CN103060233B - A Bordetella petrii NS and applications of an immobilized enzyme thereof in the soil - Google Patents

A Bordetella petrii NS and applications of an immobilized enzyme thereof in the soil Download PDF

Info

Publication number
CN103060233B
CN103060233B CN201210579290.0A CN201210579290A CN103060233B CN 103060233 B CN103060233 B CN 103060233B CN 201210579290 A CN201210579290 A CN 201210579290A CN 103060233 B CN103060233 B CN 103060233B
Authority
CN
China
Prior art keywords
methano
hexahydro
degradation
soil
immobilized enzyme
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201210579290.0A
Other languages
Chinese (zh)
Other versions
CN103060233A (en
Inventor
朱鲁生
孔玲芬
王军
王金花
谢慧
王凤花
魏坤
苏坤昌
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Agricultural University
Original Assignee
Shandong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong Agricultural University filed Critical Shandong Agricultural University
Priority to CN201210579290.0A priority Critical patent/CN103060233B/en
Publication of CN103060233A publication Critical patent/CN103060233A/en
Application granted granted Critical
Publication of CN103060233B publication Critical patent/CN103060233B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention provides a Bordetella petrii NS and applications of an immobilized enzyme thereof in the soil, wherein the accession number is CCTCC No: M 2012327. The Bordetella petrii NS has the ability of degrading endosulfan in a slightly alkaline environment, and is capable of degrading residual endosulfan in water, soil and other objects safely, efficiently and rapidly, thereby reducing damage to the environment caused by the endosulfan harm, and repairing endosulfan contaminated soil and protecting the environment. The immobilized enzyme prepared by using the strain of the invention is simple in preparation process, low in cost, high in efficiency, and free of secondary pollution, thus having important practical values and good application prospects.

