CN103060364A - A recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof - Google Patents

A recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof Download PDF

Info

Publication number
CN103060364A
CN103060364A CN2012105798165A CN201210579816A CN103060364A CN 103060364 A CN103060364 A CN 103060364A CN 2012105798165 A CN2012105798165 A CN 2012105798165A CN 201210579816 A CN201210579816 A CN 201210579816A CN 103060364 A CN103060364 A CN 103060364A
Authority
CN
China
Prior art keywords
streptomyces lydicus
tennecetin
lydicus
regulating gene
natamycin
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN2012105798165A
Other languages
Chinese (zh)
Other versions
CN103060364B (en
Inventor
吴慧玲
刘伟成
燕继晔
董丹
刘霆
卢彩鸽
张殿朋
张涛涛
田兆丰
卢向阳
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Academy of Agriculture and Forestry Sciences
Original Assignee
Beijing Academy of Agriculture and Forestry Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Academy of Agriculture and Forestry Sciences filed Critical Beijing Academy of Agriculture and Forestry Sciences
Priority to CN201510011400.7A priority Critical patent/CN104611283B/en
Priority to CN201210579816.5A priority patent/CN103060364B/en
Publication of CN103060364A publication Critical patent/CN103060364A/en
Application granted granted Critical
Publication of CN103060364B publication Critical patent/CN103060364B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention discloses a recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof. The construction method for the recombinant streptomyces lydicus producing natamycin includes a step of inducing a positive regulatory gene for the synthesis of natamycin into treptomyces lydicus as a host bacterium and screening to obtain a recombinant streptomyces lydicus with a natamycin yield higher than the host bacterium streptomyces lydicus. The positive regulatory gene for the synthesis of natamycin encodes proteins related in a) or b): a) a protein with the amino acid sequence shown in SEQ IDNo. 1; or b) derived proteins of a) which are related with natamycin synthesis and obtained via substitution and / or deletion and / or addition of one or several amino acid residues in the SEQ ID No. 1. The recombinant streptomyces lydicus of the invention has significantly improved natamycin producting and antibacterial capabilities compared to the wild-type streptomyces lydicus, and can be applied to food, bio-energy and feed additives and so on.

Description

Produce restructuring streptomyces lydicus and construction process and the application of tennecetin
Technical field
The present invention relates to genetic engineering bacterium and construction process thereof and application, particularly produce restructuring streptomyces lydicus and construction process and the application of tennecetin.
Background technology
Along with the adjustment of proportion of crop planting structure and the variation of planting type, the occurrence and harm of many crop fungal diseases is on the rise, such as the harm of the pathogenic bacterias such as Cabbage Wilt Disease (Fusarium oxysporum f.sp.conglutinans), rhizoctonia cerealis (R.cerealis), Monilinia fructicola (M.fructicola), Botryosphaeria berengeriana f. sp (B.berengeriana), lily pine root fungus (F.oxysporum) also very serious (Geng Lihua etc., 2009).General chemical pesticide all is difficult to gather effect, and the frequent resistance that has increased pathogenic bacteria of using, and has polluted ecotope, therefore demands developing the large focus that new, environmentally friendly high-effective microorganism agricultural chemicals has become in recent years disease biological and ecological methods to prevent plant disease, pests, and erosion field urgently.
Tennecetin (natamycin) is a kind of polyene macrolide antibiotics, also claims pimaricin or natamycin (Pimaricin), and molecular formula is C 33H 47O 13Research report natamycin is to nearly all yeast, mould has resistance, it is a kind of potential broad spectrum antimicrobicide that has, can significantly suppress Cabbage Wilt Disease bacterium (F.oxysporumf.s.conglutinans), Glomerella cingulata bacterium (A.mali), Botrytis cinerea (B.cinerea), Botrytis cinerea (B.cinerea), cucumber fusarium axysporum (F.f.sp.cucumerinum), eggplant early epidemic germ (A.solani), botrytis cinerea (B.cinerea), Monilinia fructicola (M.fructicola), the growth of the pathogenic bacterias such as plum brown rot germ (M.fructicola), and be difficult for developing immunity to drugs, showing good application prospect (te Welscher et al., 2008 aspect the control fungal diseases of plants; Du et al., 2009; Sui Qin etc., 2007).In addition, natamycin is that (another is nisin to one of only 2 kinds of biological food antiseptics of China's approval use, Nisin), also is applied to clinical treatment as food preservatives, be used for the treatment of (Davidson andDoan, 1993 such as fungus-caused skin and mucosal infections; Cheng Liangying, 2010).
Summary of the invention
A technical problem to be solved by this invention provides tennecetin output high restructuring streptomyces lydicus and construction process thereof.
The method of structure restructuring streptomyces lydicus provided by the present invention comprises the synthetic positive regulating gene importing of tennecetin is obtained the step that tennecetin output is higher than the restructuring streptomyces lydicus of described Host Strains as screening in the streptomyces lydicus of Host Strains;
The synthetic positive regulating gene of described tennecetin encode following a) or b) protein:
A) protein of aminoacid sequence shown in SEQ ID No.1;
B) with the replacement of one or several amino-acid residue among the SEQ ID No.1 and/or disappearance and/or interpolation and synthetic relevant with tennecetin by the protein of a) deriving.
Wherein, SEQ ID No.1 is comprised of 192 amino-acid residues.
In the aforesaid method, the encoding sequence of the synthetic positive regulating gene of described tennecetin is the 433-1011 position of SEQ ID No.2.The sequence of the synthetic positive regulating gene of described tennecetin specifically can be the 14-1011 position of SEQ ID No.2.
Wherein, SEQ ID No.2 is comprised of 1019 Nucleotide; the 1-13 position is Nde I recognition site and protection base; the 14-432 position is erythromycin resistant gene promoter-; the 433-1011 position is the encoding sequence of the synthetic positive regulating gene of tennecetin, and 1012-1019 is EcoRI recognition site and protection base.
In the aforesaid method, describedly the synthetic positive regulating gene of tennecetin is imported streptomyces lydicus as Host Strains comprise the steps: that expression vector with the synthetic positive regulating gene of described tennecetin imports in the intestinal bacteria and obtain recombination bacillus coli, more described recombination bacillus coli and described streptomyces lydicus as Host Strains are carried out parents and engage the described restructuring streptomyces lydicus of acquisition; In the expression vector of the synthetic positive regulating gene of described tennecetin, the promotor that starts the synthetic positive regulating gene of described tennecetin is erythromycin resistant gene promoter-.
In one embodiment of the invention, the nucleotide sequence of described erythromycin resistant gene promoter-is SEQ IDNo.3.
Wherein, SEQ ID No.3 is comprised of 199 Nucleotide.
In an embodiment of the present invention, the recombinant expression vector that the expression vector of the synthetic positive regulating gene of described tennecetin obtains for the described erythromycin resistant gene promoter-downstream that the synthetic positive regulating gene of described tennecetin is inserted pIB139 specifically inserts the NdeI of pIB139 and the recombinant expression vector pIB139-slnM that the EcoRI site obtains with the dna fragmentation shown in the SEQ ID No.2 after NdeI and EcoRI enzyme are cut.
In an embodiment of the present invention, described streptomyces lydicus as Host Strains can be streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654, and described intestinal bacteria are demethylation E.coliET12567 (pUZ8002).
Another technical problem to be solved by this invention provides the restructuring streptomyces lydicus that is obtained by above-mentioned any method.
Described restructuring streptomyces lydicus specifically can be streptomyces lydicus AM02, and it is numbered CGMCC No.6815 registering on the books of China Committee for Culture Collection of Microorganisms common micro-organisms center.
Another technical problem to be solved by this invention provides the purposes of described restructuring streptomyces lydicus.
Purposes provided by the present invention is following 1) or 2) or 3):
1) application of described restructuring streptomyces lydicus in producing natamycin;
2) application of described restructuring streptomyces lydicus in preparation plant pathogenic fungi inhibitor;
3) application of described restructuring streptomyces lydicus in suppressing fungal diseases of plants.
In the above-mentioned application, described plant pathogenic fungi is following at least a: Cabbage Wilt Disease bacterium (Fusariumoxysporum f.sp.conglutinans) and withered germ of water-melon (F. oxysporum f.sp.niveum); Described fungal diseases of plants is following at least a: the disease that is caused by Cabbage Wilt Disease bacterium (Fusarium oxysporum f.sp.conglutinans) and the disease that is caused by withered germ of water-melon (F. oxysporumf.sp.niveum).
Experimental results show that, streptomyces lydicus (Streptomyces lydicus) AM02 CGMCC No.6815 tennecetin output is wild type strain streptomyces lydicus (Streptomyces lydicus) A02 CGMCCNo.1654 3 times (Fig. 3) approximately on the YEME substratum, is 2 times (Fig. 4) of wild type strain streptomyces lydicus (Streptomyceslydicus) A02 CGMCC No.1654 approximately on fermention medium.Streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 is 1.8 times of streptomyces lydicus (Streptomyces lydicus) A02 CGMCC No.1654 to the bacteriostatic activity of Cabbage Wilt Disease bacterium (Fusarium oxysporum f.sp.conglutinans), is 2.2 times of streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 to the bacteriostatic activity of withered germ of water-melon (F. oxysporum f.sp.niveum).Restructuring streptomyces lydicus of the present invention, have the product tennecetin and the bacteriostasis that significantly improve than wild-type, because tennecetin can be used as food preservative and fodder additives, therefore, restructuring streptomyces lydicus of the present invention can be applied to the aspects such as food, bioenergy and feed interpolation.
Biomaterial information
Classification And Nomenclature: streptomyces lydicus (Streptomyces lydicus)
Strain number: AM02
Preservation mechanism: China Committee for Culture Collection of Microorganisms common micro-organisms center
Preservation mechanism is called for short: CGMCC
Address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City
Preservation date: on November 12nd, 2012
The preservation center numbering of registering on the books: CGMCC No.6815
Describe the present invention in detail below in conjunction with specific embodiment, these embodiment are used for understanding rather than restriction the present invention.
Description of drawings
Fig. 1 is that NdeI and the EcoRI enzyme of pIB139-slnM cut the result.
Wherein, swimming lane M is dna molecular amount standard, and 1 is pIB139-slnM.
Fig. 2 is the electrophoretogram of apramycin resistance PCR checking transformant.
Fig. 3 is that streptomyces lydicus (Streptomyces lydicus) AM02 and the tennecetin output of streptomyces lydicus (Streptomyceslydicus) A02 in the YEME substratum compare.
Fig. 4 is that streptomyces lydicus (Streptomyces lydicus) AM02 and the tennecetin output of streptomyces lydicus (Streptomyceslydicus) A02 in fermention medium compare.
Fig. 5 is that the bacteriostatic activity of streptomyces lydicus (Streptomyces lydicus) AM02 and streptomyces lydicus (Streptomyceslydicus) A02 compares.
Pathogenic bacteria among the A is the Cabbage Wilt Disease bacterium, the left side be streptomyces lydicus (Streptomyces lydicus) A02 to the inhibition zone of Cabbage Wilt Disease bacterium, the right side is that streptomyces lydicus (Streptomyces lydicus) AM02 is to the inhibition zone of Cabbage Wilt Disease bacterium.
Pathogenic bacteria among the B is withered germ of water-melon, the left side be streptomyces lydicus (Streptomyces lydicus) A02 to the inhibition zone of withered germ of water-melon, the right side is that streptomyces lydicus (Streptomyces lydicus) AM02 is to the inhibition zone of withered germ of water-melon.
Fig. 6 A is that the HPLC of streptomyces lydicus active result separates spectrogram for the first time.
Fig. 6 B is that the HPLC of streptomyces lydicus active result separates spectrogram for the third time.
Fig. 7 is the UV scanning collection of illustrative plates of tennecetin sample.
Fig. 8 is the infrared absorption spectrum of tennecetin sample.
Fig. 9 A is the high resolution mass spectrum figure (negative ion) of tennecetin sample.
Fig. 9 B is the high resolution mass spectrum figure (positive ion) of tennecetin sample.
Figure 10 A is the carbon-13 nmr spectra (500MHz) of tennecetin sample.
Figure 10 B is the proton nmr spectra (500MHz) of tennecetin sample.
Embodiment
Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment if no special instructions, is ordinary method.
Used material, reagent etc. if no special instructions, all can obtain from commercial channels among the following embodiment.
Streptomyces expression vector pIB139(Christopher J.Wilkinson among the following embodiment, et al.Increasingthe Efficiency of Heterologous Promoters in Actinomycetes.J.Mol.Microbiol.Biotechnol. (2002) 4 (4): 417426.) public can obtain from the Beijing City Agriculture and Forestry Institute, to repeat the application's experiment.
Demethylation E.coliET12567 (pUZ8002) (Sun-Uk Choi among the following embodiment, Chang-KwonLee, Yong-Il Hwang, Hiroshi Kinoshita, and Takuya Nihira (2004) Cloning and FunctionalAnalysis by Gene Disruption of a Gene Encoding a γ-Butyrolactone Autoregulator Receptorfrom Kitasatospora setae.JOURNAL OF BACTERIOLOGY, 186:34233430.) public can obtain from the Beijing City Agriculture and Forestry Institute, to repeat the application's experiment.
Pathogenic bacteria Cabbage Wilt Disease bacterium among the following embodiment (Fusarium oxysporum f.sp.conglutinans) and withered germ of water-melon (F.oxysporumf.sp.niveum) (Sui Qin, Liu Weicheng, Qiu Jiyan, Liu Ting, Pan Zhengyan, Liu Xuemin. the antimicrobial spectrum of Streptomyces lydicus A02 and the stability of bacteriostatic activity thereof. plant protection, 2007,33 (5) 67-71; Lu Caige, Liu Weicheng, Liu Ting, Dong Dan, Zhang Taotao, Liu Dewen. streptomyces lydicus A01 active metabolite is to restraining effect and the mechanism thereof of Cabbage Wilt Disease bacterium. and Scientia Agricultura Sinica 2012,45 (18): 3764-3772) public can obtain from the Beijing City Agriculture and Forestry Institute, to repeat the application's experiment.
The restructuring streptomyces lydicus of embodiment 1, structure high yield tennecetin
One, the structure of cellulose enzyme gene expression vector pIB139-slnM
The expression vector name of the synthetic positive regulating gene of the tennecetin that present embodiment makes up is called pIB139-slnM, contains the synthetic positive regulating gene slnM of tennecetin in this carrier.The sequence of the synthetic positive regulating gene slnM of tennecetin is shown in SEQID No.2.SEQ ID No.2 is comprised of 1019 Nucleotide; the 1-13 position is Nde I recognition site and protection base; the 14-432 position is erythromycin resistant gene promoter-; the 433-1011 position is the encoding sequence of the synthetic positive regulating gene of tennecetin, and 1012-1019 is EcoRI recognition site and protection base.
The promotor that the synthetic positive regulating gene of this tennecetin of startup is transcribed among the pIB139-slnM is erythromycin resistant gene promoter-(SEQ ID No.3).
The concrete construction process of pIB139-slnM is as follows: the slnM fragment is connected through NdeI and the erythromycin resistant gene promoter-PermE that carries SEQ ID No.3 after the EcoRI enzyme is connected with the streptomyces expression vector pIB139(that cuts through same enzyme with NdeI in the two ends shown in the SEQ ID No.1 with the EcoRI restriction enzyme site) is connected, obtain NdeI and the fragment between the EcoRI of pIB139 are replaced with the recombinant expression vector pIB139-slnM that synthesizes positive regulating gene slnM sequence with self promotor tennecetin.PIB139-slnM transforms bacillus coli DH 5 alpha, with apramycin (apramycin) thus resistance screening obtains to carry the transformant of positive regulating gene and himself promoter sequence, this transformant is take p1(GGAATTCCATATGCGGTCGGAGGTGCGGGCATGAC) and p2(GGAATTCTCACTTCACGAAGTCGTCCAC) carry out the fragment that pcr amplification obtains about 1101bp as primer, with NdeI and EcoRI enzyme cut pIB139-slnM obtain the pIB139 plasmid fragment of 5.9kb and about 998bp with the synthetic positive regulating gene slnM sequence (Fig. 1) of self promotor tennecetin, thereby determine that this positive regulating gene double promoter expression vector successfully constructs.
Two, utilize pIB139-slnM to import streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 with the synthetic positive regulating gene slnM of self promotor tennecetin and obtain the tennecetin superior strain---streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815
The pIB139-slnM carrier is transformed demethylation E.coliET12567 (pUZ8002), and the method by amphiphilic engages transforms Streptomyces lydicus A02, obtains positive transformant by A Baila mycin resistance screening, and the PCR checking obtains correct transformant.Concrete method for transformation is as follows:
1) the pIB139-slnM carrier is transformed demethylation E.coliET12567 (pUZ8002)
By the heat shock method pIB139-slnM carrier is imported E.coliET12567 (pUZ8002) and obtains changing over to the recombinant bacterium E.coliET12567 (pUZ8002) of pIB139-slnM carrier/pIB139-slnM through 60 μ g/ml apramycin resistance screenings.
2) the restructuring streptomyces lydicus of amphiphilic engage build natamycin high yield
Reference (Bierman M et al.1992) carries out amphiphilic and engages, and concrete grammar is as follows:
Recombinant bacterium E.coliET12567 (pUZ8002)/pIB139-slnM is inoculated into the LB liquid nutrient medium that contains paraxin, kantlex and apramycin resistance, 37 ℃, 200rpm, overnight incubation, receive in the fresh LB substratum by 1% inoculum size and be cultured to OD morning next day 600=0.4-0.6 collects bacterium liquid, and 4 ℃, 4000rpm, centrifugal 2min abandons supernatant, with the ice-cold pure resuspended precipitation of LB nutrient solution of 20mL, 4 ℃, 4000rpm, centrifugal 2min abandons supernatant, and purpose is the flush away microbiotic.With the ice-cold pure resuspended precipitation of LB nutrient solution of 2mL.(2) grown in PDA inclined-plane streptomyces lydicus (Streptomyces lydicus) the A02CGMCC No.1654(CN100467588C in 2 weeks) spore elutes with aseptic double-distilled water, and with sample injector piping and druming evenly, prepares spore suspension.(3) 250 μ L strepto-spore suspensions add 500 μ L2 * YT nutrient solution, gently mixing.50 ℃ of thermal shock 10min, the activation spore.Streptomyces lydicus (Streptomyces lydicus) the A02CGMCC No.1654 spore suspension that 500 μ L recombinant bacterium E.coliET12567 (pUZ8002)/pIB139-slnM bacterium liquid and 500 μ L activate, gently mixing.4000rpm, the centrifugal 3min of room temperature removes supernatant, and the mixing precipitation is coated MS substratum+10mM/L MgCl 2, 28 ℃ of inversions are cultured to morning next day (18h), are coated with afterwards antibiotic solution and (0.5mg nalidixic acid and 60 μ g apramycins are dissolved in 1mLddH 2The liquid that obtains among the O).Picking list bacterium colony is to the MS flat board of the new above-mentioned antibiotic solution of adding after 2-3 days.The bacterium colony above-mentioned p3(AGCTCATCGGTCAGCTTCTC of picking on this MS flat board) and p4(GGCATCGCATTCTTCGCATC) carry out pcr amplification apramycin resistant gene, a strain wherein can be obtained recombinant bacterium called after streptomyces lydicus (Streptomyces lydicus) AM02 of the amplified production of 731bp.Streptomyces lydicus (Streptomyces lydicus) AM02 has been preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center on November 12nd, 2012, the preservation center numbering of registering on the books: CGMCC No.6815.
The morphological specificity of streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 thalline is as follows: Gram-positive; After 7 days, substrate mycelium physically well develops, and without tabula, does not rupture in the growth of GYM nutrient agar; The aerial hyphae well-grown, multi-branched; Fibrillae of spores is flexible or crooked, and spore is oval.
Three, the synthetic tennecetin ability of streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815
Used substratum is as follows:
Gause I slant medium: K 2HPO 40.5g, NaCl0.5g, KNO 31.0g, FeSO 47H 2O0.01g, MgSO 47H 2O0.5g, Zulkovsky starch 20g, agar 20g, water 1000ml; PH7.2-7.4.
Seed culture medium: 15g soybean grain (adding distil water boils 0.5-1h, gets filtrate), 5g peptone, 2.5g ammonium sulfate, 20g glucose, 10g starch, 0.25g sal epsom, 0.2g potassium primary phosphate, 5g sodium-chlor, be made into the aqueous solution, behind the accent pH7-8, add 1g calcium carbonate, add water and be settled to 1000ml.
Fermention medium: 15g soybean grain (adding distil water boils 0.5-1h, gets filtrate), 5g peptone, 2.5g ammonium sulfate, 10g sucrose, 10g starch, 0.25g sal epsom, 0.2g potassium primary phosphate, 5g sodium-chlor, be made into the aqueous solution, behind the accent pH7-8, add 1g calcium carbonate, add water and be settled to 1000ml.
Not with the YEME substratum of sucrose: the 3g yeast extract, the 5g peptone, the 3g malt extract, 10g glucose adds water and is settled to 1000ml, adds 2ml2.5M MgCl after the sterilization 2
A, in fermention medium, produce tennecetin
Streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 and streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 are inoculated into respectively on the Gause I slant medium, cultivated 7-10 days for 28 ℃, treat that it produces the spore of capacity, encircle in the 50ml seed culture medium that is inoculated in the 250ml triangular flask with aseptic its spore of platinum loop scraping 2-3, put on the temperature controllable shaking table, under 28 ℃ of conditions, 200rpm(rotation radius 13mm) constant-temperature shaking culture 24h-30h; Then under aseptic condition, its minute be connected to (every bottled liquid measure is 100ml) in 60 fermention mediums in the 500ml triangular flask, streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 is identical with the inoculum size of streptomyces lydicus (Streptomyceslydicus) AM02CGMCC No.6815, OD after every bottle graft kind 600Value is 0.1; Postvaccinal shaking flask is under 31 ℃ of conditions, with 240rpm(rotation radius 13mm) speed oscillation cultivate 0,24,48,72,96,120h, get the output that fermented liquid is measured tennecetin.The experiment triplicate.
B, do not producing tennecetin in the YEME substratum with sucrose
With streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 and streptomyces lydicus
(Streptomyces lydicus) AM02CGMCC No.6815 is inoculated into respectively on the Gause I slant medium, cultivated 7-10 days for 28 ℃, treat that it produces the spore of capacity, encircle in the 50ml seed culture medium that is inoculated in the 250ml triangular flask with aseptic its spore of platinum loop scraping 2-3, put on the temperature controllable shaking table, under 28 ℃ of conditions, 200rpm(rotation radius 13mm) constant-temperature shaking culture 24h-30h; Then under aseptic condition, its minute be connected in the not YEME substratum with sucrose in 70 500ml triangular flasks (every bottled liquid measure is 100ml), streptomyces lydicus (Streptomyceslydicus) A02CGMCC No.1654 is identical with the inoculum size of streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815, and the OD600 value is 0.1 after every bottle graft kind; Postvaccinal shaking flask is under 31 ℃ of conditions, with 240rpm(rotation radius 13mm) speed oscillation cultivate 0,24,48,72,96,120h, get the output that fermented liquid is measured tennecetin.The experiment triplicate.
C, tennecetin volume analysis
The 1mL fermented liquid that above step is obtained adds 9mL methyl alcohol, fully after the vibration, carry out the 30min ultrasonic extraction, 5000rpm/min centrifugal 10-15min sedimentation mycelium and solid substance, 10 times of aseptic filtering with microporous membrane of using afterwards 0.45 μ m of supernatant liquor dilution, collect filtrate, the gained sample is used for HPLC and detects.Chromatographic column: the C18 post (5 μ m, 4.6mm * 200mm); Detect wavelength: 303nm; Flow velocity: 1.00mL/min; Sample size: 10 μ L; Detect column temperature: 30 ℃; Experiment moving phase is V (methyl alcohol): V (water)=65: 35.Adopt external standard method (calibration curve method) that tennecetin is carried out quantitatively take tennecetin (sigma-P9703) as standard substance.
Experimental result shows, streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 shake flask fermentation is the 1.148g/L substratum in YEME substratum top fermentation 72 hourly outputs with sucrose not, is the 5.338g/L substratum in fermention medium top fermentation 96 hourly outputs; Streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 shake flask fermentation is the 0.375g/L substratum in YEME substratum top fermentation 72 hourly outputs with sucrose not, is the 2.546g/L substratum in fermention medium top fermentation 96 hourly outputs.Illustrating that streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 tennecetin output is wild type strain streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 3 times (Fig. 3) on the YEME substratum with sucrose not approximately, is 2 times (Fig. 4) of wild type strain streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 approximately on fermention medium.
Wherein, in the streptomyces lydicus fermented liquid tennecetin slightly carry with authentication method as follows:
One) slightly the carrying of tennecetin in the fermented liquid
The fermented liquid of above-mentioned streptomyces lydicus is used respectively the dehydrated alcohol pre-treatment of 3 times of volumes, 4 ℃ leave standstill 2h, with precipitation thalline, solid particles, solubility sticking jelly, nucleic acid and heteroproteins and mesostate etc., supernatant liquor with 2 metafiltration paper with the Büchner funnel vacuum filtration, filtrate through Rotary Evaporators at 45 ℃ of lower concentrating under reduced pressure, concentrated solution is the tennecetin crude extract, and 4 ℃ save backup.
Two), the separation and purification of tennecetin crude extract
Carry out progressively separation and purification by macroporous resin column chromatography, silica gel column chromatography and high performance liquid chromatograph HPLC.
1, macroporous resin adsorption column chromatography
Select 40cm * 2.6cm glass chromatography column, X-5 macroporous resin (Tianjin Nankai university chemical plant).Macroporous resin is mixed well with appropriate amount of deionized water after by producer explanation pre-treatment, slowly adds and is equipped with in the chromatography column of 1/3 volumes of deionized water, emits distilled water from the column bottom with uniform speed slow simultaneously, makes that liquid level remains at above the resin layer in the post.Be filled to about 3/4 post height, natural subsidence 6～10h, making the dress column volume after the balance is 150ml.
Get tennecetin crude extract and resin and carry out dynamic adsorption by the volume ratio of 1 ﹕ 1.Elution process is: the deionized water wash-out remove portion pigment of 2 times of column volumes and a large amount of water-soluble impurity; The 30%(volumn concentration of 2 times of column volumes) the methanol-eluted fractions element that discolors; Use at last the 70%(volumn concentration of 2 times of column volumes) the ethanol elution activeconstituents.Be in charge of the collection elutriant, every pipe 15ml, the filter paper method is carried out determination of activity.
The result shows that active eluant concentrates on the 48th～56 pipe (i.e. elutriant between 4.8 times of column volume to 5.6 times column volumes).With active eluant, supply next step separation behind 45 ℃ of lower concentrating under reduced pressure.
2, silica gel adsorption column chromatography
Select 40cm * 2.6cm glass chromatography column, 100 orders～200 order silica gel, the mixed solution take volume ratio as ethanol, ammoniacal liquor and the water of 8 ﹕, 1 ﹕ 1 is as elutriant; Get about 150g silica gel and soak 3h with deionized water, the fine particle that inclines, the Büchner funnel vacuum filtration is removed moisture; Soak 12h with 6mol/LHCl again, then be washed till neutrality with deionized water, vacuum is drained; Spend the night with soaked in absolute ethyl alcohol, vacuum is drained; Under 120 ° of C, activate 2h before use, be dried to constant weight; Then pack in the chromatography column elutriant of 1/3 column volume slowly adds the silica gel that mixes with elutriant, stops when high to 3/4 post approximately adding, and leaves standstill 6～10h, makes the slow sedimentation of silica gel.Then with the elutriant of 2～3 times of volumes flow velocity flushing cylinder with 1mL/min, make it balance.Column volume after the balance is 150ml.The active wash-out concentrated solution of the macroporous resin 10ml upper prop of getting step 1 carries out dynamic adsorption, carries out wash-out with the elutriant of 2～3 times of column volumes by the flow velocity of 0.5ml/min, is in charge of the collection elutriant with automatic Fraction Collector, every pipe 5ml.Take S. cervisiae ACCC20036 as indicator, it is active to utilize the filter paper agar diffusion method to detect every pipe elutriant.The result shows: the active ingredient in its elutriant concentrates on the 7th～36 pipe (i.e. elutriant between 0.23 times of column volume to 1.2 times column volume).With active eluant, supply next step separation behind 45 ℃ of lower concentrating under reduced pressure.
3, preparation HPLC separation and purification
Adopt LC-9101 type circulation preparative HPLC, JAIGEL-ODS-AP type SP-120-15 preparative column.
Get the active wash-out concentrated solution behind the silica gel column chromatography of step 2, filter automatic sampler sample introduction, each sample size 6ml with 0.45 μ m millipore filter; Take methyl alcohol: water (volume ratio is as 7:3) separates as moving phase, utilizes the UV detector to detect at wavelength 305nm place and automatically forms separating spectrum; Utilize run tank to collect respectively each corresponding elutriant in curve peak in the collection of illustrative plates; Take S. cervisiae ACCC20036 as indicator, it is active to utilize the filter paper agar diffusion method to detect every pipe elutriant.After carrying out separating the first time with the flow rate pump of 2ml/min, the flow rate pump with 3ml/min separates 2 times in succession again.
Experimental result shows that for the first time HPLC separation detects 30 peaks altogether, and wherein retention time is that the strong absorption peak of 57.866min is Peak Activity (Fig. 6 A), and its relative peak area is 35.121%; To its separation detection to the 6 peak second time that carries out, wherein retention time is that the peak of 41.699min is Peak Activity, and its relative peak area is 97.020%; Separation detection is that the peak of 39.766min is Peak Activity (Fig. 6 B) to retention time for the third time, is 99.845% by its purity of calculated by peak area.
Carry out vacuum concentration with separating for the third time the Peak Activity sample that obtains, be white in color after the drying or cream-colored powder, this sample is the tennecetin sample.Utilize Shimadzu analysis mode HPLC to adopt following method that it is carried out purity checking: the sample that takes a morsel is dissolved in 70% methanol aqueous solution, carries out gradient elution take methyl alcohol (A) and water (B) as moving phase.Chromatographic condition is: the C18 reversed-phase column, and 30 ℃ of column temperatures, the UV detector detects wavelength 305nm, and SIL-10ADVP automatic sampler sample introduction 10 μ l are with the flow velocity wash-out 60min of 1ml/min.The gradient elution step is as follows:
Figure BDA00002663619000091
The result shows that elution curve is single peak, illustrates that it is one-component, and purity reaches the requirement of determination of chemical structure.
Four, the parsing of purification of samples chemical structure is identified
1, ultra-violet absorption spectrum (UV)
The tennecetin sample denier of above-mentioned steps three purifying is dissolved in the ultrapure water, use the UV of Hitachi-the VIS3010 ultraviolet-visible pectrophotometer carries out full wavelength scanner take ultrapure water as blank in 190nm～400nm wavelength region, automatically form ultraviolet absorpting spectrum.
By the UV scanning collection of illustrative plates as seen, the tennecetin sample shows typical tetraenes microbiotic spectral pattern, near the absorption peak that typical conjugation tetraene chromophoric group is namely all arranged wavelength 281nm, 291nm, 305nm and 319nm, its medium wavelength 305nm place absorption value is maximum, 281nm place absorption value minimum (Fig. 7) illustrates that this material belongs to the tetraene microbiotic in the polyenoid class.
2, infrared absorption spectrum (IR)
Adopt the KBr pressed disc method, carry out 400cm with German BRUKER company's T ENSOR27 Fourier infrared spectrograph -1-4000cm -1The zone interscan.
The infrared spectra of tennecetin sample as shown in Figure 8, ν wherein Max3416.78cm -1Charateristic avsorption band for-OH; ν Max3288.23cm -1Stretching vibration charateristic avsorption band for N-H; ν Max2940.44 and 2980.27cm -1Be-CH 3Charateristic avsorption band; ν Max3017.23cm -1Be-CH 2Charateristic avsorption band; ν Max1715.38cm -1Show the strong absorption peak of typical carbonyl; ν Max1571.44cm -1The strong absorption peak of performance-C=C-; ν Max1634.40cm -1The weak absorption peak of performance-C=C-.
3, high resolution mass spectrum
Adopt the German BRUKER ultrahigh resolution 9.4T of company mixed type level Four bar fourier tandom mass spectrometer (9.4TQ-FT-MS); Condition: capillary4000, Dry Gas:4.0l/s, the source temperature: 180 ° of C, scan range:300～2000, syringe pump:1.5ml/min, data analysis software is Bruker DaltonicsDataAnalysis3.4.
The result shows, in the collection of illustrative plates that the tennecetin sample is analyzed, adopts the positive ion detection mode to detect adduct ion [M+Na] +Be m/z688.2937(Fig. 9 B); Adopt the negative ion detection mode to detect quasi-molecular ion [M-H] +Compound (Fig. 9 A) for m/z664.2975; Adopt the positive and negative ion detection mode that the tennecetin sample is detected analysis, determine that 664.2975 are molecular ion peak.
In sum, the molecular formula of the main active component of tennecetin sample is C 33H 47NO 13, molecular weight is 665; By formula: degree of unsaturation (n)=1+Nc+(Nn-Nh)/2(Nc: carbonatoms; Nn: nitrogen-atoms number; Nh: the degree of unsaturation of number of hydrogen atoms) calculating its molecular formula is 11, shows and contains a plurality of unsaturated link(age)s and ring etc. in its molecular structure.
4, nuclear magnetic resonance spectrum (NMR)
Take deuterium generation-dimethyl formamide (d-DMF) as solvent, take tetramethylsilane (TMS) as interior mark, measure under the room temperature.
Adopt Bruker AVANCE DRX-500 nuclear magnetic resonance spectrometer (German Bruker spectral instrument company), take deuterium generation-dimethyl formamide (d-DMF) as solvent, tetramethylsilane (TMS) is interior mark, carry out hydrogen compose ( 1HNMR) and carbon spectrum ( 13CNMR) mensuration; The former resonant frequency is 500.1325156MHZ, sampling number 32768 times; Latter's resonant frequency 125.7577612MHZ, sampling number are 65536 times.
Experimental result shows, the nucleus magnetic resonance of tennecetin sample 13Can find out in the C collection of illustrative plates (Figure 10 A) that the chemical shift (δ 165.217) of a carboxyl carbon atom is arranged in the molecule; The chemical shift of a carbonylic carbon atom (δ 178.603); The chemical shift of one group of conjugation tetraene carbon atom (δ 125.089～145.447); The chemical shift of one group of carbon atom that links to each other with hydroxyl (δ 66.102～70.326); Sugar ring upper five carbon atom resonance peaks (δ 71.194～97.894); Methine carbon atom resonance peak (δ 18.062, and δ 20.360).The nucleus magnetic resonance of 500 megahertzes 1Can find out in the H collection of illustrative plates (Figure 10 B) that ((δ 5.686～6.625ppm) in chemical shift CH=CH-) for the proton hydrogen that links to each other with four two keys on the polyenoid ring; (δ 4.187～4.741ppm) for the chemical displacement value of the proton hydrogen in five hydroxyls; (δ 1.274～2.439ppm) in the chemical shift of the proton hydrogen in five methylene radical and two methyl.
The above-mentioned experimental data of analysis-by-synthesis, the main active component of tennecetin sample are tennecetin, and its chemical structural formula is:
The bacteriostatic activity of embodiment 2, streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 is higher than streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654
Among this embodiment, used substratum is as follows:
Gause I slant medium: K 2HPO 40.5g, NaCl0.5g, KNO 31.0g, FeSO 47H 2O0.01g, MgSO 47H 2O0.5g, Zulkovsky starch 20g, agar 20g, water 1000ml; PH7.2-7.4.
Seed culture medium: 15g soybean grain (adding distil water boils 0.5-1h, gets filtrate), 5g peptone, 2.5g ammonium sulfate, 20g glucose, 10g starch, 0.25g sal epsom, 0.2g potassium primary phosphate, 5g sodium-chlor, be made into the aqueous solution, behind the accent pH7-8, add 1g calcium carbonate, add water and be settled to 1000ml.
Fermention medium: 15g soybean grain (adding distil water boils 0.5-1h, gets filtrate), 5g peptone, 2.5g ammonium sulfate, 10g sucrose, 10g starch, 0.25g sal epsom, 0.2g potassium primary phosphate, 5g sodium-chlor, be made into the aqueous solution, behind the accent pH7-8, add 1g calcium carbonate, add water and be settled to 1000ml.
1, the preparation of fungal diseases of plants inhibitor
Streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 and streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 are inoculated into respectively on the Gause I slant medium, cultivated 7-10 days for 28 ℃, treat that it produces the spore of capacity, encircle in the 50ml seed culture medium that is inoculated in the 250ml triangular flask with aseptic its spore of platinum loop scraping 2-3, put on the temperature controllable shaking table, under 28 ℃ of conditions, 200rpm/min(rotation radius 13mm) constant-temperature shaking culture 24h-30h; Then under aseptic condition, its minute be connected to (every bottled liquid measure is 100ml) in 10 fermention mediums in the 500ml triangular flask, streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 is identical with the inoculum size of streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815, OD after every bottle graft kind 600Value is 0.1; Postvaccinal shaking flask is under 31 ℃ of conditions, with 240rpm/min(rotation radius 13mm) speed oscillation cultivate 96h; This moment, bacterial strain produced the bacteriostatic activity meta-bolites of high density in fermented liquid.
The 1mL fermented liquid is added 9mL methyl alcohol, fully after the vibration, carry out the 30min ultrasonic extraction, 5000rpm/min centrifugal 10-15min sedimentation mycelium and solid substance, supernatant liquor dilutes 10 times of aseptic filtering with microporous membrane of using afterwards 0.45 μ m with methyl alcohol, collect filtrate, this filtrate is the methanol solution of streptomyces lydicus metabolite.Get respectively streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 metabolite methanol solution and streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 metabolite methanol solution, carry out the bacteriostatic activity test of following step 2.
2, bacteriostatic activity test
Supplying the examination target pathogens is Cabbage Wilt Disease bacterium (Fusarium oxysporum f.sp.conglutinans) and withered germ of water-melon (F. oxysporumf.sp.niveum).
Cultivate the Cabbage Wilt Disease bacterium (Fusarium oxysporum f.sp.conglutinans) of generation and the conidium of withered germ of water-melon (F. oxysporumf.sp.niveum) on the scraping PDA flat board, make bacteria suspension with sterilized water, be applied to equably on the freshly prepd PDA flat board, put in the Bechtop and dry up; Aseptic punch tool symmetric position punching around flat board with diameter 7mm, then inject streptomyces lydicus (Streptomyceslydicus) A02CGMCC No.1654 metabolite methanol solution 200 μ l or streptomyces lydicus (Streptomyceslydicus) AM02CGMCC No.6815 metabolite methanol solution 200 μ l in every hole, take 200ul methyl alcohol as contrast; 28 ℃ of lower cultivations 3 days, the right-angled intersection method is measured antibacterial circle diameter.Three repetitions of every processing.
Experimental result shows that streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654 metabolin methanol solution and streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 metabolin methanol solution can all produce obvious inhibition zone to Cabbage Wilt Disease bacterium (Fusarium oxysporum f.sp.conglutinans) and withered germ of water-melon (F. oxysporumf.sp.niveum) on the PDA flat board, and methyl alcohol all can not produce inhibition zone to Cabbage Wilt Disease bacterium (Fusarium oxysporum f.sp.conglutinans) and withered germ of water-melon (F.oxysporumf.sp.niveum) on the PDA flat board.Streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 metabolite methanol solution is respectively 36 ± 1.1mm to Cabbage Wilt Disease bacterium (Fusarium oxysporum f.sp.conglutinans) and withered germ of water-melon (F. oxysporumf.sp.niveum) antibacterial circle diameter, 47 ± 1.4mm, streptomyces lydicus (Streptomyceslydicus) A02CGMCC No.1654 metabolite methanol solution is respectively 20 ± 1.2mm to Cabbage Wilt Disease bacterium (Fusarium oxysporum f.sp.conglutinans) and withered germ of water-melon (F.oxysporumf.sp.niveum) antibacterial circle diameter, 21 ± 1.1mm(Fig. 5).Illustrate that streptomyces lydicus (Streptomyceslydicus) AM02CGMCC No.6815 metabolin methanol solution is 1.8 times of streptomyces lydicus (Streptomyces lydicus) A02CGMCCNo.1654 to the bacteriostatic activity of Cabbage Wilt Disease bacterium (Fusarium oxysporumf.sp.conglutinans), streptomyces lydicus (Streptomyces lydicus) AM02CGMCC No.6815 metabolin methanol solution is 2.2 times of streptomyces lydicus (Streptomyceslydicus) A02CGMCC No.1654 to the bacteriostatic activity of withered germ of water-melon (F.oxysporumf.sp.niveum).
Figure IDA00002663620100011
Figure IDA00002663620100021
Figure IDA00002663620100041

Claims (10)

1. make up the method for restructuring streptomyces lydicus, comprise the synthetic positive regulating gene importing of tennecetin is obtained the step that tennecetin output is higher than the restructuring streptomyces lydicus of described Host Strains as screening in the streptomyces lydicus of Host Strains;
The synthetic positive regulating gene of described tennecetin encode following a) or b) protein:
A) protein of aminoacid sequence shown in SEQ ID No.1;
B) with the replacement of one or several amino-acid residue among the SEQ ID No.1 and/or disappearance and/or interpolation and synthetic relevant with tennecetin by the protein of a) deriving.
2. method according to claim 1 is characterized in that: the encoding sequence of the synthetic positive regulating gene of described tennecetin is the 433-1011 position of SEQ ID No.2.
3. method according to claim 1 and 2 is characterized in that: the sequence of the synthetic positive regulating gene of described tennecetin is the 14-1011 position of SEQ ID No.2.
4. arbitrary described method according to claim 1-3, it is characterized in that: describedly the synthetic positive regulating gene of tennecetin is imported streptomyces lydicus as Host Strains comprise the steps: that expression vector with the synthetic positive regulating gene of described tennecetin imports in the intestinal bacteria and obtain recombination bacillus coli, more described recombination bacillus coli and described streptomyces lydicus as Host Strains are carried out parents and engage the described restructuring streptomyces lydicus of acquisition; In the expression vector of the synthetic positive regulating gene of described tennecetin, the promotor that starts the synthetic positive regulating gene of described tennecetin is erythromycin resistant gene promoter-.
5. arbitrary described method in 4 according to claim 1, it is characterized in that: described streptomyces lydicus as Host Strains is streptomyces lydicus (Streptomyces lydicus) A02CGMCC No.1654.
6. the restructuring streptomyces lydicus that is obtained by arbitrary described method in the claim 1 to 5.
7. restructuring streptomyces lydicus according to claim 6 is characterized in that: the bacterial strain of described restructuring streptomyces lydicus number is AM02, and it is numbered CGMCC No.6815 registering on the books of China Committee for Culture Collection of Microorganisms common micro-organisms center.
8. claim 6 or the 7 described restructuring streptomyces lydicuses application in producing natamycin.
9. claim 6 or the 7 described restructuring streptomyces lydicuses application in preparation plant pathogenic fungi inhibitor; Or the application in suppressing fungal diseases of plants.
10. application according to claim 9 is characterized in that: described plant pathogenic fungi is following at least a: Cabbage Wilt Disease bacterium (Fusarium oxysporum f.sp.conglutinans) and withered germ of water-melon (F.oxysporum f.sp.niveum);
Described fungal diseases of plants is following at least a: the disease that is caused by Cabbage Wilt Disease bacterium (Fusarium oxysporum f.sp.conglutinans) and the disease that is caused by withered germ of water-melon (F. oxysporum f.sp.niveum).
CN201210579816.5A 2012-12-27 2012-12-27 A recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof Active CN103060364B (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN201510011400.7A CN104611283B (en) 2012-12-27 2012-12-27 A kind of recombination streptomyces lydicus and its application
CN201210579816.5A CN103060364B (en) 2012-12-27 2012-12-27 A recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210579816.5A CN103060364B (en) 2012-12-27 2012-12-27 A recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CN201510011400.7A Division CN104611283B (en) 2012-12-27 2012-12-27 A kind of recombination streptomyces lydicus and its application

Publications (2)

Publication Number Publication Date
CN103060364A true CN103060364A (en) 2013-04-24
CN103060364B CN103060364B (en) 2015-01-07

Family

ID=48103258

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210579816.5A Active CN103060364B (en) 2012-12-27 2012-12-27 A recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof

Country Status (1)

Country Link
CN (1) CN103060364B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103923870A (en) * 2014-04-30 2014-07-16 山东大学 Genetically engineered bacterium for producing natamycin as well as construction method and application of genetically engineered bacterium
CN104480134A (en) * 2014-12-17 2015-04-01 北京市农林科学院 High-efficiency biocontrol recombinant streptomyces lydicus as well as construction method and application thereof
CN105431045A (en) * 2013-05-31 2016-03-23 帝斯曼知识产权资产管理有限公司 Microbial agriculture
CN105431044A (en) * 2013-05-31 2016-03-23 帝斯曼知识产权资产管理有限公司 Microbial agriculture

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101397579A (en) * 2007-09-29 2009-04-01 北京市农林科学院 Method for preparing natamycin

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101397579A (en) * 2007-09-29 2009-04-01 北京市农林科学院 Method for preparing natamycin

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
H.M. ATTA ET AL: "Biochemical studies on the natamycin antibiotic produced by streptomyces lydicus: fermentaion, extraction and biological activities", 《JOURNAL OF SAUDI CHEMICAL SOCIETY》 *
YILING DU ET AL: "Identification of a novel streptomyces chattanoogensis L10 and enhancing its natamycin production by overexpressing positive regulator ScnRII", 《THE JOURNAL OF MICROBIOLOGY》 *
亓芳 等: "纳他霉素及其生产菌育种研究进展", 《生物技术通报》 *
陈时飞: "一株新的纳他霉素生产菌L10的系统发育分析及其基因工程高产菌构建", 《中国博士学位论文全文数据库工程科技I辑》 *
隋勤 等: "利迪链霉菌A02 抗真菌活性产物的分离和结构鉴定", 《生物工程学报》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105431045A (en) * 2013-05-31 2016-03-23 帝斯曼知识产权资产管理有限公司 Microbial agriculture
CN105431044A (en) * 2013-05-31 2016-03-23 帝斯曼知识产权资产管理有限公司 Microbial agriculture
CN103923870A (en) * 2014-04-30 2014-07-16 山东大学 Genetically engineered bacterium for producing natamycin as well as construction method and application of genetically engineered bacterium
CN104480134A (en) * 2014-12-17 2015-04-01 北京市农林科学院 High-efficiency biocontrol recombinant streptomyces lydicus as well as construction method and application thereof

Also Published As

Publication number Publication date
CN103060364B (en) 2015-01-07

Similar Documents

Publication Publication Date Title
CN100590194C (en) Streptomyces lydicus producing natamycin and uses thereof
CN103060364B (en) A recombinant streptomyces lydicus producing natamycin, a construction method and applications thereof
CN101397579B (en) Method for preparing natamycin
CN101720772B (en) Macrolide composition for preventing and controlling fungal disease of crop and preparation process thereof
CN104611283A (en) Recombinational streptomyces lydicus and application thereof
KR0140218B1 (en) Ab-021 antibiotics and process for producing them
CN104480135A (en) Recombinant streptomyces lydicus for producing cellulase and natamycin and application
CN101720781B (en) New phosphorus and nitrogen mycin A for preventing and controlling fungal disease of crop and preparation process thereof
CN104480134A (en) High-efficiency biocontrol recombinant streptomyces lydicus as well as construction method and application thereof
FI65082C (en) FRAMEWORK FOR ANTIBIOTICS ACTIVATING ACTIVITIES
CN103074356B (en) Vector for knocking out streptomycete gene as well as constructing method and application of same
CN109182180B (en) A kind of application of the brown streptomycete of ash and its fermenting and producing bar bifilomycin A1
AU721483B2 (en) Novel polyene antibiotics, 3874 H1 to H6, processes for their preparation and use
CN108441427B (en) Arthriospora fungi and pyridone alkaloid compound produced by same
CN102993168B (en) Streptonigrin analog and preparation method thereof, purposes
CN100387609C (en) Novel antibiotic preparing process
US5516686A (en) Fungicidal antibiotic producing Streptomyces sp. NCIMB 40212
CN104480136A (en) Construction method of recombinant streptomyces lydicus for producing cellulase and natamycin
Balakrishnan et al. Growth and cyclosporin A production by an indigenously isolated strain of Tolypocladium inflatum
CN103045516B (en) Novel strain for producing natamycin and application thereof
KR970010955B1 (en) Ab-o11 antibiotics and process for producing them
CN110343639B (en) Streptomyces producing 15(S) -O-ethyl rapamycin
CN114920721B (en) Polyketide with anti-tumor activity and preparation method and application thereof
CN115504990B (en) Sugar-spiro-macrolide compound FW-5-39 and preparation method and application thereof
CN109321612A (en) A kind of method of fermenting and producing bar bifilomycin A1

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant