scientia Agricultura Sinica 2012,45 (18): 3764-3772) public can obtain from Beijing City Agriculture and Forestry Institute, to repeat the application's experiment.
The restructuring streptomyces lydicus of embodiment 1, structure high yield tennecetin
One, the structure of cellulose enzyme gene expression vector pIB139-slnM
The expression vector name of the tennecetin synthesis positive regulating gene that the present embodiment builds is called pIB139-slnM, containing tennecetin synthesis positive regulating gene slnM in this carrier.The sequence of tennecetin synthesis positive regulating gene slnM is as shown in SEQID No.2.SEQ ID No.2 is made up of 1019 Nucleotide; 1-13 position is Nde I recognition site and protection base; 14-432 position is erythromycin resistant gene promoter-; 433-1011 position is the encoding sequence of tennecetin synthesis positive regulating gene, and 1012-1019 is EcoRI recognition site and protection base.
Starting this tennecetin synthesis positive regulating gene promotor of transcribing in pIB139-slnM is erythromycin resistant gene promoter-(SEQ ID No.3).
The concrete construction process of pIB139-slnM is as follows: the erythromycin resistant gene promoter-PermE of SEQ ID No.3 is carried with the streptomyces expression vector pIB139(cut through same enzyme with the slnM fragment of NdeI with EcoRI restriction enzyme site in the two ends shown in SEQ ID No.1 after NdeI with EcoRI enzyme is cut) be connected, the fragment between obtaining NdeI and EcoRI of pIB139 replaces with the recombinant expression vector pIB139-slnM with its own promoter tennecetin synthesis positive regulating gene slnM sequence.PIB139-slnM transformation of E. coli DH5 α, obtain carry the transformant of positive regulating gene and own promoter sequence thereof with apramycin (apramycin) resistance screening, this transformant is with p1(GGAATTCCATATGCGGTCGGAGGTGCGGGCATGAC) and p2(GGAATTCTCACTTCACGAAGTCGTCCAC) for primer carries out the fragment that pcr amplification obtains about 1101bp, with NdeI and EcoRI enzyme cut pIB139-slnM obtain the pIB139 plasmid fragments of 5.9kb and about 998bp with its own promoter tennecetin synthesis positive regulating gene slnM sequence (Fig. 1), thus determine that this positive regulating gene double promoter expression vector successfully constructs.
Two, utilize pIB139-slnM will import streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 with its own promoter tennecetin synthesis positive regulating gene slnM and obtain tennecetin superior strain---streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815
By pIB139-slnM vector demethylation E.coliET12567 (pUZ8002), by the method that amphiphilic engages, transform Streptomyces lydicus A02, obtain positive transformant by the screening of A Baila chloramphenicol resistance, PCR checking obtains correct transformant.Concrete method for transformation is as follows:
1) by pIB139-slnM vector demethylation E.coliET12567 (pUZ8002)
By heat shock method by pIB139-slnM vector introduction E.coliET12567 (pUZ8002) and through 60 μ g/ml apramycin resistance screening obtain recombinant bacterium E.coliET12567 (the pUZ8002)/pIB139-slnM proceeding to pIB139-slnM carrier.
2) the restructuring streptomyces lydicus of amphiphilic engagement build natamycin high yield
Reference (Bierman M et al.1992) carries out amphiphilic joint, and concrete grammar is as follows:
Recombinant bacterium E.coliET12567 (pUZ8002)/pIB139-slnM is inoculated into the LB liquid nutrient medium containing paraxin, kantlex and apramycin resistance, 37 DEG C, 200rpm, overnight incubation, morning next day by 1% inoculum size receive in fresh LB and be cultured to OD
600=0.4-0.6, collect bacterium liquid, 4 DEG C, 4000rpm, centrifugal 2min, abandons supernatant, and by the pure resuspended precipitation of LB nutrient solution that 20mL is ice-cold, 4 DEG C, 4000rpm, centrifugal 2min, abandons supernatant, and object washes away microbiotic.By the pure resuspended precipitation of LB nutrient solution that 2mL is ice-cold.(2) PDA inclined-plane is grown streptomyces lydicus (Streptomyces lydicus) the A02CGMCC No.1654(CN100467588C of 2 weeks) spore aseptic double-distilled water elutes, and with sample injector piping and druming evenly, prepare spore suspension.(3) 250 μ L strepto-spore suspensions add 500 μ L2 × YT nutrient solutions, mix gently.50 DEG C of thermal shock 10min, activation spore.Streptomyces lydicus (Streptomyces lydicus) the A02CGMCC No.1654 spore suspension that 500 μ L recombinant bacterium E.coliET12567 (pUZ8002)/pIB139-slnM bacterium liquid and 500 μ L activate, mixes gently.4000rpm, the centrifugal 3min of room temperature, removes supernatant, and mixing precipitation coats MS substratum+10mM/L MgCl
2, 28 DEG C of inversions are cultured to morning next day (18h), are coated with antibiotic solution afterwards and (0.5mg nalidixic acid and 60 μ g apramycins are dissolved in 1mLddH
2the liquid obtained in O).After 2-3 days, picking list bacterium colony adds on the MS flat board of above-mentioned antibiotic solution to new.The bacterium colony above-mentioned p3(AGCTCATCGGTCAGCTTCTC of picking on this MS flat board) and p4(GGCATCGCATTCTTCGCATC) carry out pcr amplification apramycin resistance gene, a wherein strain can be obtained recombinant bacterium called after streptomyces lydicus (Streptomyces lydicus) AM02 of the amplified production of 731bp.Streptomyces lydicus (Streptomyces lydicus) AM02 is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center on November 12nd, 2012, and register on the books numbering in preservation center: CGMCC No.6815.
The morphological specificity of streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 thalline is as follows: Gram-positive; After GYM nutrient agar grows 7 days, substrate mycelium physically well develops, and without tabula, does not rupture; Aerial hyphae well-grown, multi-branched; Fibrillae of spores is flexible or bending, and spore is oval.
Three, the synthesis tennecetin ability of streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815
Substratum used is as follows:
Gause I slant medium: K
2hPO
40.5g, NaCl0.5g, KNO
31.0g, FeSO
47H
2o0.01g, MgSO
47H
2o0.5g, Zulkovsky starch 20g, agar 20g, water 1000ml; PH7.2-7.4.
Seed culture medium: 15g soybean grain (adding distil water boils 0.5-1h, gets filtrate), 5g peptone, 2.5g ammonium sulfate, 20g glucose, 10g starch, 0.25g magnesium sulfate, 0.2g potassium primary phosphate, 5g sodium-chlor, be made into the aqueous solution, after adjusting pH7-8, add 1g calcium carbonate, add water and be settled to 1000ml.
Fermention medium: 15g soybean grain (adding distil water boils 0.5-1h, gets filtrate), 5g peptone, 2.5g ammonium sulfate, 10g sucrose, 10g starch, 0.25g magnesium sulfate, 0.2g potassium primary phosphate, 5g sodium-chlor, be made into the aqueous solution, after adjusting pH7-8, add 1g calcium carbonate, add water and be settled to 1000ml.
Not with the YEME substratum of sucrose: 3g yeast extract, 5g peptone, 3g malt extract, 10g glucose, adds water and is settled to 1000ml, adds 2ml2.5M MgCl after sterilizing
2.
A, produce tennecetin in the fermentation medium
Streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 and streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 is inoculated on Gause I slant medium respectively, cultivate 7-10 days for 28 DEG C, treat that it produces enough spores, be inoculated in the 50ml seed culture medium in 250ml triangular flask with aseptic its spore of platinum loop scraping 2-3 ring, put on temperature controllable shaking table, under 28 DEG C of conditions, 200rpm(rotation radius 13mm) constant-temperature shaking culture 24h-30h; Then aseptically its point is connected in the fermention medium in 60 500ml triangular flasks (every bottled liquid measure is 100ml), streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 is identical with the inoculum size of streptomyces lydicus (Streptomyceslydicus) AM02CGMCC No.6815, OD after every bottle graft kind
600value is 0.1; Postvaccinal shaking flask under 31 DEG C of conditions, with 240rpm(rotation radius 13mm) speed oscillation cultivate 0,24,48,72,96,120h, get fermented liquid and measure the output of tennecetin.Experiment in triplicate.
B, in not with the YEME substratum of sucrose, produce tennecetin
By streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 and streptomyces lydicus
(Streptomyces lydicus) AM02CGMCC No.6815 is inoculated on Gause I slant medium respectively, cultivate 7-10 days for 28 DEG C, treat that it produces enough spores, be inoculated in the 50ml seed culture medium in 250ml triangular flask with aseptic its spore of platinum loop scraping 2-3 ring, put on temperature controllable shaking table, under 28 DEG C of conditions, 200rpm(rotation radius 13mm) constant-temperature shaking culture 24h-30h; Then aseptically its point is connected in 70 500ml triangular flasks not with (every bottled liquid measure is 100ml) in the YEME substratum of sucrose, streptomyces lydicus (Streptomyceslydicus) A02CGMCC No.1654 is identical with the inoculum size of streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815, and after every bottle graft kind, OD600 value is 0.1; Postvaccinal shaking flask under 31 DEG C of conditions, with 240rpm(rotation radius 13mm) speed oscillation cultivate 0,24,48,72,96,120h, get fermented liquid and measure the output of tennecetin.Experiment in triplicate.
C, tennecetin volume analysis
The 1mL fermented liquid above step obtained adds 9mL methyl alcohol, after abundant vibration, carry out 30min ultrasonic extraction, 5000rpm/min centrifugal 10-15min settling bacteria filament and solid substance, supernatant liquor dilutes the aseptic filtering with microporous membrane that 10 times are used 0.45 μm afterwards, collect filtrate, gained sample is used for HPLC and detects.Chromatographic column: C18 post (5 μm, 4.6mm × 200mm); Determined wavelength: 303nm; Flow velocity: 1.00mL/min; Sample size: 10 μ L; Detect column temperature: 30 DEG C; Experiment moving phase is V (methyl alcohol): V (water)=65: 35.With tennecetin (sigma-P9703) for standard substance adopt external standard method (calibration curve method) to carry out quantitatively tennecetin.
Experimental result shows, streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 shake flask fermentation is 1.148g/L substratum in YEME substratum top fermentation 72 hourly output not with sucrose, is 5.338g/L substratum in fermention medium top fermentation 96 hourly output; Streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 shake flask fermentation is 0.375g/L substratum in YEME substratum top fermentation 72 hourly output not with sucrose, is 2.546g/L substratum in fermention medium top fermentation 96 hourly output.Illustrating that streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 tennecetin output is not with 3 times (Fig. 3) the YEME substratum of sucrose being about wild type strain streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654, fermention medium is about 2 times (Fig. 4) of wild type strain streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654.
Wherein, in streptomyces lydicus fermented liquid tennecetin slightly carry with authentication method as follows:
One) slightly the carrying of tennecetin in fermented liquid
The fermented liquid of above-mentioned streptomyces lydicus is used respectively the dehydrated alcohol pre-treatment of 3 times of volumes, 4 DEG C of standing 2h, to precipitate thalline, solid particles, solubility glue jelly, nucleic acid and heteroproteins and mesostate etc., supernatant liquor with 2 metafiltration paper with Büchner funnel vacuum filtration, filtrate is through Rotary Evaporators concentrating under reduced pressure at 45 DEG C, concentrated solution is tennecetin crude extract, and 4 DEG C save backup.
Two), the separation and purification of tennecetin crude extract
Progressively separation and purification is carried out by macroporous resin column chromatography, silica gel column chromatography and high performance liquid chromatograph HPLC.
1, macroporous resin adsorption column chromatography
Select 40cm × 2.6cm glass chromatography column, X-5 macroporous resin (Tianjin Nankai university chemical plant).Macroporous resin is mixed well by appropriate amount of deionized water after pre-treatment being described by producer, slowly adds in the chromatography column that 1/3 volumes of deionized water is housed, and releases distilled water simultaneously, liquid level in post is remained at above resin layer from column bottom with uniform speed slow.Be filled to about 3/4 post height, natural subsidence 6 ~ 10h, make the dress column volume after balance be 150ml.
Get tennecetin crude extract and resin carries out dynamic adsorption by the volume ratio of 1 ﹕ 1.Elution process is: the deionized water wash-out remove portion pigment of 2 times of column volumes and a large amount of water-soluble impurity; The 30%(volumn concentration of 2 times of column volumes) methanol-eluted fractions discolors element; Finally use the 70%(volumn concentration of 2 times of column volumes) ethanol elution activeconstituents.Be in charge of collection elutriant, often pipe 15ml, filter paper enzyme carries out determination of activity.