Description

One strain 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS and the application of immobilized enzyme in soil thereof
Technical field
The present invention relates to a strain 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS and the application of immobilized enzyme in soil thereof, belong to biological degradation processing technology field.
Background technology
Chemistry 1,2,3,4,7,7-chlordene dicyclo (2,2,1) by name hept-2-ene"-5 of 5a,6,9,9a-hexahydro-6,9-methano-2,4 (Endosulfan), the two methylol sulfites of 6-, molecular formula is C 9h 6cl 6o 3s, molecular weight is 406.91, and the former medicine of 5a,6,9,9a-hexahydro-6,9-methano-2,4 is solid at normal temperatures and pressures, is often the mixture of two kinds of isomer (α-5a,6,9,9a-hexahydro-6,9-methano-2,4 and β-5a,6,9,9a-hexahydro-6,9-methano-2,4, the two ratio is 7:3), and chemical structural formula is as follows:
5a,6,9,9a-hexahydro-6,9-methano-2,4 sterling is white crystal, and mixture is brown crystal.There is sulfurous gas smell; The relative density of 5a,6,9,9a-hexahydro-6,9-methano-2,4 is 1.745g/cm 3, at the saturation vapour pressures of 25 ℃ 1.33 * 10 3pa, fusing point is 70-100 ℃; Water insoluble, be dissolved in dimethylbenzene, chloroform, acetone and other organic solvent; Unstable in alkaline matter, and be slowly hydrolyzed to glycol and sulfurous gas; Meet moisture decomposition failure gradually; Forbidden to deposit in the environment such as strong oxidizer, strong acid, highly basic, damp atmosphere, to daylight stable.α-5a,6,9,9a-hexahydro-6,9-methano-2,4 and β-5a,6,9,9a-hexahydro-6,9-methano-2,4 have obvious lipotropy, are in close proximity to the standard of the definite POPs material logKOW > 5 of United Nations Environment Programme (UNEP), show that 5a,6,9,9a-hexahydro-6,9-methano-2,4 has the potentiality of biological accumulation.In the 5th conference of contracting party of < < Convention of Stockholm > > of holding for 2011,5a,6,9,9a-hexahydro-6,9-methano-2,4 is put into banned substance list, the whole world by 5 years, realize afterwards forbid 5a,6,9,9a-hexahydro-6,9-methano-2,4 production, use and import and export.
5a,6,9,9a-hexahydro-6,9-methano-2,4 by the development in 1954 of German FarbwerkHoechst company, is organochlorine insecticide the earliest, uses history to surpass 50 years, and in agricultural, accumulative total whole world use 5a,6,9,9a-hexahydro-6,9-methano-2,4 amount estimates it is 30.8 ten thousand tons.5a,6,9,9a-hexahydro-6,9-methano-2,4 is widely used in China, and the usage quantity of annual 5a,6,9,9a-hexahydro-6,9-methano-2,4 is estimated average 2800 tons.The main path of 5a,6,9,9a-hexahydro-6,9-methano-2,4 entered environment is the extensive use in agriculture production, causes large-area soil, water source to be subject to the pollution of 5a,6,9,9a-hexahydro-6,9-methano-2,4.At China's 5a,6,9,9a-hexahydro-6,9-methano-2,4, be widely used in the prevention and control of plant diseases, pest control of cotton field and tealeaves, caused serious soil pollution and residual the exceeding standard of farm crop 5a,6,9,9a-hexahydro-6,9-methano-2,4, simultaneously can enrichment in fish body due to 5a,6,9,9a-hexahydro-6,9-methano-2,4, also caused fishery products 5a,6,9,9a-hexahydro-6,9-methano-2,4 to exceed standard.Due to the spray application of 5a,6,9,9a-hexahydro-6,9-methano-2,4, in atmosphere, also have a certain amount of residually, it can be transported at a distance.Meta-bolites sulfuric ester, alcohol, ether, hydroxy ethers and lactone, but only have 5a,6,9,9a-hexahydro-6,9-methano-2,4 sulfuric ester still containing element sulphur, there is the toxicity higher than 5a,6,9,9a-hexahydro-6,9-methano-2,4.
At present, except forbidding the production and application of 5a,6,9,9a-hexahydro-6,9-methano-2,4, also there is no method for repairing 5a,6,9,9a-hexahydro-6,9-methano-2,4 contaminated soil.Immobilized enzyme is the pollution remediation technology growing up on the basis of biological restoration, is considered in organic pollutant bioremediation technology the most effectively, the most feasible and the most reliable method.The immobilization of enzyme is by originally free water-soluble enzyme restriction or is fixed on the space or solid carrier of a certain part, immobilized enzyme through filtration or centrifugal after, can prolonged and repeatedly use.Process for fixation has physisorphtion, crosslinking, covalent coupling method and entrapping method etc.Entrapping method does not need the amino-acid residue of chemically modified zymoprotein, and reaction conditions is gentle, seldom changes enzymatic structure, is most widely used.The present invention utilizes the immobilized enzyme of 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria to add in soil, the 5a,6,9,9a-hexahydro-6,9-methano-2,4 of can degrading rapidly, shorten this feature of transformation period of 5a,6,9,9a-hexahydro-6,9-methano-2,4, filter out the microorganism with degraded 5a,6,9,9a-hexahydro-6,9-methano-2,4 ability, extract its degrading enzyme being fixed, be applied in 5a,6,9,9a-hexahydro-6,9-methano-2,4 contaminated soil, to reach the object of repairing 5a,6,9,9a-hexahydro-6,9-methano-2,4 contaminated soil.
Summary of the invention
In order to address the above problem, the invention provides a strain 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS and the application of immobilized enzyme in soil thereof; The present invention filters out the 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS in slight alkali environment with degraded 5a,6,9,9a-hexahydro-6,9-methano-2,4 ability, to reach the object of repairing 5a,6,9,9a-hexahydro-6,9-methano-2,4 contaminated soil.
The present invention gathers separation and has obtained a strain 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS from the sewage of sewage work's discharge of production 5a,6,9,9a-hexahydro-6,9-methano-2,4 agricultural chemicals, belongs to Bordetella petrii, the experiment proved that it has degradation capability to 5a,6,9,9a-hexahydro-6,9-methano-2,4.
One strain 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS (Bordetella petrii NS), has been preserved in Chinese Typical Representative culture collection center (being called for short CCTCC), address: Wuhan, China Wuhan University on September 6th, 2012; Preserving number is CCTCC No:M 2012327.
A described strain 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS morphological specificity is as follows: NS bacterium colony pinkiness, and opaque, smooth surface, bacterium colony is circular, less, surrounding rule, under microscope, observation of cell is shaft-like, Gram-positive.
The total DNA of 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS of take is template, utilize bacterial 16 S rDNA universal primer (27F:AGAGTTTGATCCTGGCTCAG, 1392R:ACGGGCGGTGTGTAC) carry out pcr amplification, obtain being about the amplified production of 1.4kb, order-checking is completed by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd, and its nucleotide sequence is as shown in SEQ ID NO 1.
According to the comparison of Gene Bank sequence homology, 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS and Bordetella pe trii are in a minimum branch together, and homology is up to 99%.In conjunction with the physiological and biochemical property of bacterial strain, 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS is initially identified as to the rich name of Whooping cough special Salmonella NS (Bordetella petrii NS), called after 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS(Bordetella petrii NS).
Through the degradation characteristic research of 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS is found: suitable NS growth and temperature when 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation rate is reached to maximum thereof are 35 ℃, and pH is 8.0, connects bacterium amount 2%; Under optimum temps and pH condition, 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS5d is interior to 100 μ gmL -1the degradation rate of 5a,6,9,9a-hexahydro-6,9-methano-2,4 reaches more than 80%, and during 21d, 5a,6,9,9a-hexahydro-6,9-methano-2,4 is almost all degraded.
By GC-MS, analyze, 5a,6,9,9a-hexahydro-6,9-methano-2,4 is degraded and is formed 5a,6,9,9a-hexahydro-6,9-methano-2,4 glycol, 5a,6,9,9a-hexahydro-6,9-methano-2,4 lactone and 5a,6,9,9a-hexahydro-6,9-methano-2,4 ether under 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS effect, does not find the degraded product 5a,6,9,9a-hexahydro-6,9-methano-2,4 vitriol of high poison.
By being fixed of 5a,6,9,9a-hexahydro-6,9-methano-2,4 degrading enzyme of extracting, measure its degradation capability in 5a,6,9,9a-hexahydro-6,9-methano-2,4 contaminated soil from 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS.Result shows, accelerated the degraded of 5a,6,9,9a-hexahydro-6,9-methano-2,4 in soil after adding the immobilized enzyme of 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS, reduced the eco-toxicity of 5a,6,9,9a-hexahydro-6,9-methano-2,4 to soil and environment.
Beneficial effect of the present invention is mainly reflected in: 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS of the present invention can be applied to by making the mode of immobilized enzyme the degraded of 5a,6,9,9a-hexahydro-6,9-methano-2,4 in environment; the residual 5a,6,9,9a-hexahydro-6,9-methano-2,4 on the objects such as water body, soil of safely, efficiently, fastly degrading; thereby reduce the harm that 5a,6,9,9a-hexahydro-6,9-methano-2,4 causes environment, play the effect of repairing 5a,6,9,9a-hexahydro-6,9-methano-2,4 contaminated soil, preserving the ecological environment.The immobilized enzyme preparation technology of this bacterial strain is simple, and cost is low, efficiency is high, non-secondary pollution, has important realistic price and good application prospect.
Accompanying drawing explanation
Fig. 1 is bacterial strain NS scanning electron microscope picture of the present invention;
Fig. 2 is the phylogeny tree graph of bacterial strain NS of the present invention;
This figure can find out the evolutionary relationship of bacterial strain NS and homologous strain;
Fig. 3 is the gas chromatogram of 5a,6,9,9a-hexahydro-6,9-methano-2,4 sample in isolation and purification culture base
As benchmark, go out the degradation rate of NS to 5a,6,9,9a-hexahydro-6,9-methano-2,4;
Fig. 4 is the degradation curve figure of the growth curve of NS and the 5a,6,9,9a-hexahydro-6,9-methano-2,4 that is 100mg/L to concentration
This figure has illustrated that bacterial strain NS just can reach 80% left and right to the degradation rate of 5a,6,9,9a-hexahydro-6,9-methano-2,4 when 5d;
Fig. 5 is that initial pH value is on the impact of the growth of bacterial strain NS and degradation capability (5d)
Optimal pH in the time of can judging bacterial strain NS degraded 5a,6,9,9a-hexahydro-6,9-methano-2,4 by this figure;
Fig. 6 is that initial 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration is on the impact of the growth of bacterial strain NS and degradation capability (5d)
The suitableeest 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration in the time of can judging bacterial strain NS degraded 5a,6,9,9a-hexahydro-6,9-methano-2,4 by this figure;
Fig. 7 is for initially to add bacterium amount to the impact of the growth of bacterial strain NS and degradation capability (5d)
The suitableeest bacterium amount that adds in the time of can judging bacterial strain NS degraded 5a,6,9,9a-hexahydro-6,9-methano-2,4 by this figure;
Fig. 8 is that initial temperature is on the impact of the growth of bacterial strain NS and degradation capability (5d)
Optimum temperuture in the time of can judging bacterial strain NS degraded 5a,6,9,9a-hexahydro-6,9-methano-2,4 by this figure;
Fig. 9 is the degraded of bacterial strain NS under optimum condition dynamically (21d)
This figure has reflected that bacterial strain NS changes the process of fast degradation 5a,6,9,9a-hexahydro-6,9-methano-2,4 under optimum condition along with the time;
Figure 10 is the total ion current scanning spectra (Figure 10 is formed automatically by gaseous mass spectrum instrument system) of sample after 5a,6,9,9a-hexahydro-6,9-methano-2,4 degraded
By this figure, can determine the degraded product that NS degraded 5a,6,9,9a-hexahydro-6,9-methano-2,4 produces;
Embodiment
Below in conjunction with concrete case study on implementation, the present invention is described further, but protection scope of the present invention is not limited in this:
Embodiment 1: screening and the evaluation of 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS
Substratum:
Inorganic salt basic medium: 5.8g K 2hPO 4, 4.5g KH 2pO 4, 2.0g (NH 4) 2sO 4, 0.16g MgSO 4, 0.02g CaCl 2, 0.002 g Na 2moO 4, 0.001 g FeSO 4, 0.001 g MnCl 2, deionized water 1L, is adjusted to pH7.0,121 ℃ of sterilizing 30min.
Contain a small amount of carbon source substratum: in above-mentioned inorganic salt basic medium, add 5.0g peptone, be adjusted to pH7.0,121 ℃ of sterilizing 30min.
Isolation and purification culture base: add 5a,6,9,9a-hexahydro-6,9-methano-2,4 above-mentioned containing in a small amount of carbon source substratum, and the concentration that makes 5a,6,9,9a-hexahydro-6,9-methano-2,4 in substratum is 100 μ gmL -1, agar 15.0g, is adjusted to pH7.0,121 ℃ of sterilizing 30min.
LB substratum: peptone 10.0g, yeast extract paste 5.0g, NaCl10.0g is dissolved in 1L deionized water, adjusts pH to 7.0,121 ℃ of sterilizing 30min.
1) bacterial strain concentration and separation:
5a,6,9,9a-hexahydro-6,9-methano-2,4 discharge outlet mud, soil and the water sample that insecticide factory is gathered is as the source of microorganism enrichment separation and Culture.Adopt direct method of isolation and two kinds of methods of liquid enrichment culture, separated 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria from gathered sample.
Direct method of isolation: get mud 5g or sewage 5mL in containing in the triangular flask of sterilized water 95mL, obtain 10 -2soil diluent; With the 1mL transfer pipet of sterilizing, pipette 0.5mL10 -2soil diluent, inject a test tube that fills 4.5mL sterilized water, fully shake up, obtain 10 -3diluent; Change again the pipette, extract 0.5mL 10 of a 1mL sterilizing -3diluent, injects a test tube that fills 4.5mL sterilized water, fully shakes up, and obtains 10 -4diluent.The rest may be inferred, and serial dilution is made into 10 -5, 10 -6etc. a series of concentration dilution liquid, for plate isolation.By 10 -4, 10 -5, 10 -6the mud diluent of three concentration is inoculated into and contains 100 μ gmL -1on the isolation and purification culture base flat board of 5a,6,9,9a-hexahydro-6,9-methano-2,4.With spreading rod coating evenly, be placed in 30 ℃ of biochemical cultivation cases and cultivate, the microorganism of gained carries out separation and purification, obtains the bacterial strain that several strains have degradation capability after purifying, preserves stand-by.
Liquid enrichment culture method: take mud 10g and put into 100mL inorganic salt basic medium, in substratum, the concentration of 5a,6,9,9a-hexahydro-6,9-methano-2,4 is 200 μ gmL -1, in 30 ℃, 130rmin -1shaking table is cultivated, and cultivates after one week, in 10% inoculum size access inorganic salt basic medium, shifts once weekly repeated multiple times domestication like this later.Finally, with plate dilution method, carry out separation and purification, after purifying, obtain the bacterial strain that several strains have degradation capability, preserve stand-by.
A few strain bacterial classifications that above-mentioned separation and purification is obtained are cultivated 48h respectively at connecing bacterium in culture dish, add appropriate aqua sterilisa, and with connecing the collarium bacterium colony on scraping surface gently, make rough bacteria suspension, transfer them in the triangular flask of 150mL sterilizing, with physiological saline modulation cell concentration, make its OD 600be 1.0, shaking culture 3h in shaking culture case, the nutrition composition carrying to eliminate thalline.Then with aqua sterilisa, adjust cell concentration, be mixed with OD 600be 1.0 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria bacteria suspension, standby.
Preparation is containing 100 μ gmL -1the isolation and purification culture base of 5a,6,9,9a-hexahydro-6,9-methano-2,4, gets in the test tube that 5mL joins 18mm * 180mm, and each bacterial classification is established the test tube of 3 repetitions, by the above-mentioned OD600 preparing at the bacteria suspension of 1.0 left and right by each test tube 2%(mass ratio) the bacterium amount that connects inoculation.30 ℃, 160rmin -1lucifuge shaking culture, takes out test tube after cultivation 5d, measures the residual concentration of 5a,6,9,9a-hexahydro-6,9-methano-2,4, obtains degradation rate.Choose the bacterial strain called after NS that wherein degradation rate is higher.
2) identification of strains:
The NS bacterial strain of above-mentioned acquisition is carried out to colonial morphology and Physiology and biochemistry evaluation, and the electromicroscopic photograph of this bacterial strain as shown in Figure 1.The main biological property of this bacterial strain is: NS bacterium colony pinkiness, and opaque, smooth surface, bacterium colony is circular, less, surrounding rule, under microscope, observation of cell is shaft-like, Gram-positive.The optimum growth conditions of this bacterial strain is pH value 7.0,30 ℃ of temperature.This bacterial strain is accredited as Bordetella petrii through 16S rDNA sequential analysis.
Embodiment 2 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS 16S rDNA sequential analyses
1. the extraction of the total DNA of 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS
In experiment, utilize MI BIO PowerSoil DNA Isolation Kit to extract total DNA in soil, main operational steps is improved a little on the basis of former operation instruction, and idiographic flow is as follows:
1) yeast culture: NS is in LB substratum, in 30 ℃ of shaking culture 18h for inoculation 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria;
2) microorganism collection: weigh 10ml centrifuge tube blank pipe weight record.Get 5mL nutrient solution in 10mL centrifuge tube, 8000rmin -1centrifugal 8min, abandons supernatant liquor, collects thalline.Again weigh 10ml centrifuge tube weight the record that thalline is housed, the difference of twice weighing value is this thalline quality.With sterilized water: the dilution proportion of thalline (mass ratio) 3:1 also mixes, and obtains bacteria suspension;
3) bath of fetching boiling water, is adjusted to 60 ℃, and Solution C1 is put into water-bath, and precipitation is disappeared;
4) get step 2) in the bacteria suspension 0.5mL that collects add in PowerBead pipe, whirlpool gently mixes;
5) in PowerBead pipe, add 60 μ L Solution C1, of short duration vortex mixes;
6) vortex vibration 10min;
7) under room temperature, the centrifugal 2min of 10000 * g;
8) avoid soil particle, transferase 45 00 μ L supernatant liquor is to clean 2mL collection tube;
9) in 2mL collection tube, add 250 μ L Solut ion C2, after vortex vibration 5s, at 4 ℃, cultivate 5min;
10) under room temperature, 10,000 * g, centrifugal 2mL collection tube 3min;
11) avoid particle, shift the supernatant liquor of 650 μ L to clean 2mL collection tube;
12) in 2mL collection tube, add 200 μ L Solut ion C3, after of short duration vortex vibration, at 4 ℃, cultivate 5min;
13) under room temperature, 10,000 * g, centrifugal 2mL collection tube 3min;
14) avoid particle, shift the supernatant liquor of 750 μ L to clean 2mL collection tube;
15) rock and mix after Solution C4, in 2mL collection tube, add 1,200 μ L Solution C4, vortex vibration 5s.
16) pipette about 675 μ L supernatant liquors to Spin Filter, under room temperature, 10,000 * g, centrifugal 3min.Outwell waste liquid, then add 675 μ L supernatant liquors to Spin Filter, under room temperature, 10,000 * g, centrifugal 3min.Outwell waste liquid, add remaining supernatant liquor to Spin Filter, under room temperature, 10,000 * g, centrifugal 3min;
17) in Spin Filter, add 500 μ L Solution C5, under room temperature, 10,000 * g, centrifugal 2 min;
18) outwell after waste liquid, under room temperature, 10,000 * g, empty centrifugal Spin Filter 3 min;
19) carefully Spin Filter is put into clean 2mL collection tube, avoid Solution C5 to spill on Spin Filter;
20) add 60 μ L Solution C6 in the white filter membrane of central authorities place, wash-out Spin Filter film;
21) under room temperature, 10,000 * g, centrifugal 3min;
22) abandon Spin Filter, in-20 ℃, preserve DNA in pipe.To in the thalline collected
2. the 16S rDNA of 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS amplification
Primer: 5 ' end primer is 27F(5 '-AGAGTTTGATCCTGGCTCAG-3 '), 3 ' end primer is 1392R(5 '-ACGGGCGGTGTGTAC-3 ').
Pcr amplification reaction system (50 μ L): 5.0 μ L 10 * PCR Buffer, 2.0 μ L2.5mM dNTP mixed solutions, 5.0 μ L 25mM MgCl2 solution, 2.0 μ L primer 1(27F), 2.0 μ L primer 2s (1392R), 1.0 μ L Taq archaeal dna polymerases, 1.0 μ L template DNAs, 32.0 μ L distilled waters.
PCR reaction conditions: 94 ℃ of denaturation 1min; 94 ℃ of sex change 1min, 58 ℃ of annealing 1min, 72 ℃ are extended 2min, circulating reaction 28 times, 72 ℃ are extended 10min, 10 ℃ of insulations.
Get 5 μ L reactants and in suitable sepharose, check that the expection of PCR product is big or small, with EB dyeing, under UV-light, observe goal gene.
3) 16S rDNA sequencing
Order-checking is completed by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd, and its nucleotide sequence is as shown in SEQ ID NO 1.5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS phylogenetic tree as shown in Figure 2.
Embodiment 3: the degradation characteristic of degradation bacteria NS
The extraction of 5a,6,9,9a-hexahydro-6,9-methano-2,4 in isolation and purification culture base: 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS is inoculated in isolation and purification culture base and cultivates 5d, add the normal hexane of 5mL, abundant mechanical shaking extraction on vortex mixer, stratification, gets organic phase.
The mensuration of 5a,6,9,9a-hexahydro-6,9-methano-2,4: gas chromatographic analysis: Shimadzu GC-14C gas chromatograph, capillary column (OV-1701) 0.53mm * 30m, fid detector.260 ℃ of injector temperatures, 240 ℃ of column temperatures, 260 ℃ of detectors, N 2flow velocity 25mLmin -1, sample size 2 μ L.
The calculation formula of bacteria suspension to 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation rate:
R = &rho; ck - &rho; &rho; ck &times; 100 %
In formula: R: the degradation rate of 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria (%); ρ: meet concentration (the μ gmL that bacterium is processed 5a,6,9,9a-hexahydro-6,9-methano-2,4 in nutrient solution -1); ρ ck: concentration (the μ gmL that does not connect 5a,6,9,9a-hexahydro-6,9-methano-2,4 in bacterium contrast culture liquid -1).
GC measures the cubage of 5a,6,9,9a-hexahydro-6,9-methano-2,4: the peak height of chromatographic peak and standard specimen chromatographic peak per sample, utilizes external standard method to calculate the concentration of 5a,6,9,9a-hexahydro-6,9-methano-2,4 in nutrient solution.Calculation formula is as follows:
C X = C X &times; M X M 0 &times; V 0 V X
In formula: C x: 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration (μ gmL in nutrient solution -1); M x: sample chromatogram peak-to-peak area (mv); V x: sample feeding amount (μ L); V 0: standard specimen sample size (μ L); H 0: standard specimen chromatographic peak peak area (mv); C 0: standard specimen concentration (μ gmL -1).
1) to adding 5a,6,9,9a-hexahydro-6,9-methano-2,4 standard specimen containing in a small amount of carbon source substratum, set the nutrient solution of four groups of different 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration, in four groups of nutrient solutions, 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration is respectively 10,20,50,100,200 μ gmL -1establish 6 repetitions for every group, the abstraction and quantification test method according to above-mentioned 5a,6,9,9a-hexahydro-6,9-methano-2,4, extracts the 5a,6,9,9a-hexahydro-6,9-methano-2,4 of respectively organizing nutrient solution, then under selected GC-FID chromatographic condition, measure the 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration that in four groups of nutrient solutions, actual extracting goes out, and calculate and add the rate of recovery and the variation coefficient.Recording four components is 85.41%-89.59% from the interpolation rate of recovery of α-5a,6,9,9a-hexahydro-6,9-methano-2,4 in pure medium, and the interpolation rate of recovery that the variation coefficient is less than 3.8%, β-5a,6,9,9a-hexahydro-6,9-methano-2,4 is 95.19%-101.04%, and the variation coefficient is less than 4.7%, meets the requirement of pesticide residue extracting method completely.The rate of recovery situation of adding concentration from standard, the abstraction and quantification method of 5a,6,9,9a-hexahydro-6,9-methano-2,4 can meet 5a,6,9,9a-hexahydro-6,9-methano-2,4 retention analysis requirement in nutrient solution.
Under described chromatographic condition, 5a,6,9,9a-hexahydro-6,9-methano-2,4 standard specimen, working sample spectrogram are respectively Fig. 3 and Fig. 4.By above two spectrograms, can be found out, under this chromatographic condition, sample peak shape is good, and inclusion-free peak disturbs, highly sensitive, and retention time is also proper.
2) impact of pH value on the growth of bacterium for degrading and degradation capability: the pH value of adjusting isolation and purification culture base is respectively 4.0,5.0,6.0,7.0,8.0,9.0,10.0, and wherein the concentration of 5a,6,9,9a-hexahydro-6,9-methano-2,4 is 100 μ gmL -1, the bacteria suspension of the bacterium amount that connects (mass ratio) the inoculation 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS by 3%, 30 ℃, 160rmin -1lower lucifuge shaking culture, samples after 5d, measures the OD of nutrient solution 600value, the increment of calculating degradation bacteria; Repeat 3 times, establish 3 control treatment that do not connect bacterium simultaneously, residual 5a,6,9,9a-hexahydro-6,9-methano-2,4 in nutrient solution is carried out to extraction and determination, calculate the degradation rate of 5a,6,9,9a-hexahydro-6,9-methano-2,4.As shown in Figure 5, result shows experimental result: pH value has a certain impact to the degradation rate of bacterium, and between pH6.0-9.0,5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS degradation rate is higher.When pH<8, along with the raising of pH value, degradation rate increases; Under the meta-alkalescence condition of pH8.0, degradation rate is the highest; When pH>8, along with the rising of pH value, degradation rate reduces.In sum, this bacterium degradation rate under the condition of meta-alkalescence reaches maximum value, illustrates that the optimal ph of 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS bacterium for degrading is 8.0.
3) impact of 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration on the growth of bacterium for degrading and degradation capability: according to the result of initial pH value experiment in above-mentioned 2, select optimal ph 8 to test, control initial 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration in isolation and purification culture base and be respectively 10,20,50,100,200 μ gmL -1, the bacteria suspension of the bacterium amount that the connects inoculation 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS by 3%, 30 ℃, 160rmin -1lucifuge shaking culture, samples after 5d, measures the OD of nutrient solution 600value, the increment of calculating degradation bacteria; Repeat 3 times, establish 3 control treatment that do not connect bacterium simultaneously, residual 5a,6,9,9a-hexahydro-6,9-methano-2,4 in nutrient solution is carried out to extraction and determination, calculate the degradation rate of 5a,6,9,9a-hexahydro-6,9-methano-2,4.As shown in Figure 6, result shows experimental result: in nutrient solution, the concentration of 5a,6,9,9a-hexahydro-6,9-methano-2,4 is at 20 μ gmL -1can be degradable by bacterium NS when following; 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration is 50-100 μ gmL -1time, two kinds of 5a,6,9,9a-hexahydro-6,9-methano-2,4 isomery physical efficiencys are decomposed 70-80% by NS; When 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration increases to 200 μ gmL -1time, NS still can reach more than 60% its degradation rate, illustrates that this bacterial strain still has higher degradation rate to high density 5a,6,9,9a-hexahydro-6,9-methano-2,4.
4) add the impact of bacterium amount on the growth of bacterium for degrading and degradation capability: according to above-mentioned 2), 3), the experimental result of middle initial pH value, 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration, selecting optimal ph 7 and 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration is 100 μ gmL -1test, the bacterium amount that adds in nutrient solution controlled be 1%, 2%, 3%, 4% and the concentration of 5%(bacterial strain in isolation and purification culture base), 30 ℃, 160rmin -1lucifuge shaking culture, samples after 5d, measures the OD of nutrient solution 600value, the increment of calculating degradation bacteria; Repeat 3 times, establish 3 control treatment that do not connect bacterium simultaneously, residual 5a,6,9,9a-hexahydro-6,9-methano-2,4 in nutrient solution is carried out to extraction and determination, calculate the degradation rate of 5a,6,9,9a-hexahydro-6,9-methano-2,4.As shown in Figure 7, result shows experimental result: add bacterium amount 2% when following, the increment of bacterium and the degradation rate of 5a,6,9,9a-hexahydro-6,9-methano-2,4 is increased very fast; While being greater than 2%, the increment of bacterium still increases, but the degradation rate of 5a,6,9,9a-hexahydro-6,9-methano-2,4 is started to reduce; When adding bacterium amount and be 2%, bacterium reaches maximum to the degradation rate of 5a,6,9,9a-hexahydro-6,9-methano-2,4.Therefore selected 2% adds bacterium amount for the best.
5) impact of temperature on the growth of bacterium for degrading and degradation capability: according to above-mentioned 2), 3), 4) in initial pH value, 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration and add the experimental result of bacterium amount, select that optimal ph is 7,5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration is 100 μ gmL -1, to add bacterium amount be 3% to test.The temperature of setting shaking culture is respectively 10,20,30,35,40 ℃, 160rmin -1lucifuge shaking culture, samples after 5d, measures the OD of nutrient solution 600value, the increment of calculating degradation bacteria; Repeat 3 times, establish 3 control treatment that do not connect bacterium simultaneously, residual 5a,6,9,9a-hexahydro-6,9-methano-2,4 in nutrient solution is carried out to extraction and determination, calculate the degradation rate of 5a,6,9,9a-hexahydro-6,9-methano-2,4.As shown in Figure 8, result shows experimental result: culture temperature is degraded and taken the lead in increasing rear decline along with temperature raises the impact of degradation by bacteria 5a,6,9,9a-hexahydro-6,9-methano-2,4.In the temperature range of 30-40 ℃, NS is higher to the degradation rate of 5a,6,9,9a-hexahydro-6,9-methano-2,4.Culture temperature is during lower than 35 ℃, and bacterial strain NS continues to raise to the degradation rate of 5a,6,9,9a-hexahydro-6,9-methano-2,4; When culture temperature is during higher than 35 ℃, microbial activity is lost, and the degradation rate of 5a,6,9,9a-hexahydro-6,9-methano-2,4 starts to decline; In the time of 35 ℃, degradation rate reaches maximum, in 80% left and right.Illustrate that 35 ℃ for the optimum degradation temperature of 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS bacterium for degrading.
6) growth curve of bacterial strain NS and 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation curve under top condition: preparation 5a,6,9,9a-hexahydro-6,9-methano-2,4 content is 100 μ gmL -1isolation and purification culture base, by the bacteria suspension of 2% the bacterium amount that connects inoculation 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS.35 ℃, 160rmin -1lucifuge shaking culture.Repeat 3 times, establish 3 control treatment that do not connect bacterium simultaneously, according to sample time, 3d, 5d, 7d, 10d, 14d, 21d take out test tube, measure the residual concentration of 5a,6,9,9a-hexahydro-6,9-methano-2,4, obtain degradation rate.The concentration of 5a,6,9,9a-hexahydro-6,9-methano-2,4 in nutrient solution of take is ordinate zou, and be X-coordinate sample time, draws the degradation curve of 5a,6,9,9a-hexahydro-6,9-methano-2,4, is Fig. 9, and the time that degradation rate is the highest is defined as the best degradation time of bacterial strain NS degradation bacteria.
By experimental results show that above: suitable 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS growth and temperature when 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation rate is reached to maximum thereof are 35 ℃, and pH is 8.0, connects bacterium amount 2%, under optimum temps and pH condition, in 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS5d to 100 μ gmL -1the degradation rate of 5a,6,9,9a-hexahydro-6,9-methano-2,4 reaches more than 80%, when 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration is 20 μ gmL -1during following concentration, by NS, all being degraded, is 200 μ gmL in 5a,6,9,9a-hexahydro-6,9-methano-2,4 concentration -1in time, is still degraded more than 60%.
Embodiment 4: 5a,6,9,9a-hexahydro-6,9-methano-2,4 degraded product is analyzed
The preparation of Methanogenesis degradation solution and extraction: preparation 5a,6,9,9a-hexahydro-6,9-methano-2,4 content is 100 μ gmL -1isolation and purification culture base, 40 ℃, 160rmin -1lucifuge shaking culture 5d.Take out the test tube of cultivating after 5d, add the normal hexane of 5mL, vortex mechanical shaking extraction 1min, the centrifugal 8min of 8000rpm/min; Separated and collected organic phase, upper machine testing.
Gas-matter analysis condition: gas chromatograph-mass spectrometer (GC-MS) model: PE Clarus500; PE-5MS capillary column.Elite-5MS capillary gas chromatographic column (30m * 0.25mm * 0.25 μ m); Carrier gas is helium, purity 99.999%, flow velocity 1.2mLmin -1; Initial column temperature is 100 ℃, keeps 1min, then with 4 ℃ of min -1be warming up to 240 ℃, then be warmed up to 300 ℃ with 10 ℃/min speed, keep 6min, 290 ℃ of sampler temperature.Input mode is not shunted, sample size 1 μ L.200 ℃ of ion source temperatures, 250 ℃ of transmission line temperature, electron-multiplier voltage 500V, mass scanning scope: m/z 40-500, automatic sampling.
Atlas analysis method: mass spectroscopy is used PE TurboMass5.1 to carry database analysis system, resolves in conjunction with artificial material.
Total ion scan of processing sample as shown in figure 10, is analyzed collection of illustrative plates known, and 5a,6,9,9a-hexahydro-6,9-methano-2,4 is degraded and formed 5a,6,9,9a-hexahydro-6,9-methano-2,4 glycol, 5a,6,9,9a-hexahydro-6,9-methano-2,4 lactone and 5a,6,9,9a-hexahydro-6,9-methano-2,4 ether under 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS effect, does not find the degraded product 5a,6,9,9a-hexahydro-6,9-methano-2,4 vitriol of high poison.
Extraction preparation and the application of case study on implementation 5 immobilized enzyme
1. the cultivation of degradation bacteria
Under aseptic condition, bacterial strain NS is inoculated into containing on a small amount of carbon source substratum, cultivates 48h for 30 ℃.Get two and connect collarium 30 ℃ of shaking tables (rotating speed 160rpm) in 100mLLB substratum and cultivate after 24h, the bacterium amount that connects (mass ratio) by 3% is transferred in 100mL LB substratum, cultivates under these conditions 48h.
2. the extraction of degrading enzyme
By cultured bacterial strain, in cryogenic freezing whizzer, the centrifugal 8min of 8000rpm under 15 ℃ of conditions, collects thalline; By thalline 20mL(pH7.0) 0.05molL -1phosphate buffered saline buffer (Na 2hPO 4-NaH 2pO 4) wash 3 times, then with the centrifugal 8min of 8000rpm; By thalline 1:3(m:v) be suspended in the 0.05molL of (pH7.0) -1in phosphate buffered saline buffer, be placed in ice-water bath, with ultrasonic cell disruptor, process 10 * 1min, power is 280W, broken 5s, interval 5s.Broken afterwards at 4 ℃, the centrifugal 15min of 10000rpm, to remove cell debris, the supernatant liquor obtaining is degrading enzyme crude enzyme liquid.
3. the preparation of immobilized enzyme
The sodium alginate soln that is 3.0% with massfraction by the crude enzyme liquid in above-mentioned 2 mixes according to the volume ratio of 1:20.Re-use syringe mixing liquid is extruded, making it fall into massfraction is 4.0% calcium chloride solution, the immobilized enzyme that to form particle diameter be 1.5-2.0mm.Immobilized enzyme 4 ° of C in above-mentioned calcium chloride solution are preserved to 4-6h, and it is standby to be stored in 4 ° of C.
4. the enzymatic reaction of 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS degrading enzyme
Get 3mL containing 100mgL -1the 0.05molL of 5a,6,9,9a-hexahydro-6,9-methano-2,4 -1na 2hPO 4-NaH 2pO 4damping fluid is preheating 10min in 35 ℃ of water-baths, and the 20-30 particle fixing enzyme that then adds said extracted to go out, after reaction 20min, is used 0.2mL1.0molL -1hCl solution stops enzyme reaction.If 3 parallel controls, establish and are not fixed the contrast that is treated to of changing enzyme simultaneously.Extracting method according to 5a,6,9,9a-hexahydro-6,9-methano-2,4 in embodiment 3 extracts, and by the residual quantity of 5a,6,9,9a-hexahydro-6,9-methano-2,4 in gas Chromatographic Determination solution, and calculates its degradation rate.
Experimental result shows, the immobilized enzyme of 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS, after 20min, can reach respectively 63.5%, 64.7% to the degradation rate of α 5a,6,9,9a-hexahydro-6,9-methano-2,4, β 5a,6,9,9a-hexahydro-6,9-methano-2,4.
4. the application of 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS immobilized enzyme in soil
Preparation method according to above-mentioned 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS immobilized enzyme, is directly added to the immobilized enzyme of preparation in 5a,6,9,9a-hexahydro-6,9-methano-2,4 contaminated soil, can reach the object of quick reparation 5a,6,9,9a-hexahydro-6,9-methano-2,4 contaminated soil.
In sum, 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS has good Degradation to 5a,6,9,9a-hexahydro-6,9-methano-2,4 in meta-alkalescence soil, its immobilized enzyme can be accelerated the degraded of 5a,6,9,9a-hexahydro-6,9-methano-2,4 in contaminated soil, and in product, does not produce the degraded product of high poison, so can reduce the harm of 5a,6,9,9a-hexahydro-6,9-methano-2,4 to soil and environment.Therefore, the 5a,6,9,9a-hexahydro-6,9-methano-2,4 in application 5a,6,9,9a-hexahydro-6,9-methano-2,4 degradation bacteria NS immobilized enzyme degraded meta-alkalescence soil has good application prospect.

Claims (1)

1. a strain preserving number is the rich name of the Whooping cough special Salmonella NS (Bordetella petrii NS) of CCTCC NO:M2012327, it is characterized in that on September 6th, 2012, being preserved in Wuhan, China typical case culture collection center C CTCC; Its 16S rDNA sequence is as shown in SEQ ID NO:1.
CN201210579290.0A 2012-12-27 2012-12-27 A Bordetella petrii NS and applications of an immobilized enzyme thereof in the soil Expired - Fee Related CN103060233B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210579290.0A CN103060233B (en) 2012-12-27 2012-12-27 A Bordetella petrii NS and applications of an immobilized enzyme thereof in the soil

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210579290.0A CN103060233B (en) 2012-12-27 2012-12-27 A Bordetella petrii NS and applications of an immobilized enzyme thereof in the soil

Publications (2)

Publication Number Publication Date
CN103060233A CN103060233A (en) 2013-04-24
CN103060233B true CN103060233B (en) 2014-07-23

Family

ID=48103133

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210579290.0A Expired - Fee Related CN103060233B (en) 2012-12-27 2012-12-27 A Bordetella petrii NS and applications of an immobilized enzyme thereof in the soil

Country Status (1)

Country Link
CN (1) CN103060233B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113005046B (en) * 2020-09-29 2022-07-08 湘潭大学 Pyridine degrading microbial inoculum and application thereof in high-salt pyridine-containing wastewater treatment
CN114231430B (en) * 2021-06-11 2024-02-09 常州大学 Erythromycin degrading bacterium IURM F57 and application thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102757907A (en) * 2012-03-30 2012-10-31 浙江农林大学 Endosulfan degradation stain and application thereof in soil remediation
CN102827789A (en) * 2012-07-16 2012-12-19 山东农业大学 Endosulfan degradation bacterium JBW4

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102757907A (en) * 2012-03-30 2012-10-31 浙江农林大学 Endosulfan degradation stain and application thereof in soil remediation
CN102827789A (en) * 2012-07-16 2012-12-19 山东农业大学 Endosulfan degradation bacterium JBW4

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
Supriya Goswami and Dileep K. Singh.Biodegradation of alpha and beta endosulfan in broth medium and soil microcosm by bacterial strain Bordetella sp. B9.《Biodegradation》.2008,199–207.
Supriya Goswami and Dileep K. Singh.Biodegradation of alpha and beta endosulfan in broth medium and soil microcosm by bacterial strain Bordetella sp. B9.《Biodegradation》.2008,199–207. *
Zhu,L.et al..GenBank: KC109822.1:Bordetella sp. enrichment culture clone NS 16S ribosomal RNA gene, partial sequence.《Genbank》.2012, *
李文.硫丹降解菌的筛选、鉴定及降解机理研究.《2008年山东农业大学硕士学位论文》.2009,第1.3.6节，第3.5节.
硫丹降解菌的筛选、鉴定及降解机理研究;李文;《2008年山东农业大学硕士学位论文》;20090207;第1.3.6节，第3.5节 *
竺利红.硫丹残留及其微生物降解研究进展.《中国农学通报》.2011,242-245. *

Also Published As

Publication number Publication date
CN103060233A (en) 2013-04-24

Similar Documents

Publication Publication Date Title
CN105132324B (en) One plant of wheat rhizosphere Paenibacillus polymyxa WXD 6-4 and its application
Hartley et al. Assessing biological indicators for remediated anthropogenic urban soils
CN102757915B (en) Chloro acetamide herbicide degrading bacteria as well as bactericide prepared thereby and application thereof
CN106734188A (en) A kind of nitrate nitrogen contamination method of heavy metals in farmland pollution
CN111286475B (en) Pyrethroid insecticide residue degradation strain and application thereof
Santos et al. Possibilities of the use of vinasses in the control of fungi phytopathogens
Jiang et al. Remediation of pentachlorophenol-contaminated soil by composting with immobilized Phanerochaete chrysosporium
CN105602872B (en) The bacterium of one high-efficiency degradation glyphosate
CN103060233B (en) A Bordetella petrii NS and applications of an immobilized enzyme thereof in the soil
Stewart et al. Potential contribution of native herbs and biological soil crusts to restoration of the biogeochemical nitrogen cycle in mining impacted sites in Northern Canada
CN105112325A (en) Bacillus cereus bacterial strain WL08 for efficiently degrading dimethomorph, and application and using method of bacillus cereus bacterial strain
CN102827789B (en) Endosulfan degradation bacterium JBW4
CN105198548A (en) Bio-organic fertilizer with acetochlor degradation function and preparation method and application thereof
CN104845890B (en) Applications of earth mould (Agromyces sp.) the MT E in a variety of phthalic acid esters of degrading
CN103911319B (en) Pyrethrin degradation bacteria strains and microbial inoculum thereof and application
CN106399194A (en) Pyridine degradation strain A6, fungicide produced by same and application thereof
CN101381687B (en) DDTs degrading bacteria and use thereof
CN108130281B (en) Aspergillus terreus DDT98801 and its screening technique and the application in degradation of dichloro-diphenyl-trichloroethane
CN107164239B (en) Purple lilac spore bacterium and method for repairing heavy metal in polluted water body by using purple lilac spore bacterium and synergistic biomass
Kadhim et al. Biodegradation of malathion by selected bacterial isolates
CN104805018A (en) Agromyces sp. MT-E used for simultaneous degradation of plurality of phthalic acid esters
Pawar et al. Biodegradation of the organophosphorus insecticide dichlorvas by Bacillus species isolated from grape wine yard soils from Sangli District, MS, India
CN114456945A (en) Paecilomyces for degrading fluorochloridone and application thereof
CN106399126A (en) Method for restoration of carbofuran and chlorpyrifos pesticide-polluted soil through immobilized white-rot fungi
CN103074276B (en) Screening of endosulfan degrading bacteria JW2 and application of endosulfan degrading bacteria JW2 to red soil

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20140723

Termination date: 20211227

CF01 Termination of patent right due to non-payment of annual fee