CN103044534A - Related gene of drought resistant medicago sativa as well as encoding protein and application of gene and protein - Google Patents
Related gene of drought resistant medicago sativa as well as encoding protein and application of gene and protein Download PDFInfo
- Publication number
- CN103044534A CN103044534A CN201110310769XA CN201110310769A CN103044534A CN 103044534 A CN103044534 A CN 103044534A CN 201110310769X A CN201110310769X A CN 201110310769XA CN 201110310769 A CN201110310769 A CN 201110310769A CN 103044534 A CN103044534 A CN 103044534A
- Authority
- CN
- China
- Prior art keywords
- gene
- alfalfa
- drought
- seq
- sequence shown
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses an encoding protein of a related gene of drought resistant medicago sativa, wherein the protein has an amino acid sequence shown as SEQ ID No:2 or amino acid sequence which still has drought resistant activity through substituting, losing or adding one or more amino acid residues of the amino acid sequence shown as SEQ ID No:2. The invention also relates to an encoding gene of the protein as well as an expression vector and cell containing the gene and also relates to a method for cultivating the drought resistant medicago sativa and applications of the gene and the protein. The drought resistance of the medicago sativa can be remarkably enhanced through expressing the related gene (bZIP) of the drought resistant medicago sativa, provided by the invention, in the medicago sativa. The gene provides a gene resource for the drought resistance research of main crops and plays an important role in researching the drought resistance of improved plants in genetic engineering.
Description
Technical field
The present invention relates to a kind of alfalfa gene related to drought tolerance, also relate to the albumen by this genes encoding, and the expression vector and the cell that contain described alfalfa gene related to drought tolerance, also relate to simultaneously a kind of method of cultivating the drought resisting alfalfa, and the application in the plant of cultivating the drought-resistant ability raising with the expression vector that contains this gene and cell of the albumen of alfalfa gene related to drought tolerance and coding thereof.
Background technology
Alfalfa is China and even most important leguminous forage in the world, is described as " King of Pasture ".Alfalfa is more in northwest China's plantation, and arid, the short of rain climatic characteristic in the Northwest, it is very unfavorable that the normal growth of crop is grown, and seriously restricted the development of husbandry.
Therefore, the drought resistance of further investigation alfalfa for overcoming the restriction of the natural condition such as this area's arid, wind erosion to the clover cultivation, enlarges its planting range, increases productivity, and has very important meaning.
In the past few decades the study on drought resistance of alfalfa progressively being transferred to the research that improves alfalfa self drought resistance from the research of the evaluation aspect of drought resistance comes up, especially in recent years or the research in the nearly more than ten years, the research work of the breeding for drought resistance of alfalfa and breed improvement aspect is particularly outstanding.
Method at present the most effective and commonly used or traditional recurrent selection method namely produce the offspring by roguing in original population, and the offspring is identified, form new colony to improve the average performance of colony with good progeny recombination again.Then can utilize pedigree method that self-mating system is selected by new colony.
Along with molecular biological development, biotechnology has obtained using widely in breeding.But compare with the research in other crops (such as corn, Chinese sorghum etc.), the research in the alfalfa Drought-resistant Breeding is also relatively less.Therefore, the Molecular Biology Mechanism that the alfalfa drought resisting is relevant awaits further to study.
Summary of the invention
The present invention is based on the research to the relevant the Molecular Biology Mechanism of alfalfa drought resisting, the albumen of alfalfa gene related to drought tolerance and this genes encoding is provided on the one hand, the expression vector and the cell that contain described alfalfa gene related to drought tolerance also are provided on the other hand, and the method for cultivating the drought resisting alfalfa, their application also is provided.
The invention provides a kind of albumen of alfalfa gene related to drought tolerance coding, wherein, this albumen has the aminoacid sequence shown in the SEQ ID No:2, and perhaps this albumen has the aminoacid sequence that still has the drought resisting activity with after replacement, disappearance or the interpolation of the aminoacid sequence shown in the SEQ ID No:2 through one or several amino-acid residue.
The present invention also provides a kind of alfalfa gene related to drought tolerance, and wherein, this gene has the nucleotide sequence shown in the SEQ IDNo:1, and perhaps this gene has the nucleotide sequence of the aminoacid sequence shown in the coding SEQ ID No:2.
The present invention also provides a kind of expression vector, and wherein, this expression vector contains alfalfa gene related to drought tolerance provided by the invention.
The present invention also provides a kind of transgenic cell, and wherein, this transgenic cell contains alfalfa gene related to drought tolerance provided by the invention.
The present invention also provides a kind of method of cultivating the drought resisting alfalfa, and wherein, the method comprises alfalfa gene related to drought tolerance provided by the invention is imported in the alfalfa cell, obtains alfalfa cell and transfer-gen plant that drought-resistant ability improves.
The present invention also provide alfalfa gene related to drought tolerance provided by the invention and coding thereof albumen, contain the expression vector of described gene, the application of transgenic cell in cultivating the plant that drought-resistant ability improves that contains described gene.
Alfalfa gene related to drought tolerance provided by the invention (bZIP) in alfalfa by the Drought Stress abduction delivering, and then the present inventor imports to alfalfa gene related to drought tolerance (bZIP) in the alfalfa by transgenic technology, and the result shows that the expression of alfalfa gene related to drought tolerance (bZIP) in alfalfa can significantly strengthen the drought resistance of alfalfa.The anti-drought gene that the present invention clones from alfalfa is that the drought resisting research of staple crops (particularly alfalfa) provides genetic resources, will play a significant role in the drought resistance research of genetically engineered improvement plant.
Description of drawings
Fig. 1 has shown the analytical results of the real-time quantitative PCR of bZIP gene (SEQ ID NO:1), and the result shows that the expression level of bZIP gene can be by raising that drought stress is induced.
Fig. 2 has shown the structure of carrying out the used pCAMBIA1302 carrier that is inserted with the bZIP gene of cellular localization among the embodiment 2.
Fig. 3 is transferred in the onion epidermis cell Subcellular Localization figure that observes for the empty expression vector that will not contain purpose bZIP gene.
Fig. 4 is transferred in the onion epidermis cell Subcellular Localization figure that observes for the expression vector that will contain ZIP gene (SEQ ID NO:1).
Fig. 5 has shown the structure of among the embodiment 3 Medicago sativa being carried out the used pCAMBIA1302 carrier that is inserted with the bZIP gene of agriculture bacillus mediated bZIP gene transformation.
Embodiment
The invention provides a kind of albumen by alfalfa gene related to drought tolerance coding, wherein, this albumen has the aminoacid sequence shown in the SEQ ID No:2, and perhaps this albumen has the aminoacid sequence that still has the drought resisting activity with after replacement, disappearance or the interpolation of the aminoacid sequence shown in the SEQ ID No:2 through one or several amino-acid residue.Under the preferable case, this albumen has the aminoacid sequence shown in the SEQ ID No:2.
Correspondingly, the present invention also provides a kind of alfalfa gene related to drought tolerance (bZIP), wherein, this gene has the nucleotide sequence shown in the SEQ ID No:1, and perhaps this gene has the nucleotide sequence of the aminoacid sequence shown in the coding SEQ IDNo:2.Preferably, this gene has the nucleotide sequence shown in the SEQ ID No:1.
Alfalfa gene related to drought tolerance provided by the invention (bZIP) is the contriver by making up the cDNA library of specifically expressing under the alfalfa drought stress, and screening obtains from this cDNA library.
The construction process of described cDNA library comprises: utilize 30% (w/v) PEG8000 to alfalfa (Medicago sativa L.cv. Baoding clover, poultry east grass cultivation science and technology limited Company in Beijing) carrying out simulating drought processed 12 hours, the results plant is put in-80 ℃ as experimental group.The plant of not processing through arid is control group.Utilize PCR-Selected cDNA Subtraction Kit (Clontech, Mountain View, CA, USA) to make up the cDNA library of specifically expressing under the alfalfa drought stress.
In the building process in library, obtained 525 single bacterium colonies and also all checked order.Through removing carrier sequence and redundant sequence, 130 est sequences have finally been obtained.The size of these sequences is from 250bp to 1000bp.Wherein, length is the concern that the est sequence of 567bp has caused the experimenter, and to utilizing SMARTer
TMRACE cDNA Amplification Kit (Clontech, USA) has carried out 5 ' RACE and 3 ' RACE clone to this est sequence respectively, has obtained at last this full length gene sequence (SEQ IDNO:2).Wherein, the method for gene clone is the normal experiment operation of biology field, and concrete grammar is as follows:
A. prepare basic liquid: 2.0 μ l, 5 * the first chain damping fluids, 1.0 μ l DTT (20mM), 1.0 μ ldNTP Mix (10mM);
B. for the preparation of the cDNA:2.75 μ l RNA of 5 ' RACE, 1.0 μ l, 5 '-CDS primer A (ACGCGACGGTTTCAACATCCCTCTC);
For the preparation of the cDNA:3.75 μ l RNA of 3 ' RACE, 1.0 μ l, 3 '-CDS primer A (GAGCTGATGCTGTGGCTGCTGGTTG);
C. ready liquid is put in 72 ℃ 3 minutes, be put in again 42 ℃ the cooling 2 minutes.
D. the SMARTer IIA oligo that adds 1 μ l in the B among the cDNA of 5 ' RACE.
E. the cDNA reaction solution for preparing 5 ' RACE and 3 ' RACE: the damping fluid that the steps A of 4.0 μ l obtains, 0.25 μ l RNA enzyme inhibitors (40U/ μ l), 1.0 μ l SMARTScribe reversed transcriptive enzymes (100U).
F. the liquid in the step e is joined among the step C, finish the preparation of the cDNA synthesis reaction solution of 3 ' RACE; Liquid in the step e is joined among the step D, finish the preparation of the cDNA synthesis reaction solution of 5 ' RACE.
G. the reaction solution for preparing is put in 42 ℃ 90 minutes, in last 70 ℃ 10 minutes, finishes the synthetic of cDNA.
Wherein, 3 ' RACE reaction system is: 94 ℃ 30 seconds, 68 ℃ 30 seconds, 72 ℃ 3 minutes, totally 30 circulations.5 ' RACE reaction system is: 94 ℃ 30 seconds, 65 ℃ 30 seconds, 72 ℃ 3 minutes, totally 40 circulations.
Get the PCR product and on the sepharose of 1.0 (W/V) %, carry out electrophoresis detection, reclaim the purpose band, connect and reclaim on product and the pEGM T-Easy carrier, transform the bacillus coli DH 5 alpha competent cell, extract plasmid and order-checking, sequencing result shows that this gene has the nucleotide sequence shown in the SEQ ID:No:1 (1781bp).
The present invention also provides a kind of expression vector, and wherein, this expression vector contains the gene with following nucleotide sequence: the nucleotide sequence shown in the SEQ ID No:1, the nucleotide sequence of the aminoacid sequence shown in the SEQ ID No:2 of perhaps encoding.Gene provided by the invention can be building up in the expression vector by existing method, can add any enhancing promotor or inducible promoter before its transcription initiation Nucleotide.For the ease of transgenic plant cells or plant being identified and screening, can process employed carrier, such as the antibiotic marker thing (such as Totomycin, kantlex etc.) that adds plant selected marker (such as BAR gene, gus gene, luciferase gene etc.) or have resistance.
The present invention also provides a kind of transgenic cell, and wherein, this transgenic cell contains the gene with following nucleotide sequence: the nucleotide sequence shown in the SEQ ID No:1, the nucleotide sequence of the aminoacid sequence shown in the SEQ ID No:2 of perhaps encoding.Described cell can be monocotyledonous cell, also can be the cell of dicotyledons, such as the cell of paddy rice, wheat, corn, cucumber, tomato or clover etc.Be preferably the clover cell, more preferably the alfalfa cell.
The present invention also provides a kind of method of cultivating the drought resisting alfalfa, and wherein, the method comprises that the base that will have the Nucleotide shown in the SEQ ID No:1 imports in the alfalfa cell, obtains alfalfa cell and transfer-gen plant that drought-resistant ability improves.
Be the method for genetically engineered field routine according to the method that will have gene provided by the invention to import in the alfalfa cell of the present invention, such as conventional biological method transformed plant cells or the tissue such as leading by Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, electricity, agriculture bacillus mediated, afterwards the vegetable cell that transforms is cultivated into plant.
The present invention also provide alfalfa gene related to drought tolerance provided by the invention and coding thereof albumen, contain the expression vector of described gene, the application of transgenic cell in cultivating the plant that drought-resistant ability improves that contains described gene.Preferably, described plant is alfalfa.
The Real-time PCR Analysis of bZIP gene
In order further to study from suppressing the poor expression that subtracts the bZIP gene (gene shown in the SEQ ID NO:1) that obtains the hybridization library, utilize the method for real-time quantitative PCR to analyze, concrete steps are as follows:
Medicago sativa (Medicago sativa L.cv. Baoding clover with 50 days sizes, poultry east grass cultivation science and technology limited Company in Beijing) be experiment material, use respectively 30% (w/v) PEG 8000 to process 0,15,30 minute and 1,6,12,24 hour, extract total RNA.Total RNA of 5 μ g is used to the preparation of the first chain cDNA, concrete steps are as follows: at first add 0.5 μ l, 50 μ M oligo (dT) (Invitrogen), 1 μ l 10mM dNTP Mix and 5 μ l DEPC-treated water, 65 ℃ of heat shocks 5 minutes were put in cooled on ice 1 minute; Secondly, add 4 μ l, 5 * First Strand Buffer, 2 μ l 0.1M dithiothreitol (DTT), 1 μ l 40U/ μ l RNaseOUT (Invitrogen) and 200USuperScript II Reverse Transcriptase (Invitrogen), be put in 25 ℃ 5 minutes, 50 ℃ 60 minutes and 70 ℃ 15 minutes.Synthetic cDNA is put in-20 ℃ of preservations.
The primer that is used for real-time quantitative PCR is:
Primer 1:5 '-3 ': ACCAAGACTGAAAAGCCTTC
Primer 2: 5 '-3 ': TTCTCCATCAGTGGTCGGTG.
A SYBR green reporter assay kit is used to the real-time quantitative PCR reaction.The 18S rRNA of Medicago truncatula is used to interior mark.Do repeated experiments 3 times for each gene.Reaction system is as follows: 2 μ l, 10 * PCR buffer, 2 μ l 25mM Mg
2+0.5 μ l 25mM dNTP, 0.5 μ l 10 μ M forward primer, 0.5 μ l 10 μ M reverse primer, 1 μ l, 20 * SYBR Green Master Mix (Invitrogen), 0.2 μ l 5U/ μ l Taq (Invitrogen, 11304-029), 1 μ l cDNA mends 20 μ l with ultrapure water with cumulative volume at last.Reaction conditions is as follows: 95 ℃ of dissolving DNAs 2 minutes, the amplified reaction that then carries out 40 circulations, 95 ℃ of 10 second, 60 ℃ of 30 second, 70 ℃ of 45 second.Use at last 2
-Δ Δ CtStatistical method is analyzed PCR result.The result as shown in Figure 1.
Can find out that from the result of Fig. 1 the expression level of bZIP gene (SEQ ID NO:1) can be by raising that drought stress is induced.
The Subcellular Localization of bZIP gene
The structure of plant expression vector: 1) RNA extracts (extraction of Trizol method), 2) reverse transcription (M-MLV, promega company), 3) pcr amplification: take the cDNA of reverse transcription as template, utilizing the Taq enzyme to be PCR, the restriction enzyme site (NcoI and SpeI) that designs be connected into PCR product, 4) PCR product and carrier carry out enzyme and cut processing, 5) enzyme is cut the product connection, and carrier structure as shown in Figure 2.
Transform intestinal bacteria and detect, utilize particle gun, the empty expression vector that does not contain purpose bZIP gene is transferred to onion epidermis cell, observe its Subcellular Localization (as shown in Figure 3); Utilize particle gun, the carrier that will contain goal gene imports in the onion epidermis cell, observes its Subcellular Localization (as shown in Figure 4).
Among Fig. 3, by relatively can finding out of A and B, the empty expression vector that does not contain purpose bZIP gene all has expression at the each several part of cell; And can find out relatively that by A among Fig. 4 and B the expression vector that contains ZIP gene (SEQ ID NO:1) is only expressed in nucleus.
Embodiment 3
Agriculture bacillus mediated bZIP gene transformation Medicago sativa
One, material and reagent
1, vegetable material
Supplying the examination alfalfa variety is alfalfa (Medicago sativa L.cv. Baoding clover, poultry east grass cultivation science and technology limited Company in Beijing).
The aseptic seedling cotyledon that germinateed 7 days is the acceptor material of genetic transformation.
2, agrobacterium strains and plasmid vector
Used agrobacterium strains is agrobacterium tumefaciens: GV3103 (sky, Beijing bounties Gene Tech. Company Limited), the Agrobacterium substratum:
Plasmid vector: pCAMBIA1302 (available from the uncommon lucky Bioisystech Co., Ltd in Shanghai).The bZIP gene is inserted among the pCAMBIA1302, and concrete steps are as follows:
1) RNA extracts (extractions of Trizol method), 2) reverse transcription (M-MLV, promega company), 3) pcr amplification: take the cDNA of reverse transcription as template, increasing obtains the bZIP gene order (primer is: 5 '-3 ': GGGGCTC
CCATGGATGGGAAATAGTGACGAAGAGAAATC Nco I and 5 '-3 ': CGCGGCTC
TGATCAACCAGCAGCCACAGCATCAGCTCTAG Spe I), 3) pcr amplification product is that 1% (W/V) sepharose carries out electrophoresis detection in concentration, and the pcr amplification product of recovery target sizes, and with Nco I and Spe I pCAMBIA1302 carrier and PCR product are carried out double digestion and process, 4) after endonuclease reaction finishes, carry out electrophoresis detection with 1.0% (W/V) sepharose, recovery contains the fragment of purpose band, by the T4 dna ligase, connect, 5) will connect product changes in the competence bacillus coli DH 5 alpha, obtain being inserted with the pCAMBIA1302 carrier of bZIP gene, it contains the CaMV35s promotor, bZIP gene (SEQ ID NO:1) and a moisture resistance mycin screening-gene can be by the transfer-gen plants of hygromycin selection preliminary evaluation acquisition when carrying out genetic transformation.The structure of plasmid vector that contains the purpose fragment is shown in Figure 3.
The pCAMBIA1302 carrier that is inserted with the bZIP gene is imported to agrobacterium tumefaciens: among the GV3103, concrete steps are as follows:
1) gets the agrobacterium tumefaciens of-70 ℃ of preservations: GV3103 in containing 50 μ g/ml Streptomycin sulphate plate streakings, 28 ℃ of cultivations.
2) picking list colony inoculation is in 5ml YM liquid nutrient medium, 28 ℃ of shaking culture 12-16hr of 220rpm.
3) get 2ml bacterium liquid and transfer in 100ml YM liquid nutrient medium, 28 ℃ of 220rpm shaking culture are to OD600=0.5.
4) change aseptic centrifuge tube over to, the centrifugal 5min of 5000rpm removes supernatant liquor.
5) the CaCl2 solution of the 0.1M of adding 10ml precooling, suspension cell is placed 20min on ice gently.4 ℃ of centrifugal 5min of 5000rpm remove supernatant.
6) the CaCl2 solution of the 0.1M that contains 15% glycerine of adding 4ml precooling suspends gently.
7) agrobacterium suspension is sub-packed in the aseptic Eppendorf pipe, and every pipe 200 μ l are frozen in-70 ℃.
The plasmid DNA of 8) getting about 1 μ g joins in the 200ml GV3103 competent cell, and behind the mixing, ice bath 30min places 10min for-70 ℃.
9) again at 37 ℃ of water-bath 5min or 42 ℃ of water-bath 1min, then ice bath 2min adds 28 ℃ of 800mlYM liquid nutrient mediums, and 175rpm is coated on the YM flat board that contains 50 μ g/ml Kanamycin after shaking training 3hr.28 ℃ of cultivations are to forming single bacterium colony.
Extract the plasmid and the order-checking that import the Agrobacterium that the bZIP gene is arranged, the result shows that the nucleotide sequence of quiding gene is consistent with SEQ ID NO:1, shows that Loss does not occur the expression vector that contains goal gene bZIP.
Two, experimental technique
1, the cultivation of Agrobacterium
Importing there is the Agrobacterium of bZIP gene on the YMB solid medium that contains 50mg/L kantlex and 50mg/L Rifampin, draw flat board, is put in the incubator 28 ℃ of cultivations.Two days later, picking list bacterium colony from the flat board is inoculated in the 20ml YMB liquid nutrient medium that contains 50mg/L kantlex and 50mg/L Rifampin 180rpm, 28 ℃ of cultivations.Draw flat board with the bacterium liquid that shakes, 28 ℃ of cultivations after growing single bacterium colony, are put in 4 ℃ of preservations with flat board.
2, the conversion of bZIP gene
Picking list bacterium colony on flat board is inoculated in the YMB liquid nutrient medium that 20ml contains 50mg/L kantlex and 50mg/L Rifampin, and in 28 ℃, 180rpm cultivates on constant-temperature table.Reclaimed later on bacterial strain in two days, bacterium liquid is fallen in the 10ml centrifuge tube 4000rpm, centrifugal 10min.Outwell supernatant, with the resuspended thalline of SH liquid nutrient medium that does not contain antibiotic improvement of the bacterium of having gone out, make the OD of bacterium liquid
600Value is for 0.6-0.8, and is stand-by.The preparation of 4 explants: the alfalfa cotyledon of 4-5 days sizes is downcut from aseptic seedling with pocket knife, be cut into the long fritter of 3-4mm, the explant that scales off is put in the SH liquid nutrient medium of improvement, prevents from drying up, and is stand-by.After explant is ready to complete, with the explant that is soaked in the SH liquid nutrient medium of improvement, fall in the filter of the bacterium of having gone out in advance, reclaim explant.The explant that reclaims is put in the ready bacterium liquid, carries out During Agrobacterium.Every for a moment, shake several times, help Agrobacterium to be adsorbed onto on the explant.Contaminate after 15 minutes, fall on aseptic filter, reclaim explant.Explant is put on the aseptic filter paper, blots the bacterium liquid of explant outside.Explant is put on the filter paper in the common culture medium that does not contain cephamycin, with Parafilm culture dish is sealed, be put in dark place, cultivated 4 days for 28 ℃.
Explant after agrobacterium tumefaciens is infected is placed on dark the cultivation after 4 days on the common culture medium, transfers to and contains 2mg/L 2, on the SH solid medium of the improvement of 4-D, 0.2mg/L KT, 30mg/L Totomycin and 300mg/L Cef, induces the generation callus; After cultivating 20 days, the callus of inducing generation is transferred on the UM substratum that contains 0.2mg/L KT, 30mg/L Totomycin and 250mg/L Cef, induce the generation embryoid; After the embryoid maturation, (approximately cultivated 30 days), embryoid is transplanted on the 1/2MS substratum, root induction, thus finish the regeneration of plant.
Respectively go on foot the composed as follows of substratum in the regenerative process:
Be total to culture medium: the SH substratum+2mg/L 2 of improvement, 4-D+0.2mg/L KT;
Callus induction substratum: the SH substratum+2mg/L 2 of improvement, 4-D+0.2mg/L KT+300mg/LCef+30mg/L Hyg;
Embryoid induction substratum: UM substratum+0.6mg/L KT+250mg/L Cef+30mg/LHyg;
Root media: 1/2MS substratum+250mg/L Cef+30mg/L Hyg.
Comparative Examples 1
Turn the acquisition of empty carrier control plant
Transform Agrobacterium with plasmid pCAMBIA1302, obtain the restructuring Agrobacterium, with restructuring Agrobacterium-mediated Transformation alfalfa, obtain turning the adjoining tree of empty carrier, method such as embodiment 2.
Embodiment 4
The alfalfa that turns the pCAMBIA1302 carrier that is inserted with the bZIP gene that obtains among the alfalfa that turns empty carrier that obtains in the Comparative Examples 1 with 30 strains and the embodiment 3 of 30 strains is carried out the drought resisting experiment, concrete grammar is as follows: 1) plant is taken out from soil, water washes the soil on the root; 2) cleaned plant is put into the Hoagland Complete plant liquid growth media that contains 30% (w/v) PEG8000 and carry out simulating drought processing 2 days.
The result shows that the alfalfa that turns the pCAMBIA1302 empty carrier is all withered, and the alfalfa that turns the pCAMBIA1302 carrier that is inserted with the bZIP gene has 28 strains survival, and most of blade keeps green, and plant strain growth is good.
This shows that the expression of alfalfa gene related to drought tolerance provided by the invention (bZIP) in alfalfa can significantly strengthen the drought resistance of alfalfa.The drought resisting research that is found to be staple crops (particularly alfalfa) of this gene provides genetic resources, will play a significant role in the drought resistance research of genetically engineered improvement plant.
Claims (10)
1. albumen by alfalfa gene related to drought tolerance coding, it is characterized in that, this albumen has the aminoacid sequence shown in the SEQ ID No:2, and perhaps this albumen has the aminoacid sequence that still has the drought resisting activity with after replacement, disappearance or the interpolation of the aminoacid sequence shown in the SEQ ID No:2 through one or several amino-acid residue.
2. albumen according to claim 1, wherein, this albumen has the aminoacid sequence shown in the SEQ ID No:2.
3. an alfalfa gene related to drought tolerance is characterized in that, this gene has the nucleotide sequence shown in the SEQ ID No:1, and perhaps this gene has the nucleotide sequence of the aminoacid sequence shown in the coding SEQ ID No:2.
4. gene according to claim 3, wherein, this gene has the nucleotide sequence shown in the SEQ ID No:1.
5. an expression vector is characterized in that, this expression vector contains gene claimed in claim 3.
6. a transgenic cell is characterized in that, this transgenic cell contains gene claimed in claim 3.
7. transgenic cell according to claim 6, wherein, described transgenic cell is the alfalfa transgenic cell.
8. a method of cultivating the drought resisting alfalfa is characterized in that, the method comprises gene claimed in claim 3 is imported in the alfalfa cell, obtains alfalfa cell and transfer-gen plant that drought-resistant ability improves.
9. albumen claimed in claim 1, gene claimed in claim 3, expression vector claimed in claim 5, the application of transgenic cell claimed in claim 6 in the plant of cultivating the drought-resistant ability raising.
10. application according to claim 9, wherein, described plant is alfalfa.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110310769.XA CN103044534B (en) | 2011-10-14 | 2011-10-14 | Related gene of drought resistant medicago sativa as well as encoding protein and application of gene and protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110310769.XA CN103044534B (en) | 2011-10-14 | 2011-10-14 | Related gene of drought resistant medicago sativa as well as encoding protein and application of gene and protein |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103044534A true CN103044534A (en) | 2013-04-17 |
| CN103044534B CN103044534B (en) | 2014-07-02 |
Family
ID=48057416
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110310769.XA Expired - Fee Related CN103044534B (en) | 2011-10-14 | 2011-10-14 | Related gene of drought resistant medicago sativa as well as encoding protein and application of gene and protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103044534B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103343131A (en) * | 2013-06-28 | 2013-10-09 | 廊坊师范学院 | Gene GmCTRL2 used for improving osmotic stress resistance of alfalfa, preparation and protein coded by gene GmCTRL2 |
| CN104059928A (en) * | 2014-05-30 | 2014-09-24 | 廊坊师范学院 | Gene GhASS1 for improving salt tolerance of Escherichia coli and preparation of gene GhASS1 as well as protein coded by gene GhASS1 |
| CN110016479A (en) * | 2019-05-17 | 2019-07-16 | 河南省农业科学院畜牧兽医研究所 | One alfalfa MsGPF gene |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109486838B (en) * | 2018-12-21 | 2021-09-17 | 中国农业科学院北京畜牧兽医研究所 | Transcription factor gene for regulating plant flavonoid synthesis and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1472223A (en) * | 2002-07-30 | 2004-02-04 | 中国农业科学院生物技术研究所 | bZIP transcription factor of corn and its encoding genes and use |
| CN102140443A (en) * | 2010-02-03 | 2011-08-03 | 中国科学院遗传与发育生物学研究所 | Plant stress-resistant associated protein, and encoding gene and application thereof |
-
2011
- 2011-10-14 CN CN201110310769.XA patent/CN103044534B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1472223A (en) * | 2002-07-30 | 2004-02-04 | 中国农业科学院生物技术研究所 | bZIP transcription factor of corn and its encoding genes and use |
| CN102140443A (en) * | 2010-02-03 | 2011-08-03 | 中国科学院遗传与发育生物学研究所 | Plant stress-resistant associated protein, and encoding gene and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| CARLOS MOLINA ET AL: "SuperSAGE- the drought stress-responsive transcriptome of chickpea roots", 《BIOMED CENTRAL》 * |
| W WALTER LORENZ ET AL: "Microarray analysis and scale-free gene networks identify candidate regulators in drought-stressed roots of loblolly pine (P. taeda L.)", 《BMC GENOMICS》 * |
| 沈元月等: "植物抗旱的分子机制研究", 《中国生态农业学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103343131A (en) * | 2013-06-28 | 2013-10-09 | 廊坊师范学院 | Gene GmCTRL2 used for improving osmotic stress resistance of alfalfa, preparation and protein coded by gene GmCTRL2 |
| CN103343131B (en) * | 2013-06-28 | 2015-07-15 | 廊坊师范学院 | Gene GmCTRL2 used for improving osmotic stress resistance of alfalfa, preparation and protein coded by gene GmCTRL2 |
| CN104059928A (en) * | 2014-05-30 | 2014-09-24 | 廊坊师范学院 | Gene GhASS1 for improving salt tolerance of Escherichia coli and preparation of gene GhASS1 as well as protein coded by gene GhASS1 |
| CN110016479A (en) * | 2019-05-17 | 2019-07-16 | 河南省农业科学院畜牧兽医研究所 | One alfalfa MsGPF gene |
| CN110016479B (en) * | 2019-05-17 | 2022-08-26 | 河南省农业科学院畜牧兽医研究所 | Alfalfa MsGPF gene |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103044534B (en) | 2014-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107937411B (en) | Populus tomentosa PtoWRKY40 gene, expression vector and construction method thereof and application | |
| CN112626080B (en) | R gene for controlling soybean-rhizobium matching property, protein and application thereof | |
| CN102432679B (en) | Rice extensin OsPEX1 and application thereof | |
| CN109797157B (en) | Abiotic stress resistant transcription factor PbrbHLH92, primer thereof, encoded protein and application | |
| CN110128514B (en) | Rice cold tolerance associated protein CTB4b in booting stage, coding gene and application | |
| CN112779234B (en) | Phyllostachys pubescens PeAPX5 gene and application thereof | |
| CN102002101B (en) | Plant root development related protein ZmNR1 and coding gene thereof | |
| CN107267526B (en) | Radix Notoginseng myb transcription factor gene PnMYB2 and its application | |
| CN103044534B (en) | Related gene of drought resistant medicago sativa as well as encoding protein and application of gene and protein | |
| CN103710357B (en) | Alfalfa stress response gene M sNAC2 and application thereof | |
| CN102250949B (en) | Application of rice miR166 in enhancing plant cadmium stress tolerance | |
| CN104404043B (en) | Promoter of gene Me094 related to bacterial-blight resistance of Oryza meyeriana | |
| CN103183731B (en) | Dendrobe DnMYB type transcription factor, coding gene, carrier and engineering bacteria and application thereof | |
| CN117286150A (en) | Notoginseng disease course related protein 1 gene PnPR1-3 and its application | |
| CN110195065B (en) | Zinc stress resistant PuPLA2 gene, PuPLA2 protein, recombinant expression vector and application thereof | |
| CN116083445A (en) | CrBZR1 gene and application thereof | |
| CN115772212A (en) | Alfalfa chloroplast MsSAP22 gene and application thereof in improving drought resistance of plants | |
| CN106520723A (en) | Protein VvMas and encoding gene, and application thereof in improvement of salt tolerance of plants | |
| CN113603757A (en) | Lilium regale Dirigent similar protein gene LrDI 1 and application | |
| CN110904106A (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
| CN110964729A (en) | Cloning method, application and application method of common wheat gene TaSNX1 | |
| CN104911198B (en) | Blueberry salt tolerant, anti-drought gene VcLON2 and its coding albumen and application | |
| CN111500624B (en) | Use of CrSMT genes to increase resistance of plants to biotic and abiotic stress | |
| CN116555286B (en) | Notoginseng rich proline protein gene PnPRPL1 and application thereof | |
| CN110964724B (en) | Application of cymbidium goeringii miR390c in enhancing cold resistance of plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140702 Termination date: 20141014 |
|
| EXPY | Termination of patent right or utility model |