Result shows that active eluant concentrates on 48th ~ 56 pipes (elutriant namely between 4.8 times of column volume to 5.6 times column volumes).By active eluant, be separated for next step after concentrating under reduced pressure at 45 DEG C.
2, silica gel adsorption column chromatography
Selecting 40cm × 2.6cm glass chromatography column, 100 order ~ 200 order silica gel, is that the mixed solution of the ethanol of 8 ﹕ 1 ﹕ 1, ammoniacal liquor and water is for elutriant with volume ratio; Get about 150g silica gel deionized water and soak 3h, incline fine particle, Büchner funnel vacuum filtration removing moisture; Soak 12h with 6mol/LHCl again, be then washed till neutrality with deionized water, vacuum is drained; Spend the night by soaked in absolute ethyl alcohol, vacuum is drained; Under 120 ° of C, activate 2h before use, be dried to constant weight; Load the elutriant of 1/3 column volume in chromatography column, then slowly add the silica gel mixed with elutriant, stop during about to 3/4 post height adding, leave standstill 6 ~ 10h, make the slow sedimentation of silica gel.Then rinse cylinder with the elutriant of 2 ~ 3 times of volumes with the flow velocity of 1mL/min, make it balance.Column volume after balance is 150ml.The macroporous resin active wash-out concentrated solution 10ml upper prop getting step 1 carries out dynamic adsorption, carries out wash-out, be in charge of collection elutriant, often pipe 5ml with automatic Fraction Collector with the elutriant of 2 ~ 3 times of column volumes by the flow velocity of 0.5ml/min.With S. cervisiae ACCC20036 for indicator, filter paper agar diffusion method is utilized to detect often pipe elutriant active.Result shows: the active ingredient in its elutriant concentrates on 7th ~ 36 pipes (elutriant namely between 0.23 times of column volume to 1.2 times column volume).By active eluant, be separated for next step after concentrating under reduced pressure at 45 DEG C.
3, preparation HPLC separation and purification
Adopt LC-9101 type circulation preparative HPLC, JAIGEL-ODS-AP type SP-120-15 preparative column.
Get the active wash-out concentrated solution after the silica gel column chromatography of step 2, filter with 0.45 μm of millipore filter, automatic sampler sample introduction, each sample size 6ml; With methyl alcohol: water (volume ratio is 7:3), for moving phase is separated, utilizes UV detector detect at wavelength 305nm place and automatically form separating spectrum; Run tank is utilized to collect elutriant in collection of illustrative plates corresponding to each curve peak respectively; With S. cervisiae ACCC20036 for indicator, filter paper agar diffusion method is utilized to detect often pipe elutriant active.After carrying out first time separation with the flow rate pump of 2ml/min, be more in succession separated 2 times with the flow rate pump of 3ml/min.
Experimental result shows, first time HPLC is separated and 30 peaks detected altogether, and wherein retention time is the strong absorption peak of 57.866min is Peak Activity (Fig. 6 A), and its relative peak area is 35.121%; To its second time separation detection of carrying out to 6 peaks, wherein retention time is the peak of 41.699min is Peak Activity, and its relative peak area is 97.020%; Separation detection is Peak Activity (Fig. 6 B) to the peak that retention time is 39.766min for the third time, is 99.845% by its purity of calculated by peak area.
Carry out vacuum concentration by being separated the Peak Activity sample obtained for the third time, in white or cream coloured powder after dry, this sample is tennecetin sample.Shimadzu analysis mode HPLC is utilized to adopt following method to carry out purity checking to it: the sample that takes a morsel is dissolved in 70% methanol aqueous solution, with methyl alcohol (A) and water (B) for moving phase carries out gradient elution.Chromatographic condition is: C18 reversed-phase column, column temperature 30 DEG C, UV detector, and determined wavelength 305nm, SIL-10ADVP automatic sampler sample introduction 10 μ l, with the flow velocity wash-out 60min of 1ml/min.Gradient elution step is as follows:
Result display elution curve is single peak, and illustrate that it is one-component, purity reaches the requirement of determination of chemical structure.
Four, the parsing qualification of purification of samples chemical structure
1, ultra-violet absorption spectrum (UV)
The tennecetin sample denier of above-mentioned steps three purifying is dissolved in ultrapure water, use Hitachi UV-VIS3010 ultraviolet-visible pectrophotometer is that blank carries out full wavelength scanner with ultrapure water in 190nm ~ 400nm wavelength region, automatically forms ultraviolet absorpting spectrum.
From UV scanning collection of illustrative plates, tennecetin sample shows typical tetraenes microbiotic spectral pattern, namely near wavelength 281nm, 291nm, 305nm and 319nm, all there is the absorption peak of typical conjugated tetraene chromophoric group, its medium wavelength 305nm place absorption value is maximum, 281nm place absorption value minimum (Fig. 7), illustrates that this material belongs to the tetraene microbiotic in polyenoid class.
2, infrared absorption spectrum (IR)
Adopt KBr pressed disc method, carry out 400cm with German BRUKER company's T ENSOR27 Fourier infrared spectrograph
-1-4000cm
-1scanned in regions.
The infrared spectra of tennecetin sample as shown in Figure 8, wherein ν
max3416.78cm
-1for the charateristic avsorption band of-OH; ν
max3288.23cm
-1for the stretching vibration charateristic avsorption band of N-H; ν
max2940.44 and 2980.27cm
-1-CH
3charateristic avsorption band; ν
max3017.23cm
-1-CH
2charateristic avsorption band; ν
max1715.38cm
-1show the strong absorption peak of typical carbonyl; ν
max1571.44cm
-1the strong absorption peak of performance-C=C-; ν
max1634.40cm
-1the weak absorbing peak of performance-C=C-.
3, high resolution mass spectrum
Adopt German BRUKER company ultrahigh resolution 9.4T mixed type level Four bar fourier tandom mass spectrometer (9.4TQ-FT-MS); Condition: capillary4000, Dry Gas:4.0l/s, source temperature: 180 ° of C, scan range:300 ~ 2000, syringe pump:1.5ml/min, data analysis software is Bruker DaltonicsDataAnalysis3.4.
Result shows, tennecetin sample carries out in the collection of illustrative plates analyzed, and adopts positive ion detection mode adduct ion [M+Na] to be detected
+for m/z688.2937(Fig. 9 B); Anionic textiles mode is adopted quasi-molecular ion [M-H] to be detected
+for the compound (Fig. 9 A) of m/z664.2975; Adopt positive and negative ion detection mode to carry out detection to tennecetin sample to analyze, determine that 664.2975 for molecular ion peak.
In sum, the molecular formula of the main active component of tennecetin sample is C
33h
47nO
13, molecular weight is 665; By formula: degree of unsaturation (n)=1+Nc+(Nn-Nh)/2(Nc: carbonatoms; Nn: nitrogen-atoms number; Nh: number of hydrogen atoms) degree of unsaturation that calculates its molecular formula is 11, shows in its molecular structure containing multiple unsaturated link(age) and ring etc.
4, nuclear magnetic resonance spectrum (NMR)
With deuterated-dimethyl formamide (d-DMF) for solvent, with tetramethylsilane (TMS) for interior mark, measure under room temperature.
Adopt Bruker AVANCE DRX-500 nuclear magnetic resonance spectrometer (German Bruker spectral instrument company), with deuterated-dimethyl formamide (d-DMF) for solvent, tetramethylsilane (TMS) is interior mark, carry out hydrogen spectrum (
1hNMR) and carbon spectrum (
13cNMR) mensuration; The former resonant frequency is 500.1325156MHZ, sampling number 32768 times; The latter's resonant frequency 125.7577612MHZ, sampling number is 65536 times.
Experimental result shows, the nucleus magnetic resonance of tennecetin sample
13can find out in molecule, there is the chemical shift (δ 165.217) of a carboxyl carbon atom in C collection of illustrative plates (Figure 10 A); The chemical shift (δ 178.603) of a carbonylic carbon atom; The chemical shift (δ 125.089 ~ 145.447) of one group of conjugated tetraene carbon atom; The chemical shift (δ 66.102 ~ 70.326) of one group of carbon atom be connected with hydroxyl; Five carbon atom resonance peaks (δ 71.194 ~ 97.894) on sugar ring; Methine carbon atom resonance peak (δ 18.062, δ 20.360).The nucleus magnetic resonance of 500 megahertzes
1can find out in H collection of illustrative plates (Figure 10 B), the chemical shift (δ 5.686 ~ 6.625ppm) of the proton hydrogen (-CH=CH-) that polyenoid ring is connected with four double bonds; The chemical displacement value (δ 4.187 ~ 4.741ppm) of the proton hydrogen in five hydroxyls; The chemical shift (δ 1.274 ~ 2.439ppm) of the proton hydrogen in five methylene radical and two methyl.
The above-mentioned experimental data of comprehensive analysis, the main active component of tennecetin sample is tennecetin, and its chemical structural formula is:
The bacteriostatic activity of embodiment 2, streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 is higher than streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654
In this embodiment, substratum used is as follows:
Gause I slant medium: K
2hPO
40.5g, NaCl0.5g, KNO
31.0g, FeSO
47H
2o0.01g, MgSO
47H
2o0.5g, Zulkovsky starch 20g, agar 20g, water 1000ml; PH7.2-7.4.
Seed culture medium: 15g soybean grain (adding distil water boils 0.5-1h, gets filtrate), 5g peptone, 2.5g ammonium sulfate, 20g glucose, 10g starch, 0.25g magnesium sulfate, 0.2g potassium primary phosphate, 5g sodium-chlor, be made into the aqueous solution, after adjusting pH7-8, add 1g calcium carbonate, add water and be settled to 1000ml.
Fermention medium: 15g soybean grain (adding distil water boils 0.5-1h, gets filtrate), 5g peptone, 2.5g ammonium sulfate, 10g sucrose, 10g starch, 0.25g magnesium sulfate, 0.2g potassium primary phosphate, 5g sodium-chlor, be made into the aqueous solution, after adjusting pH7-8, add 1g calcium carbonate, add water and be settled to 1000ml.
1, the preparation of fungal diseases of plants inhibitor
Streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 and streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 is inoculated on Gause I slant medium respectively, cultivate 7-10 days for 28 DEG C, treat that it produces enough spores, be inoculated in the 50ml seed culture medium in 250ml triangular flask with aseptic its spore of platinum loop scraping 2-3 ring, put on temperature controllable shaking table, under 28 DEG C of conditions, 200rpm/min(rotation radius 13mm) constant-temperature shaking culture 24h-30h; Then aseptically its point is connected in the fermention medium in 10 500ml triangular flasks (every bottled liquid measure is 100ml), streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 is identical with the inoculum size of streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815, OD after every bottle graft kind
600value is 0.1; Postvaccinal shaking flask under 31 DEG C of conditions, with 240rpm/min(rotation radius 13mm) speed oscillation cultivate 96h; Now bacterial strain has produced the bacteriostatic activity meta-bolites of high density in fermented liquid.
1mL fermented liquid is added 9mL methyl alcohol, after abundant vibration, carry out 30min ultrasonic extraction, 5000rpm/min centrifugal 10-15min settling bacteria filament and solid substance, supernatant liquor methanol dilution 10 times uses the aseptic filtering with microporous membrane of 0.45 μm afterwards, collect filtrate, this filtrate is the methanol solution of streptomyces lydicus metabolite.Get streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 metabolite methanol solution and streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 metabolite methanol solution respectively, carry out the bacteriostatic activity test of following step 2.
2, bacteriostatic activity test
Examination target pathogens is supplied to be cabbage oxysporum (Fusarium oxysporum f.sp.conglutinans) and withered germ of water-melon (F. oxysporumf.sp.niveum).
Scraping PDA flat board is cultivated the cabbage oxysporum (Fusarium oxysporum f.sp.conglutinans) of generation and the conidium of withered germ of water-melon (F. oxysporumf.sp.niveum), bacteria suspension is made with sterilized water, be applied to equably on freshly prepd PDA flat board, put in Bechtop and dry up; Punch in dull and stereotyped surrounding symmetric position with the aseptic punch tool of diameter 7mm, then streptomyces lydicus (Streptomyceslydicus) A02CGMCC No.1654 metabolite methanol solution 200 μ l or streptomyces lydicus (Streptomyceslydicus) AM02CGMCC No.6815 metabolite methanol solution 200 μ l is injected in every hole, with 200ul methyl alcohol for contrast; Cultivate 3 days at 28 DEG C, right-angled intersection method measures antibacterial circle diameter.Often process three repetitions.
Experimental result shows that streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 metabolite methanol solution and streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 metabolite methanol solution can all produce obvious inhibition zone to cabbage oxysporum (Fusarium oxysporum f.sp.conglutinans) and withered germ of water-melon (F. oxysporumf.sp.niveum) on PDA flat board, and methyl alcohol all can not produce inhibition zone to cabbage oxysporum (Fusarium oxysporum f.sp.conglutinans) and withered germ of water-melon (F.oxysporumf.sp.niveum) on PDA flat board.Streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 metabolite methanol solution is respectively 36 ± 1.1mm to cabbage oxysporum (Fusarium oxysporum f.sp.conglutinans) and withered germ of water-melon (F. oxysporumf.sp.niveum) antibacterial circle diameter, 47 ± 1.4mm, streptomyces lydicus (Streptomyceslydicus) A02CGMCC No.1654 metabolite methanol solution is respectively 20 ± 1.2mm to cabbage oxysporum (Fusarium oxysporum f.sp.conglutinans) and withered germ of water-melon (F.oxysporumf.sp.niveum) antibacterial circle diameter, 21 ± 1.1mm(Fig. 5).Illustrate that the bacteriostatic activity of streptomyces lydicus (Streptomyceslydicus) AM02CGMCC No.6815 metabolite methanol solution to cabbage oxysporum (Fusarium oxysporumf.sp.conglutinans) is 1.8 times of streptomyces lydicus (Streptomyces lydicus) A02CGMCCNo.1654, the bacteriostatic activity of streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 metabolite methanol solution to withered germ of water-melon (F.oxysporumf.sp.niveum) is 2.2 times of streptomyces lydicus (Streptomyceslydicus) A02CGMCC No.1654.
Claims (4)
1. build the method for restructuring streptomyces lydicus, comprise and tennecetin synthesized positive regulating gene and import screening in the streptomyces lydicus of Host Strains and obtain the step of tennecetin output higher than the restructuring streptomyces lydicus of described Host Strains;
The protein of described tennecetin synthesis positive regulating gene encoding amino acid sequence as shown in SEQ ID No.1;
The described streptomyces lydicus as Host Strains is streptomyces lydicus (Streptomyces lydicus) A02 CGMCC No.1654.
2. method according to claim 1, is characterized in that: the encoding sequence of described tennecetin synthesis positive regulating gene is the 433-1011 position of SEQ ID No.2.
3. method according to claim 1, is characterized in that: the sequence of described tennecetin synthesis positive regulating gene is the 14-1011 position of SEQ ID No.2.
4. according to described method arbitrary in claim 1-3, it is characterized in that: the described positive regulating gene that synthesized by tennecetin imports and comprises the steps: the expression vector of described tennecetin synthesis positive regulating gene to import in intestinal bacteria to obtain recombination bacillus coli as the streptomyces lydicus of Host Strains, more described recombination bacillus coli and the described streptomyces lydicus as Host Strains are carried out parents and engage and obtain described restructuring streptomyces lydicus; In the expression vector of described tennecetin synthesis positive regulating gene, the promotor starting described tennecetin synthesis positive regulating gene is erythromycin resistant gene promoter-.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210579816.5A CN103060364B (en) | 2012-12-27 | 2012-12-27 | A recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof |
| CN201510011400.7A CN104611283B (en) | 2012-12-27 | 2012-12-27 | A kind of recombination streptomyces lydicus and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210579816.5A CN103060364B (en) | 2012-12-27 | 2012-12-27 | A recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510011400.7A Division CN104611283B (en) | 2012-12-27 | 2012-12-27 | A kind of recombination streptomyces lydicus and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103060364A CN103060364A (en) | 2013-04-24 |
| CN103060364B true CN103060364B (en) | 2015-01-07 |
Family
ID=48103258
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210579816.5A Active CN103060364B (en) | 2012-12-27 | 2012-12-27 | A recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103060364B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2694810T3 (en) * | 2013-05-31 | 2018-12-27 | Dsm Ip Assets B.V. | Microbial agriculture |
| CN105431045A (en) * | 2013-05-31 | 2016-03-23 | 帝斯曼知识产权资产管理有限公司 | Microbial agriculture |
| CN103923870B (en) * | 2014-04-30 | 2016-06-01 | 山东大学 | A kind of produce tennecetin genetic engineering bacterium and construction process and application |
| CN104480134A (en) * | 2014-12-17 | 2015-04-01 | 北京市农林科学院 | High-efficiency biocontrol recombinant streptomyces lydicus as well as construction method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101397579A (en) * | 2007-09-29 | 2009-04-01 | 北京市农林科学院 | Method for preparing natamycin |
-
2012
- 2012-12-27 CN CN201210579816.5A patent/CN103060364B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101397579A (en) * | 2007-09-29 | 2009-04-01 | 北京市农林科学院 | Method for preparing natamycin |
Non-Patent Citations (5)
| Title |
|---|
| Biochemical studies on the natamycin antibiotic produced by streptomyces lydicus: fermentaion, extraction and biological activities;H.M. Atta et al;《Journal of Saudi Chemical Society》;20120426;全文 * |
| Identification of a novel streptomyces chattanoogensis L10 and enhancing its natamycin production by overexpressing positive regulator ScnRII;Yiling Du et al;《The Journal of Microbiology》;20090831;第47卷(第4期);506-513 * |
| 一株新的纳他霉素生产菌L10的系统发育分析及其基因工程高产菌构建;陈时飞;《中国博士学位论文全文数据库工程科技I辑》;20110315;1-113 * |
| 利迪链霉菌A02 抗真菌活性产物的分离和结构鉴定;隋勤 等;《生物工程学报》;20090630;第25卷(第6期);840-846 * |
| 纳他霉素及其生产菌育种研究进展;亓芳 等;《生物技术通报》;20101231;42-47 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103060364A (en) | 2013-04-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Schwartz et al. | Pneumocandins from Zalerion arboricola I. Discovery and isolation | |
| CN100590194C (en) | Streptomyces lydicus producing natamycin and uses thereof | |
| CN101481669B (en) | Preparation and use of lilac grey streptomycete and active product thereof | |
| CN103060364B (en) | A recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof | |
| CN104513300A (en) | Bio-control bacillus subtilis surfactin separation and purification method | |
| CN108300677B (en) | One plant of streptomyces albus and its preparing the application in microbialpreservatives | |
| CN104611283A (en) | Recombinational streptomyces lydicus and application thereof | |
| CN101397579B (en) | Method for preparing natamycin | |
| CN109706086A (en) | A kind of marine fungi source azaphilones class compound and its preparation method and application | |
| CN101613712A (en) | Improve the method for Avrmectin and/or ivermectin output and produce bacterial strain | |
| CN101720772B (en) | Macrolide composition for preventing and controlling fungal disease of crop and preparation process thereof | |
| CN104480135A (en) | Recombinant streptomyces lydicus for producing cellulase and natamycin and application | |
| KR0140218B1 (en) | Ab-021 antibiotics and process for producing them | |
| CN101720781B (en) | New phosphorus and nitrogen mycin A for preventing and controlling fungal disease of crop and preparation process thereof | |
| CN104480134A (en) | High-efficiency biocontrol recombinant streptomyces lydicus as well as construction method and application thereof | |
| Fang et al. | Two New Components of the Aspochalasins Produced by Aspergillm sp. | |
| FI65082C (en) | FRAMEWORK FOR ANTIBIOTICS ACTIVATING ACTIVITIES | |
| CN109182180B (en) | A kind of application of the brown streptomycete of ash and its fermenting and producing bar bifilomycin A1 | |
| AU721483B2 (en) | Novel polyene antibiotics, 3874 H1 to H6, processes for their preparation and use | |
| CN104480136A (en) | Construction method of recombinant streptomyces lydicus for producing cellulase and natamycin | |
| US5516686A (en) | Fungicidal antibiotic producing Streptomyces sp. NCIMB 40212 | |
| CN104928313A (en) | Application of rex gene of streptomyces avermitilis to improvement of avermectins yield | |
| CN103074356A (en) | Vector for knocking out streptomycete gene as well as constructing method and application of same | |
| CN115504990B (en) | Sugar-spiro-macrolide compound FW-5-39 and preparation method and application thereof | |
| CN103045516B (en) | Novel strain for producing natamycin and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |