CN103044530B

CN103044530B - Improved flagellin serving as immunologic adjuvant, and preparation method and application of improved flagellin

Info

Publication number: CN103044530B
Application number: CN201310002024.6A
Authority: CN
Inventors: 焦新安; 潘志明; 张磊; 孙林; 杨芸; 康喜龙; 王静
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2013-01-04
Filing date: 2013-01-04
Publication date: 2014-07-09
Anticipated expiration: 2033-01-04
Also published as: CN103044530A

Abstract

The invention provides improved flagellin serving as an immunologic adjuvant, and a preparation method and an application of the improved flagellin. A salmonella typhimurium flagellin mutant of the improved flagellin has bioactivity of flagellin, and contains I411A mutation compared with the wild salmonella typhimurium flagellin. The salmonella typhimurium flagellin mutant of the improved flagellin can weaken TLR5 (toll-like receptor) mediated natural immune response, and has significant adjuvanticity.

Description

A kind of modified form flagellin and preparation and application thereof that can be used as immunological adjuvant

Technical field

The present invention relates to biological technical field, be specifically related to a kind of modified form flagellin and preparation and application thereof that can be used as immunological adjuvant.

Background technology

Flagellin contains 494 amino acid, has 4 globosity territories (D0, D1, D2 and D3), wherein D0 and D1 structural domain high conservative.

Aminoacid sequence from the flagellin of each bacterioid can obtain in NCBI GenBank database.Wherein, known to Salmonella typhimurtum I (S.Typhimurium 1), helicobacter pylori (H.Pylori), vibrio cholerae (V.Cholera), serratia marcescens (S.marcesens), shigella flexneri (S.flexneri), treponema pallidum (T.Pallidum), legionella pneumophilia (L.pneumophila), Borrelia burgdoyferi (B.burgdorferei), clostridium difficile (C.difficile), rhizobium melioti (R.meliloti), agrobacterium tumefaciens (A.tumefaciens), rhizobiun lupini (R.lupini), Ka Shi Bartonella (B.clarridgeiae), Proteus mirabilis (P.Mirabilis), Bacillus subtilus (B.subtilus), Listeria monocytogenes (L.monocytogenes), the flagellin sequence of Pseudomonas aeruginosa (P.aeruginosa) and intestinal bacteria (E.coli).

Flagellin has adjuvant effect, but its mechanism that produces adjuvant effect is not clear.Research shows, flagellin by with the TLR5 receptors bind of host cell, excite adjuvant effect thereby irritation cell produces a large amount of pro-inflammatory cytokines.

But nearest research discovery, flagellin and oralbumin (OVA) mixed immunity TLR5 ^(-/-)after mouse, the adjuvant ability of its induction OVA albumen humoral immunoresponse(HI) does not change, thereby infers that natural the replying of TLR5 mediation is not that flagellin produces the requirement of adjuvant effect.

In addition, flagellin acts on after TLR5 acceptor, excites the strong innate immunity of generation can cause systemic untoward reaction, as Sepsis etc.Flagellin has restricted its application prospect as adjuvant to the side effect of body.Therefore, need badly and research and develop a kind of modified form flagellin, this albumen can retain the feature of wild-type flagellin immunological adjuvant, can reduce again the innate immunity that it excites simultaneously, alleviate its side effect to body, for new generation vaccine, research and development have realistic meaning for this.

Summary of the invention

The object of this invention is to provide a kind of modified form flagellin and preparation and application thereof, this albumen can retain the feature of wild-type flagellin immunological adjuvant, can reduce again the innate immunity that it excites simultaneously, alleviate its side effect to body, make flagellin there is the security of height as adjuvant.

One aspect of the present invention provides a kind of Salmonella typhimurtum flagellin mutant, there is the biological activity of flagellin, compared with wild-type mice Salmonella typhi flagellin, contain I411A sudden change (Isoleucine (I411) rite-directed mutagenesis on the 411st of Salmonella typhimurtum flagellin fliC gene becomes L-Ala (A)).

Further, described Salmonella typhimurtum flagellin mutant has immunological adjuvant activity.Compare wild-type mice Salmonella typhi flagellin, to Toll sample acceptor 5(Toll-like5, TLR5) stimulating activity weaken.

Further, the aminoacid sequence of Salmonella typhimurtum flagellin mutant of the present invention is:

SEQ?ID?NO:5

MAQVINTNSLSLLTQNNLNKSQSALGTAIERLSSGLRINSAKDDAAGQAIANRFTANIKGLTQASRNANDGISIAQTTEGALNEINNNLQRVRELAVQSANSTNSQSDLDSIQAEITQRLNEIDRVSGQTQFNGVKVLAQDNTLTIQVGANDGETIDIDLKQINSQTLGLDTLNVQQKYKVSDTAATVTGYADTTIALDNSTFKASATGLGGTDQKIDGDLKFDDTTGKYYAKVTVTGGTGKDGYYEVSVDKTNGEVTLAGGATSPLTGGLPATATEDVKNVQVANADLTEAKAALTAAGVTGTASVVKMSYTDNNGKTIDGGLAVKVGDDYYSATQNKDGSISINTTKYTADDGTSKTALNKLGGADGKTEVVSIGGKTYAASKAEGHNFKAQPDLAEAAATTTENPLQKADAALAQVDTLRSDLGAVQNRFNSAITNLGNTVNNLTSARSRIEDSDYATEVSNMSRAQILQQAGTSVLAQANQVPQNVLSLLR.

Second aspect present invention provides a kind of polynucleotide, its described Salmonella typhimurtum flagellin mutant of encoding.

Polynucleotide of the present invention can be DNA form or rna form.DNA form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.

Further, described polynucleotide sequence is:

SEQ?ID?NO:6

ATGGCACAAGTCATTAATACAAACAGCCTGTCGCTGTTGACCCAGAATAACCTGAACAAATCCCAGTCCGCTCTGGGCACCGCTATCGAGCGTCTGTCTTCCGGTCTGCGTATCAACAGCGCGAAAGACGATGCGGCAGGTCAGGCGATTGCTAACCGTTTTACCGCGAACATCAAAGGTCTGACTCAGGCTTCCCGTAACGCTAACGACGGTATCTCCATTGCGCAGACCACTGAAGGCGCGCTGAACGAAATCAACAACAACCTGCAGCGTGTGCGTGAACTGGCGGTTCAGTCTGCTAACAGCACCAACTCCCAGTCTGACCTCGACTCCATCCAGGCTGAAATCACCCAGCGCCTGAACGAAATCGACCGTGTATCCGGCCAGACTCAGTTCAACGGCGTGAAAGTCCTGGCGCAGGACAACACCCTGACCATCCAGGTTGGTGCCAACGACGGTGAAACTATCGATATCGATCTGAAGCAGATCAACTCTCAGACCCTGGGTCTGGATACGCTGAATGTGCAACAAAAATATAAGGTCAGCGATACGGCTGCAACTGTTACAGGATATGCCGATACTACGATTGCTTTAGACAATAGTACTTTTAAAGCCTCGGCTACTGGTCTTGGTGGTACTGACCAGAAAATTGATGGCGATTTAAAATTTGATGATACGACTGGAAAATATTACGCCAAAGTTACCGTTACGGGGGGAACTGGTAAAGATGGCTATTATGAAGTTTCCGTTGATAAGACGAACGGTGAGGTGACTCTTGCTGGCGGTGCGACTTCCCCGCTTACAGGTGGACTACCTGCGACAGCAACTGAGGATGTGAAAAATGTACAAGTTGCAAATGCTGATTTGACAGAGGCTAAAGCCGCATTGACAGCAGCAGGTGTTACCGGCACAGCATCTGTTGTTAAGATGTCTTATACTGATAATAACGGTAAAACTATTGATGGTGGTTTAGCAGTTAAGGTAGGCGATGATTACTATTCTGCAACTCAAAATAAAGATGGTTCCATAAGTATTAATACTACGAAATACACTGCAGATGACGGTACATCCAAAACTGCACTAAACAAACTGGGTGGCGCAGACGGCAAAACCGAAGTTGTTTCTATTGGTGGTAAAACTTACGCTGCAAGTAAAGCCGAAGGTCACAACTTTAAAGCACAGCCTGATCTGGCGGAAGCGGCTGCTACAACCACCGAAAACCCGCTGCAGAAAGCTGATGCTGCTTTGGCACAGGTTGACACGTTACGTTCTGACCTGGGTGCGGTACAGAACCGTTTCAACTCCGCTATTACCAACCTGGGCAACACCGTAAACAACCTGACTTCTGCCCGTAGCCGTATCGAAGATTCCGACTACGCGACCGAAGTTTCCAACATGTCTCGCGCGCAGATTCTGCAGCAGGCCGGTACCTCCGTTCTGGCGCAGGCGAACCAGGTTCCGCAAAACGTCCTCTCTTTACTGCGTTAA

Third aspect present invention provides a kind of expression vector, and it contains aforementioned polynucleotide.

Method well-known to those having ordinary skill in the art can be used for building described expression vector.These methods comprise recombinant DNA technology, DNA synthetic technology etc.The DNA of the described Salmonella typhimurtum flagellin mutant of coding can be effectively connected in the suitable promotor in expression vector, to instruct mRNA synthetic, and then expressing protein.

Preferably, described expression vector is prokaryotic vector.Further, described prokaryotic vector can be stablized and copy in salmonella, as prokaryotic vector pTrc99a, pYA3333, pYA3334 etc.

Fourth aspect present invention provides a kind of host cell, and it is transformed by aforementioned expression vector.

Host cell can be prokaryotic cell prokaryocyte, as bacterial cell; Or the eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurtum; Fungal cell is as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; CHO, the zooblast of COs.293 cell or Bowes melanoma cells etc.

Wherein, particularly preferably salmonella, as LB5000, ATCC14028s, X4550, SL5928, SL1438 etc.

Fifth aspect present invention provides the preparation method of described Salmonella typhimurtum flagellin mutant, comprises the following steps:

1) gene clone of described Salmonella typhimurtum flagellin mutant is entered to the Salmonella typhimurtum of fliC gene and fljB Gene Double disappearance, and under conditions suitable, cultivate described Salmonella typhimurtum, make flagellin at its thalline surface expression;

2) from culture, isolate described Salmonella typhimurtum flagellin mutant.

The method of isolating the bioactive albumen with flagellin from culture can adopt acid cleavage method to extract.

Sixth aspect present invention, provides described Salmonella typhimurtum flagellin mutant in the purposes of preparing in vaccine.

Further, described Salmonella typhimurtum flagellin mutant is in the time preparing vaccine, as immunological adjuvant.

Seventh aspect present invention, provides a kind of vaccine adjuvant, and its adjuvanticity composition contains described Salmonella typhimurtum flagellin mutant.

Further, described vaccine adjuvant also comprises pharmaceutically acceptable carrier or vehicle.

Inorganic or organic carrier or the vehicle of the known treatment inertia of this area branch art personnel include, but is not limited to lactose, W-Gum or derivatives thereof, talcum, vegetables oil, wax, fat, polyol for example polyoxyethylene glycol, water, sucrose, ethanol, glycerine, like that, various sanitass, lubricant, dispersion agent, correctives.Wetting Agent for Printing Inks, antioxidant, sweeting agent, tinting material, stablizer, salt, damping fluid is like that also can add wherein, these materials as required for help the stability of formula or contribute to improve active it biological effectiveness or oral in the situation that, produce acceptable mouthfeel or smell.

Eighth aspect present invention, provides a kind of vaccine, comprises described Salmonella typhimurtum flagellin mutant and one or more antigen.

There is many kinds of substance to can be used as the antigen in vaccine.For example, macromole, polysaccharide, toxoid, the recombinant antigen of attenuation and virus deactivation and bacterial pathogens, purifying, contain from the organism of the alien gene of pathogenic agent, synthetic peptide, polynucleic acid, antibody and tumour cell etc.

Flagellin of the present invention can make the innate immunity of TLR5 mediation weaken, and has significant adjuvanticity, can be used as other and look on the immunological adjuvant of albumen (bystander protein).

Brief description of the drawings

The enzyme of Fig. 1 recombinant plasmid pMD18T-fliC-WT is cut qualification result

M1.λ-EcoT14?digest?Marker;

M2.DL2000?DNA?Marker;

1.pMD18T-fliC-WT/NcoⅠ+HindIII.

The enzyme of Fig. 2 recombinant plasmid pMD18T-fliC-411 is cut qualification result

M1.λ-EcoT14?digest?Marker;

M2.DL2000?DNA?Marker;

1.pMD18T-fliC-411/NcoⅠ+HindIII.

The enzyme of Fig. 3 pTrc99a-fliC-WT and pTrc99a-fliC-411 is cut qualification result

M1.λ-EcoT14?digest?Marker;

M2.DL2000?DNA?Marker;

1.pTrc99a-fliC-WT/NcoⅠ+HindIII；

2.pTrc99a-fliC-411/NcoⅠ+HindIII.

Fig. 4 Western blot analyzes each restructuring salmonella flagellin

M.Protein?marker;

1.ATCC14028s?(pTrc99a-fliC-WT)flagellin;

2.ATCC14028s(pTrc99a-fliC-411)flagellin.

The detected result of Fig. 5 .pTrc99a-fliC-411 flagellin induction IL-8

Fig. 6 .pTrc99a-fliC-411 flagellin activates NF-κ B detected result

The detected result of Fig. 7 .pTrc99a-fliC-411 flagellin induction IL-1 β

Fig. 8 .pTrc99a-fliC-411 flagellin immunological adjuvant effect detection result

Embodiment

The expression of modified form flagellin of the present invention, is by fliC gene 411 amino acids I → A sudden change, and is cloned into prokaryotic expression carrier pTrc99a, is converted into final host ATCC14028s (fliC through intermediate host LB5000 ^-fljB ^-).Host Strains, after IPTG induction, can grow restructuring flagellum at bacterium surface.Extract through acid cleavage method, can obtain high purity flagellin mutant, this flagellin mutant has space conformation and the biological activity of natural flagellin.The innate immunity that it excites reduces, as NF-κ B reaction, the inflammatory cytokine secretions such as IL-8, IL-1 β reduce, after this albumen and OVA albumen mixed immunity mouse, its adjuvant effect is retained completely, illustrates that this modified form flagellin has important fundamental research and actual application value.

Before further describing the specific embodiment of the invention, should be understood that protection scope of the present invention is not limited to following specific specific embodiments; It is also understood that the term using in the embodiment of the present invention is in order to describe specific specific embodiments, instead of in order to limit the scope of the invention.

In the time that embodiment provides numerical range, unless should be understood that the present invention is otherwise noted, between two end points of each numerical range and two end points, any one numerical value all can be selected.Unless otherwise defined, the same meaning that all technology that use in the present invention and scientific terminology and those skilled in the art of the present technique understand conventionally.The concrete grammar that uses in embodiment, equipment, material, grasp according to those skilled in the art to prior art and record of the present invention, can also realize the present invention with any method, equipment and material similar to the method described in the embodiment of the present invention, equipment, material or prior art that be equal to.

Unless otherwise indicated, in the present invention, disclosed experimental technique, detection method, preparation method all adopt the routine techniques of molecular biology, biological chemistry, chromatin Structure and analysis, analytical chemistry, cell cultures, recombinant DNA technology and the association area of the art routine.These technology are existing in existing document improves explanation, specifically can be referring to Sambrook etc.

MOLECULAR CLONING:A LABORATORY MANUAL, Second edition, Cold Spring Harbor Laboratory Press, 1989and Third edition, 2001; Ausubel etc., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987and periodic updates; The series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolffe, CHROMATINSTRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol.304, Chromatin (P.M.Wassarman and A.P.Wolffe, eds.), AcademicPress, San Diego, 1999; With METHODS IN MOLECULAR BIOLOGY, Vol.119, Chromatin Protocols (P.B.Becker, ed.) Humana Press, Totowa, 1999 etc.

Embodiment 1

One, the clone of Salmonella typhimurtum fliC gene and construction of recombinant plasmid

By flagellin fliC gene 411 amino acids I → A rite-directed mutagenesises, the fliC gene of sudden change inserts in prokaryotic expression carrier pTrc99a, is built into recombinant plasmid pTrc99a-fliC-411.

1. the design of primer and gene amplification

With reference to Salmonella typhimurtum ATCC14028s DNA sequence dna design primer in GenBank, upstream primer is 5'-ATA cCATGGcACAAGTCATTAAT-3'(SEQ ID NO:1), downstream primer is 5'-TCA aAGCTTaACGCAGTAAAGAGAG-3'(SEQ ID NO:2), upstream and downstream primer with Nco I and HindIII site, has comprised initiator codon ATG respectively in upstream primer, and downstream primer has comprised fliC gene terminator codon.From Salmonella typhimurtum ATCC14028s, extracting genome is template, taking the sequence of SEQ ID NO:1 and SEQ ID NO:2 as amplimer, by high-fidelity enzyme pcr amplification fliC gene fragment, clip size is 1485 bp, after the fliC gene fragment PCR product of amplification is reclaimed, spend the night and be connected with 4 DEG C, pMD18T carrier (TaKaRa company), connect product and transform DH5 α competence bacterium, amicillin resistance screening, double digestion qualification (Fig. 1).Identify correct recombinant plasmid called after pMD18T-fliC-WT.

2. the Construction and identification of recombinant plasmid pMD18T-fliC-411

Design pair of primers, upstream primer: 5'-GAC TAT AAG GAC GAT GAT GAC AAA TA-3'(SEQ ID NO:3), downstream primer: 5'-AGCTTTCTGCAGCGGGTTTT-3'(SEQ ID NO:4), application TaKaRa MutanBEST Kit amplification pMD18T-fliC-WT plasmid, obtains the gene fragment fliC-411 that fliC gene 411 amino acids I → A suddenlys change.4 DEG C, fliC-411 gene fragment and pMD18T carrier spent the night and be connected, connect product and transform DH5 α competence bacterium, amicillin resistance screening, double digestion qualification (Fig. 2), identifies correct recombinant plasmid called after pMD18T-fliC-411.

3. the Construction and identification of recombinant plasmid pTrc99a-fliC-WT and pTrc99a-fliC-411

With Nco I and HindIII double digestion recombinant plasmid pMD18T-fliC-WT, pMD18T-fliC-411 and carrier pTrc99a, through electrophoresis, cut glue reclaim after, 4 DEG C of connections of spending the night of T4DNA ligase enzyme, connect product and transform DH5 α competence bacterium, amicillin resistance screening, double digestion qualification (Fig. 3), identifies correct recombinant plasmid called after pTrc99a-fliC-WT and pTrc99a-fliC-411.

Two, ATCC14028s (pTrc99a-fliC-WT) and ATCC14028s (pTrc99a-fliC-411) the restructuring structure of Salmonella typhimurtum and the extraction of flagellin thereof

Adopt electrotransformation that recombinant plasmid pTrc99a-fliC-WT or pTrc99a-fliC-411 are converted into after intermediate host bacterium LB5000 acquisition modification, then be converted into final host bacterium ATCC14028s (fliC ^-fljB ^-) (fliC gene and fljB Gene Double disappearance).

The structure of 1.LB5000 (pTrc99a-fliC-WT), LB5000 (pTrc99a-fliC-411) restructuring Salmonella typhimurtum and ATCC14028s (pTrc99a-fliC-411), ATCC14028s (pTrc99a-fliC-411) restructuring Salmonella typhimurtum

LB5000: Loma Linda university of the U.S.

ATCC14028s (fliC ^-fljB ^-): University of Washington university of the U.S..Can be with reference to Smith KD, Andersen-Nissen E, Hayashi F, Strobe K, Bergman MA, Barrett SL, Cookson BT, Aderem A (2003) Toll-like receptor 5 recognizes a conserved site on flagellin required for protofilament formation and bacterial motility.Nat Immunol4 (12): 1247-1253 document preparation.

Extract respectively pTrc99a-fliC-WT and the pTrc99a-fliC-411 plasmid in DH5 α with the little plasmid kit of carrying, with electroporation, respectively by above-mentioned recombinant plasmid importing LB5000 salmonella competent cell, transformed bacteria is coated containing 100 μ g/mL amicillin resistance LB flat boards and is screened; The single bacterium colony of picking extracts plasmid, and the qualification of checking order, by correct qualification recombinant bacterium called after LB5000 (pTrc99a-fliC-411) and LB5000 (pTrc99a-fliC-411).Extract respectively pTrc99a-fliC-WT and the pTrc99a-fliC-411 plasmid in intermediate host LB5000 salmonella with the little plasmid kit of carrying, respectively recombinant plasmid is imported to ATCC14028s (fliC with electroporation ^-fljB ^-) salmonella competent cell, transformed bacteria is coated containing 100 μ g/mL amicillin resistance LB flat boards and is screened; The single bacterium colony of picking extracts plasmid, and the qualification of checking order, and sequence is met to expection, identifies correct recombinant bacterium called after ATCC14028s (pTrc99a-fliC-WT) and ATCC14028s (pTrc99a-fliC-411).

Extraction and the Western blot analytical results of 2.ATCC14028s (pTrc99a-fliC-WT) and ATCC14028s (pTrc99a-fliC-411) restructuring Salmonella typhimurtum flagellin

The extraction procedure of each restructuring salmonella flagellin is: inoculate each restructuring salmonella to the 5mL M-broth containing 1mM IPTG and 100 μ g/mL penbritins, 37 DEG C of standing cultivations after 16-18h, with 1:100 enlarged culturing 16-18h.The centrifugal 20min of 500 × g, collects thalline, adds 5mL sterilizing PBS resuspended, bacteria suspension pH value is adjusted to 2.0-3.0 with 1N HCl, and packing 2mLeppendorf manages 5 and manages, every pipe 1mL, the room temperature 150rpm 30min that vibrates.4 DEG C of centrifugal 10min of 4000rpm, collect after supernatant and continue centrifugal 5min results supernatant at 8000rpm, 10000rpm and 12000rpm respectively, then supernatant pH are adjusted to 7.2 with 1N NaOH, and in PBS damping fluid, 4 DEG C of 24h that dialyse, change PBS damping fluid one time every 6h.Application ProteoSpin ^tMendotoxin Removal Maxi test kit and Pierce High-Capacity Endotoxin Removal Spin go intracellular toxin post to remove the intracellular toxin of the flagellin that extracts, and intracellular toxin ultimate density is lower than 0.1EU/ μ g albumen,

The each restructuring salmonella flagellin extracting is carried out to Western blot analysis: after SDS-PAGE electrophoresis, albumen is transferred on pvdf membrane, with the PBST4 DEG C of effect 12h containing 10%BSA; PBST washs after 3 times, then acts on 2h with Hi single-factor diagnostic serum (1:500 dilution), and fully after washing, the goat anti-rabbit igg using HRP mark acts on 1h as two anti-(1:1000 dilutions), and PBST washs after 3 times, DAB colour developing, distilled water termination reaction.Western blot result shows, ATCC14028s (pTrc99a-fliC-WT) and ATCC14028s (pTrc99a-fliC-411) restructuring salmonella flagellin all can with the anti-Hi single-factor of rabbit diagnostic serum generation specific reaction, albumen size is all about 52KD(Fig. 4).

Three, flagellin mutant excites the mensuration of innate immunity ability

1. flagellin mutant activates the detection of TLR5

In 96 well culture plates, every hole adds 200 μ L 293-mTLR5 cell (Invivogen company) suspensions, 50,000 cells/well.37 ° of C, 5%CO ₂incubated overnight.The pTrc99a-fliC-WT that is 0.1ng-100ng with 10 times of serial dilution final concentrations or pTrc99a-fliC-411 flagellin stimulate, and draw supernatant to measure IL-8 content after stimulation 5h.

BD OptEIA ^tMset Mouse IL-8ELISA step is as follows: the IL-8 mono-clonal capture antibodies (BD company) that the coated 100 μ L in every hole have diluted on elisa plate, 4 ° of coated spending the night of C; Wash after plate 3 times with 0.05%PBST, seal 1h with 200 μ L confining liquids in room temperature; Wash after plate 3 times with method, every hole adds 100 μ L standard substance or samples, at room temperature effect 2h; Wash after plate 5 times with method, every hole adds 100 μ L testing reagent (IL-8 mono-clonal detects antibody)+SAV-horseradish peroxidase, BD company), room temperature effect 1h; Wash after plate 7 times with method, every hole adds 100 μ L substrate buffer solutions, in the dark room temperature effect 30min; Last every hole adds 50 μ L2N H ₂sO ₄stop buffer.Measure reading in wavelength and OD570nm reference wavelength in the inherent OD450nm of 30min.As shown in Figure 5, pTrc99a-fliC-411 activates TLR5 ability will be weaker than wild-type flagellin to result.

2. flagellin mutant activates and detects NF-κ B

Plasmid pNiFty-SEAP transfection 293-mTLR5 cell.According to LyoVec ^tMthe technical specification providing is prepared pNiFty _-sEAP/LyoVec ^tMmixture, 50,000 cells of every hole 200 μ L pavings on 96 hole flat boards, every hole adds 10 μ LpNiFty (2)-SEAP/LyoVec ^tMmixture transfection; 37 ° of C, 5%CO ₂cultivate 24h.

Flagellin stimulates.First carefully suck substratum, every hole adds the fresh growth medium of 180 μ L.Add 20 μ L flagellins, final concentration is 500pg/mL, and establishes positive control and negative control; 37 ° of C, 5%CO ₂cultivate 20h.

SEAP detection by quantitative.In 96 orifice plates, add QUANTI-Blue ^tMdetect solution, 180 μ L/ holes, then add above-mentioned flagellin to stimulate the culture supernatant of 293-mTLR5 cell, 20 μ L/ holes; 37 ° of C, 5%CO ₂cultivate 2h; Measure OD630nm light absorption value, determine SEAP value.As shown in Figure 6, fliC-411 flagellin has significantly and weakens compared with the NF-κ B activation capability of wild-type flagellin result.

3. the detection of flagellin inducing mouse peritoneal exudate cells (peritoneal exudate cell, PEC) secretion IL-1 β inflammatory cytokine

Prepare according to a conventional method mouse PEC, with 2 × 10 ⁵μ L//hole, individual cell/200 adds in 96 orifice plates, 37 ° of C, 5%CO ₂cultivate after 2h, inhale and abandon supernatant, wash 2 times with the RPMI1640 substratum of preheating, leave attached cell.At 5%CO ₂, under 37 DEG C of conditions, all stimulate PEC 24h taking each flagellin final concentration as 10 μ g/mL, set up PBS contrast simultaneously.Draw supernatant, ELISA detects IL-1 β content.

BD OptEIA ^tMset Mouse IL-1 β ELISA step is as follows: on elisa plate, the coated 100 μ L in every hole have diluted IL-1 β mono-clonal capture antibodies (BD company), 4 ° of coated spending the night of C; Wash after plate 3 times with 0.05%PBST, seal 1h with 200 μ L confining liquids in room temperature; Wash after plate 3 times with method, every hole adds 100 μ L standard substance or samples, at room temperature effect 2h; Wash after plate 5 times with method, every hole adds 100 μ L IL-1 β mono-clonals to detect antibody (BD company) at room temperature effect 1h; Wash after plate 5 times with method, the SAV-HRP that every hole adds 100 μ L to dilute, at room temperature effect 30min; Wash after plate 7 times with method, every hole adds 100 μ L substrate buffer solutions, in the dark room temperature effect 30min; Last every hole adds 50 μ L2N H ₂sO ₄stop buffer, measures reading in wavelength and OD570nm reference wavelength at OD450nm.

As shown in Figure 7, pTrc99a-fliC-411 flagellin is compared with its wild-type flagellin for result, and the ability of its induction scavenger cell secretion IL-1 β reduces.

Four, the immunological adjuvant activity of flagellin mutant

By age in 6-8 week female C57BL/6 mouse be divided into 4 groups, 5 every group, be respectively wild-type flagellin (pTrc99a-fliC-WT)+OVA immune group, flagellin mutant (pTrc99a-fliC-411)+OVA immune group, OVA control group and blank group.Immunization route is abdominal injection (ip), and immunity is carried out at twice, within the 14th day, carries out two and exempt from after head exempts from.PTrc99a-fliC-WT+OVA immune group: pTrc99a-fliC-WT0.5 μ g+OVA50 μ g, pTrc99a-fliC-411+OVA immune group: pTrc99a-fliC-4110.5 μ g+OVA50 μ g, OVA protein immunization group: 50 μ g, PBS blank group: 200 μ L.Two exempt from rear the 10th day eye socket venous blood collection, collect serum sample.With the every hole of OVA albumen 1 μ g coated elisa plate, detect OVA protein-specific IgG antibody in serum to be checked.As shown in Figure 8, flagellin mutant (pTrc99a-fliC-411) adjuvanticity and wild-type flagellin (pTrc99a-fliC-WT) are suitable for result.

The above; it is only preferred embodiment of the present invention; not to any formal and substantial restriction of the present invention; should be understood that; for those skilled in the art; do not departing under the prerequisite of the inventive method, also can make some improvement and supplement, these improvement and the supplementary protection scope of the present invention that also should be considered as.All those skilled in the art, without departing from the spirit and scope of the present invention, a little change of making when utilizing disclosed above technology contents, the equivalent variations of modifying and developing, be equivalent embodiment of the present invention; Meanwhile, the change of any equivalent variations that all foundations essence technology of the present invention is done above-described embodiment, modification and differentiation, all still belong in the scope of technical scheme of the present invention.

Claims

1. a Salmonella typhimurtum flagellin mutant, there is the biological activity of flagellin, compared with wild-type mice Salmonella typhi flagellin, contain I411A sudden change, the expression of described Salmonella typhimurtum flagellin mutant, be by fliC gene 411 amino acids I → A sudden change, and be cloned into prokaryotic expression carrier pTrc99a, be converted into final host ATCC14028s (fliC through intermediate host LB5000 ^-fljB ^-), Host Strains, after IPTG induction, grows restructuring flagellum at bacterium surface.

2. Salmonella typhimurtum flagellin mutant as claimed in claim 1, is characterized in that, compare wild-type mice Salmonella typhi flagellin, described Salmonella typhimurtum flagellin mutant weakens the stimulating activity of To11 sample acceptor 5.

3. Salmonella typhimurtum flagellin mutant as claimed in claim 1, is characterized in that, the aminoacid sequence of described Salmonella typhimurtum flagellin mutant is: SEQ ID NO:5.

4. the preparation method of Salmonella typhimurtum flagellin mutant described in the arbitrary claim of claim 1-3, comprises the following steps:

1) expression of Salmonella typhimurtum flagellin mutant: by fliC gene 411 amino acids I → A sudden change, and be cloned into prokaryotic expression carrier pTrc99a, be converted into final host ATCC14028s (fliC through intermediate host LB5000 ^-fljB ^-), Host Strains, after IPTG induction, grows restructuring flagellum at bacterium surface; ;

2) from culture, isolate described Salmonella typhimurtum flagellin mutant.

As described in claim as arbitrary in claim 1-3 Salmonella typhimurtum flagellin mutant in the purposes of preparing in vaccine.

6. purposes as claimed in claim 5, is characterized in that, described Salmonella typhimurtum flagellin mutant is in the time preparing vaccine, as immunological adjuvant.

7. a vaccine adjuvant, its adjuvanticity composition contains Salmonella typhimurtum flagellin mutant described in the arbitrary claim of claim 1-3.

8. a vaccine, comprises Salmonella typhimurtum flagellin mutant and one or more antigen described in the arbitrary claim of claim 1-3.