CN101234197B - Recombination attenuation salmonella typhimurium vector vaccine and preparation - Google Patents
Recombination attenuation salmonella typhimurium vector vaccine and preparation Download PDFInfo
- Publication number
- CN101234197B CN101234197B CN200810069320A CN200810069320A CN101234197B CN 101234197 B CN101234197 B CN 101234197B CN 200810069320 A CN200810069320 A CN 200810069320A CN 200810069320 A CN200810069320 A CN 200810069320A CN 101234197 B CN101234197 B CN 101234197B
- Authority
- CN
- China
- Prior art keywords
- espa
- stx2b
- salmonella typhimurium
- preparation
- attenuated salmonella
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention relates to a carrier vaccine for recombinant attenuated Salmonella typhimurium, which comprises antigen subunits EspA, IntiminC300 and Stx2B. The antigen subunits root in Entero hemorrhagic Escherichia coli (EHEC) O157:H7. The invention also relates to a preparation method of the carrier vaccine for recombinant attenuated Salmonella typhimurium. The vaccine strain constructed by the invention can be subcultured stably in vitro with selection pressure or not, which is proved by an immune rat that the vaccine has good immunogenicity and immunity protection effect. The immune rate is immunized with an immune scheme combining oral administration of the vaccine strain and injecting recombinant protein subcutaneously or in muscles.
Description
Technical field
The present invention relates to a kind of exploitation of biovaccine, relate in particular to a kind of recombination attenuated salmonella typhimurium carrier vaccine and preparation method.
Background technology
Enterohemorrhagic Escherichia coli (EHEC) O157:H7 is a main serotype of enterohemorrhagic Escherichia coli, infect this bacterium and can make the people suffer from diarrhoea, hemorrhagic colitis, also can cause complication such as hemolytic uremic syndrome and thrombocytopenic purpura, severe patient can cause death.Be confirmed as from nineteen eighty-two between more than 20 year of pathogenic bacterium the outbreak of epidemic of a lot of O157 having taken place all over the world, show that the infection of O157:H7 has become a global public health problem.Yet lack the effectively preventing method at present, studies confirm that antibiotic can impel the O157 bacterium to discharge lethal shiga toxin (Stx), thereby the danger of the concurrent hemolytic uremic syndrome of patient is increased, and therefore, development O157 vaccine has earth shaking meaning to prevention and control O157 infection.
EHEC O157:H7 pathogenic mainly is embodied in antibacterial in the intravital adhesion field planting of host with produce aspect two of the toxin.Adhesion is the first step of bacterial infection with field planting.Tight adhesion element (Intimin) is the transmembrane protein that a kind of molecular weight is about 96KD, also is the important and special adhesion molecule of O157 bacterium.Antibacterial mainly passes through Intimin and receptor thereof, and (the plain receptor of transposition tight adhesion, interaction Tir) adheres to enterocyte, causes wiping (A/E:attaching/effacing) damage.The film outskirt of Intimin (C end fragment IntiminC) is the functional areas with the Tir receptors bind.The specific antibody that has experiment to point out Intimin and IntiminC all can be blocked the adhesion of antibacterial and then make its forfeiture pathogenicity; has stronger immune protective (Aleksic.S; H.Karch; J.BockemuhI, et al.A biotyping scheme for Shia-like (Vero) toxin-producing Escherichia coli O157 and a list of serological cross-reactionsbetween O157 and other Gramnegative bacteria.Int.J.Med.Microbiol.1992:276:221-230).And cause and mediate primary structure unit EHEC III type excretory system (the type-III secretion system of O157 bacterial adhesion field planting, TTSS) secretory protein EspA (Esp is E.coli secreted protein abbreviation) can form tubular structure at bacterium surface, be the passage that multiple effect protein and Tir enter host cell, the transmission of signal when also participating in simultaneously A/E damage formation.There are some researches show that EspA has good immunogenicity and immune protective.In addition, EHEC O157:H7 mainly produces two kinds of toxin, be called shiga toxin I (Stx1) and shiga toxin II (Stx2) (Paola Marcato, George Mulvey, Randy J.Read, etal.Immunoprophylactic Potential of Cloned Shiga Toxin 2B Subunit.J InfectDis.2001; 183:435-443).In bacterial body, Stx2 is a secretion type expression, and Stx1 expresses in the born of the same parents.Two kinds of toxin are formed by 1 A subunit and 5 B subunits, and the A subunit has toxicity in the cell, can cause protein synthesis to stop with 28S rRNA effect, and be Escherichia coli O 157: H7 causes the pathologic basis of clinical manifestation; The B subunit has the cell binding characteristic, can combine with the cell of special receptor (Gb3), thereby guiding A subunit plays a role. shiga toxin (Stx) directly kills the epithelial cell on intestinal villus surface on the one hand, the enteric epithelium that is caused by Stx damages with LPS on the other hand, inflammatory factor can promote Stx to pass through enterocyte to enter blood circulation and cause intestinal, the damage of the organ that central nervous system and Gb3 content receptor are higher. most O157:H7 antibacterials produce Stx2, its toxicity is better than Stx1, more close with the dependency of hemolytic uremic syndrome (HUS) and thrombocytopenic purpura,thrombotic severe complications such as (TTP), therefore Stx2 be this bacteria pathogenic clonal expressions such as important substance basis .Paola Marcato shiga-like toxin II in conjunction with subunit (Stx2B) and explored its immune protective, find that Stx2B is nontoxic, and has good immune protection, effect (the Paola Marcato that has the blocking-up toxin at the monoclonal antibody of Stx2B, George Mulvey, Randy J.Read, et al.Immunoprophylactic Potential of Cloned Shiga Toxin 2BSubunit.J Infect Dis.2001; 183:435-443).
Attenuated salmonella typhimurium can be by adhering to, attack, settle down in gut-associated lymphoid tissue, and through mesenteric lymph node arrival liver, spleen, further stimulate body to produce mucosa, cell and humoral immunoresponse(HI) effectively, be to carry antigenic good carrier and natural mucosal adjuvant, become the new way of vaccination.According to common mucosal immunity theory, with the attenuation salmonella typhi be the oral vaccine made of carrier can be in the oral cavity, mucosal sites such as mammary gland, reproductive tract, lachrymal gland brings out stronger mucosal immunity, and the mode safety of oral vaccination can avoid causing because of injecting immune the infection of HIV (human immunodeficiency virus) and hepatitis virus etc.Particularly recently utilize not with antibiotic and demonstrated good prospects for application as the attenuated salmonella typhimurium carrier vaccine that carrier-host's balanced lethal system of selection pressure makes up.
Summary of the invention
The present invention is directed to existing O157:H7 recombinant vaccine and have weak points such as protection poor effect; being intended to by making up with the attenuated salmonella typhimurium is the enterorrhagia Bacillus coil 0157 of carrier: H7 vaccine and combined immunization strategy oral and subcutaneous or that intramuscular injection albumen combines provide a kind of new O 157:H7 vaccine; the recombination attenuated salmonella typhimurium carrier vaccine that provides of the present invention; it comprises antigen subunit EspA; IntiminC300 and Stx2B; wherein, above-mentioned antigens subunit EspA; IntiminC300 and Stx2B derive from enterorrhagia Bacillus coil 0157: H7.
Another object of the present invention provides the preparation method of above-mentioned recombination attenuated salmonella typhimurium carrier vaccine, and it mainly may further comprise the steps:
1) obtains fusion gene EspA-IntiminC300, EspA-IntiminC300-Stx2B by PCR method;
2) fusion gene is connected with expression vector respectively, obtains recombinant expression plasmid;
3) recombinant expression plasmid transforms first intermediate host's bacterial strain, obtains recon;
4) recon transforms seocnd intermediate host's bacterial strain, identifies positive recombinant;
5) identify in the step 4) that correct positive recombinant transforms the final host bacterial strain;
6) abduction delivering obtains recombination attenuated salmonella typhimurium carrier vaccine;
7) authentication step 6) in the expression of EspA, IntiminC300, Stx2B in the recombination attenuated salmonella typhimurium carrier vaccine that obtains;
8) immunogenicity of EspA, IntiminC300, Stx2B in the recombination attenuated salmonella typhimurium carrier vaccine that obtains in the detection step 6);
9) recombination attenuated salmonella typhimurium carrier vaccine counteracting toxic substances protection experiment;
10) having, carrying out subculture in vitro separately under the situation of no selection pressure and cultivate, identify recombination attenuated salmonella typhimurium carrier vaccine stability.
The PCR primer that uses when wherein obtaining EspA-IntiminC300 by PCR method in the step 1) is shown in SEQ ID NO:1-2, and the PCR primer that uses when obtaining EspA-IntiminC300-Stx2B by PCR method is shown in SEQ ID NO:3-4; Step 2) expression vector described in is preferably pYA3149; First intermediate host's bacterial strain described in the step 3) is preferably escherichia coli X6097; Seocnd intermediate host's bacterial strain described in the step 4) is preferably attenuated salmonella typhimurium X3730; Final host bacterial strain described in the step 5) is preferably attenuated salmonella typhimurium X4550, and wherein said attenuated salmonella typhimurium X4550 is preferably asd gene defection type bacterial strain; Can detect the immunogenicity of EspA, IntiminC300, Stx2B in the step 8) by the Western immunoblotting.
Recombination attenuated salmonella typhimurium carrier vaccine of the present invention can be used for immune enterohemorrhagic Escherichia coli, and it can pass through oral immunity or booster immunization, and oral immunity specifically can be: about 4 * 108CFU//time, and each 1～2 week at interval; Booster immunization specifically can be: behind the oral immunity 2～4 times at interval certain hour by the subcutaneous or proteic mode booster immunization of intramuscular injection once, certain hour described here is decided on the situation of organism, can be one all or one month etc.
The recombination attenuated salmonella typhimurium carrier vaccine strain of expression enterohemorrhagic Escherichia coli (EHEC) O157:H7EspA, IntiminC300, Stx2B fusion rotein that the present invention has adopted the balance-system constructing that causes death; and no matter the vaccine strain that makes up has or not selection pressure all can stably cultivate at subculture in vitro separately, has good immunogenicity and immune protective effect by this vaccine of proof behind oral vaccine strains and subcutaneous or the immunization protocol immune mouse that the intramuscular injection recombiant protein combines.Advantage of the present invention mainly is: 1) successfully made up recombination attenuated salmonella typhimurium carrier, and effective expression enterohemorrhagic Escherichia coli (EHEC) O157:H7 EspA, IntiminC300, Stx2B fusion rotein; 2) utilizing Salmonella typhimurium the same with enterohemorrhagic Escherichia coli all is intestinal, and adhesion, field planting excite mucosal immunity effectively to the characteristic of mucosa system easily; 3) the oral carrier vaccine strains has improved for high-risk group (old man, child), popular area occurred frequently or the immune effect in season greatly with combined immunization strategy subcutaneous or that intramuscular injection albumen combines, effectively prevention and control enterohemorrhagic Escherichia coli (EHEC) O157:H7 infect, and reduce infection rate; 4) this immunization strategy also has reference to other vaccines.
Oral carrier vaccine strains of the present invention has improved for high-risk group (old man, child), popular area occurred frequently or the immune effect in season greatly with combined immunization strategy subcutaneous or that intramuscular injection albumen combines, effectively prevention and control enterohemorrhagic Escherichia coli (EHEC) O157:H7 infect, and reduce infection rate.
For above and other objects of the present invention, feature and advantage can be become apparent, preferred embodiment cited below particularly, and conjunction with figs. are described in detail below.
Description of drawings
Fig. 1: recombiant plasmid pYA3149-EspA-IntiminC300 construction strategy figure;
Fig. 2: EspA-IntiminC300PCR result, wherein swimming lane 1 is nucleic acid (DNA) molecular weight standard (Marker), swimming lane 2EspA-IntiminC300PCR result (about 1476bp);
Fig. 3: the enzyme action of recombiant plasmid pMD18-T-EspA-IntiminC300 is identified figure,
Fig. 4: the enzyme action evaluation of recombiant plasmid pYA3149-EspA-IntiminC300/x6097,
Fig. 5: PCR identifies pYA3149-EspA-IntiminC300/X3730 and pYA3149-EspA-IntiminC300/X4550 result,
Fig. 6: recombiant plasmid pYA3149-EspA-IntiminC300-Stx2B construction strategy figure;
The PCR result of Fig. 7: EspA-IntiminC300-Stx2B,
Fig. 8: the enzyme action qualification result of recombiant plasmid pYA3149-EspA-IntiminC300-Stx2B/X6097,
Fig. 9: PCR identifies pYA3149-EspA-IntiminC300-Stx2B/X3730 and pYA3149-EspA-IntiminC300-Stx2B/X4550 result,
Figure 10: the expression of recombiant protein pYA3149-EspA-IntiminC300/x4550, pYA3149-EspA-IntiminC300-Stx2B/x4550,
Figure 11: west-blotting identifies the immunoreactivity of EspA-IntiminC300, EspA-IntiminC300-Stx2B,
Figure 12 A-12F: mouse spleen, mesenteric lymph node, terminal ileum immunofluorescence testing result,
Wherein 12A is mouse spleen negative control (* 400), 12B is that immunity back mouse spleen immunofluorescence detects (* 400), 12C is a mice mesenteric lymph node negative control (* 400), 12D is that immunity back mice mesenteric lymph node immunofluorescence detects (* 400), 12E is a mice terminal ileum negative control (* 400), and 12F is that immunity back mice terminal ileum immunofluorescence detects (* 400).
The specific embodiment
The present invention utilizes carrier-host's balanced lethal system of pYA3149 to express the EspA of EHEC O157:H7 and the fusion protective antigen of IntiminC300, Stx2B; structure is enterohemorrhagic Escherichia coli (EHEC) the O157:H7 vaccine of carrier with the attenuated salmonella typhimurium; and immunogenicity and immune protective by animal experimental observation recombinant vector vaccine, for development new O 157 vaccines provide experimental basis.
The present invention at first adopts technique for gene engineering to clone EspA-IntiminC300 and EspA-IntiminC300-Stx2B gene; and utilize expression vector pYA3149 successfully in final host bacterium-attenuated salmonella typhimurium X4550, to express. the used attenuated salmonella typhimurium X4550 of the present invention has following feature: it is asd gene defection type antibacterial; because the asd gene is a DAP (meso diaminopimelic acid; the main component of gram-negative bacteria cell wall) essential enzyme in the biosynthesis pathway; the disappearance of this gene can cause the bacteriolyze death under the condition that no exogenous DAP exists of this mutant; thereby efficient attenuation. attenuated salmonella typhimurium can be expressed exogenous antigen; per os in mammal; nose; mucosal route immunity such as rectum can be induced powerful and special immunoreation. can settle down at host's small intestinal and gut associated lymphoid tissue; not pathogenic and can stable expression of exogenous gene. expressed target antigen does not need purification; can be directly used in the immunoprotection test, the complicated procedures of forming of having removed the protein post processing from.
In the structure of fusion rotein, patent application with the applicant, publication number is CN101062410, name is called " a kind of enterorrhagia Bacillus coil 0157: H7 recombinant vaccine and preparation method thereof ", the plasmid pET-28a-EspA-IntiminC300 plasmid that makes up in the 5/16th page of the description is a template, and the PCR primer that contains EcoRI and two restriction enzyme sites of HindIII by design carries out.
The main technological route that the present invention adopts is as follows:
1. the structure of recombination engineering pYA3149-EspA-IntiminC300,
2. the structure of recombination engineering pYA3149-EspA-IntiminC300-Stx2B,
3. enterorrhagia Bacillus coil 0157: the acquisition of H7 fusion gene EspA-IntiminC300-Stx2B,
4. enterorrhagia Bacillus coil 0157: the structure of H7 recombinant expression plasmid pYA3149-EspA-IntiminC300-Stx2B,
5. enterorrhagia Bacillus coil 0157: H7 antigen protein EspA, IntiminC300, Stx2B expression and the immunogenicity in recombinant attenuated Salmonella detects,
6. the counteracting toxic substances of the recombination attenuated salmonella typhimurium carrier vaccine of enterorrhagia Bacillus coil 0157: H7 protection experiment.
Below in conjunction with specific embodiment; further set forth the present invention; these embodiment are used for the preparation method of a kind of vaccine of the present invention is described; all the other compound modes similarly; it should be understood that these embodiment are used to illustrate the present invention, rather than limitation of the present invention; under design prerequisite of the present invention,, all belong to the scope of protection of present invention to the simple modifications of preparation method of the present invention.
1. design of primers and pcr amplification
1) primer design and synthetic
Patent application with the applicant, publication number is CN101062410, name is called " a kind of enterorrhagia Bacillus coil 0157: H7 recombinant vaccine and preparation method thereof ", the nucleotide sequence of EspA, IntiminC300 in the 5/16th page of the description (among the application respectively shown in SEQ ID NO:5, SEQ ID NO:6) and design of primers principle, design a pair of primer, forward primer 5 ' end is introduced the EcoRI restriction enzyme site, and downstream primer 5 ' end is introduced the HindIII restriction enzyme site.
P1(SEQ?ID?NO：1)：5′-CG
GAATTCATGGATACATCAAATGCAAC-3′；EcoRI
P2(SEQ?ID?NO：2)：5′-CG
AAGCTTTCATTCTACACAAACCGCAT-3′。
HindIII
P1 (SEQ ID NO:1) is positioned at the upstream of EspA-IntiminC300 gene, be added with the EcoRI restriction enzyme site, P2 (SEQ ID NO:2) is positioned at the downstream of EspA-IntiminC300 gene, is added with HindIII restriction enzyme site (primer is given birth to worker's gene technology company limited by Shanghai and synthesized).
2) pcr amplification of genes of interest:
The preparation of template: with the applicant's patent application, publication number is CN101062410, name is called " a kind of enterorrhagia Bacillus coil 0157: H7 recombinant vaccine and preparation method thereof ", the 5/16th page of description) in the pET-28a-EspA-IntiminC300 plasmid be template.
The pcr amplification reaction system is as follows:
P1(25pmol/μl) 1μl
P2(25pmol/μl) 1μl
10 * Ex Taq cushions (no Mg
2+) 5 μ l
dNTPs(25mmol/L) 4μl
Ex Taq archaeal dna polymerase (5U/ μ l) 0.25 μ l
MgCl
2(25mmol/L) 4μl
ddH
2O 33.75μl
Cumulative volume 50 μ l
With the reaction system mixing, after the centrifugal treating, add 20 μ l paraffin oil.React on the PCR instrument by following loop parameter: 94 ℃ of pre-degeneration 5 minutes, 35 circulations ℃ 1 minute are carried out in 94 ℃ of 30sec → 55 ℃ 30sec → 72 then, and last 72 ℃ were extended 10 minutes.Get 3 μ l product after reaction finishes, 2.0% agarose gel electrophoresis detects PCR effect (Fig. 1 and Fig. 2).
2.PCR the clone of product
The EspA-IntiminC300 gene fragment clone that obtains is gone into pMD18-T, Transformed E .coli DH5 α, ammonia benzyl resistance screening positive recombinant, the extracting plasmid is done double digestion with EcoRI and HindIII respectively and is identified, identifies that correctly genetic fragment (Fig. 3) is reclaimed in the back.
Overall test step: extracting pMD18-EspA-IntiminC300 plasmid, behind the EcoRI+HindIII double digestion, reclaim genes of interest EspA-IntiminC300 fragment, be connected construction recombination plasmid pYA3149-EspA-IntiminC300 with the pYA3149 carrier segments that behind the EcoRI+HindIII double digestion, reclaims equally.Be specially:
1. plasmid extraction
Extracting plasmid pYA3149 and pMD18-EspA-IntiminC300.
2. endonuclease reaction
Carrier pYA3149 and pMD18-EspA-IntiminC300 all use the EcoRI+HindIII double digestion.
3. the segmental recovery of purpose behind the enzyme action.
4. coupled reaction
UV spectrophotometer measuring genes of interest EspA-IntiminC300 fragment, the about 100ng/ μ of nucleic acid content l, the about 1476bp of clip size; PYA3149 reclaims the about 100ng/ μ of fragment concentrations l, and size is about 3726bp.According to inserting fragment and carrier mole ratio is 5～10: 1 principle, and it is as follows to design the coupled reaction system: (setting up the matched group that does not add exogenous dna fragment simultaneously)
The sample contrast
EspA-IntiminC300 fragment (50ng/ μ l) 9 μ l 0 μ l
PYA3149 fragment (100ng/ μ l) 8 μ l 1 μ l
T
4Dna ligase 1 μ l 1 μ l
ddH
2O 0 7μl
10 * ligase buffer, 2 μ l, 11 μ l
Cumulative volume 20 μ l 20 μ l
22 ℃ of connections are spent the night.
5. connect product and transform the host bacterium
(1) E.coli x6097 electricity changes the preparation of competence bacteria.
(2) salmonella x3730, the x4550 electricity changes competent preparation.
(3) contain the preparation of the LB flat board of DAP.
(4) connecting product transforms:
To connect the product electricity and change host bacterium E.coli x6097 over to, the recon electricity of again enzyme action being identified correct (Fig. 4) changes among the intermediate host bacterium x3730: because of plasmid copy number in the reorganization salmonella lower, utilize the PCR method to identify, PCR is identified that correct recon electricity changes among the final host bacterium x4550, method is the same, and identifies through the PCR method.
6. the evaluation of recombinant expression plasmid
(1) enzyme action is identified correct recon electricity changes among the intermediate host bacterium x3730.Because of plasmid copy number in the reorganization salmonella is lower, utilize the PCR method to identify, PCR is identified that correct recon electricity changes among the final host bacterium x4550, method is the same, and identifies (Fig. 5) through the PCR method.
(2) because of containing an AfaI single endonuclease digestion site in the IntiminC300 gene order, fusion gene EspA-IntiminC300 enzyme action can be grown into two fragments of 1046bp and 430bp.Therefore with the AfaI restricted enzyme genes of interest is carried out enzyme action further, to judge its correctness.
(3) target gene sequences is measured: give birth to worker company by Shanghai and finish (gene order of fusion gene EspA-IntiminC300 is shown in SEQ ID NO:8).
1. primer design reaches synthetic:
Patent application with the applicant, publication number is CN101062410, name is called " a kind of enterorrhagia Bacillus coil 0157: H7 recombinant vaccine and preparation method thereof ", EspA, IntiminC300 in the 5/16th page of the description, the nucleotide sequence of Stx2B (among the application respectively shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7) and design of primers principle, design a pair of primer, forward primer 5 ' end is introduced the EcoRI restriction enzyme site, and downstream primer 5 ' end is introduced the HindIII restriction enzyme site.
P1(SEQ?ID?NO：3)5′G
GAATTCGATACATCAAATGCAACATCCG 3′
EcoRI
P2(SEQ?ID?NO：4)5′CGC
AAGCTTTCAGTCATTATTAAACTGCACTTCAGC 3′
HindIII
P1 (SEQ ID NO:3) is positioned at the upstream of EspA-IntiminC300-Stx2B gene, be added with the EcoRI restriction enzyme site, P2 (SEQ ID NO:4) is positioned at the downstream of EspA-IntiminC300-Stx2B gene, is added with HindIII restriction enzyme site (primer is given birth to worker's gene technology company limited by Shanghai and synthesized).
2. the pcr amplification of genes of interest:
The preparation of template: with the applicant's patent application, publication number is CN101062410, name is called " a kind of enterorrhagia Bacillus coil 0157: H7 recombinant vaccine and preparation method thereof ", and the fusion plasmid EspA-IntiminC300-Stx2B in the 5/16th page of the description is a template.
The pcr amplification reaction system is as follows:
P1(25pmol/μl) 1μl
P2(25pmol/μl) 1μl
10 * Ex Taq buffer (Mg2+free), 5 μ l
dNTPs(25mmol/L?each) 4μl
Ex Taq archaeal dna polymerase (5U/ μ l) 0.25 μ l
MgCl
2(25mmol/L) 4μl
ddH
2O 33.75μl
Cumulative volume 50 μ l
With the reaction system mixing, after the centrifugal treating, add 20 μ l paraffin oil.React on the PCR instrument by following loop parameter: 94 ℃ of pre-degeneration 5 minutes, 94 ℃ 30 seconds → 54 ℃ 30 seconds → 72 ℃ were carried out 35 circulations in 1 minute then, and last 72 ℃ were extended 10 minutes.Get 3 μ L product after reaction finishes, 1.0% agarose gel electrophoresis detects PCR effect (Fig. 7).
3.PCR product reclaims.
4.PCR the clone of product
The EspA-IntiminC300-Stx2B gene fragment clone that obtains is gone into pMD18-T, Transformed E .coliDH5 α, ammonia benzyl resistance screening positive recombinant, the extracting plasmid is done double digestion with EcoRI and HindIII respectively and is identified, identifies that correctly genetic fragment is reclaimed in the back.
Embodiment 4 enterorrhagia Bacillus coil 0157s: the structure of H7 recombinant expression plasmid pYA3149-EspA-IntiminC300-Stx2B
Total step: extracting pMD18-EspA-IntiminC300-Stx2B plasmid, behind the EcoRI+HindIII double digestion, reclaim genes of interest EspA-IntiminC300-Stx2B fragment, be connected construction recombination plasmid pYA3149-EspA-IntiminC300-Stx2B (Fig. 6) with the pYA3149 carrier segments that behind the EcoRI+HindIII double digestion, reclaims equally.Be specially:
(1)
1. plasmid extraction
Extracting plasmid pYA3149 and pMD18-EspA-IntiminC300-Stx2B.
2. endonuclease reaction
Carrier pYA3149 and pMD18-EspA-IntiminC300-Stx2B all use the EcoRI+HindIII double digestion.
3. the segmental recovery of purpose behind the enzyme action.
4. coupled reaction
UV spectrophotometer measuring genes of interest EspA-IntiminC300-Stx2B fragment, the about 100ng/ μ of nucleic acid content l, the about 1767bp of clip size; PYA3149 reclaims the about 100ng/ μ of fragment concentrations l, and size is about 3726bp.According to inserting fragment and carrier mole ratio is 5～10: 1 principle, and it is as follows to design the coupled reaction system: (setting up the matched group that does not add exogenous dna fragment simultaneously)
The sample contrast
EspA-IntiminC300-Stx2B fragment (50ng/ μ l) 9 μ l 0 μ l
PYA3149 fragment (100ng/ μ l) 8 μ l 1 μ l
T
4Dna ligase 1 μ l 1 μ l
ddH
2O 0 7μl
10 * connection buffer, 2 μ l, 11 μ l
Cumulative volume 20 μ l 20 μ l
22 ℃ of connections are spent the night.
5. connect product and transform the host bacterium
(1) E.coli x6097 electricity changes the preparation of competence bacteria.
(2) salmonella x3730, the x4550 electricity changes competent preparation.
(3) contain the preparation of the LB flat board of DAP.
(4) connecting product transforms:
To connect the product electricity and change host bacterium E.coli x6097 over to, again enzyme action be identified that the recon electricity of correct (Fig. 8) changes among the intermediate host bacterium x3730.Because of plasmid copy number in the reorganization salmonella is lower, utilize the PCR method to identify, PCR is identified that correct recon electricity changes among the final host bacterium x4550, method is the same, and identifies through the PCR method.
6. the evaluation of recombinant expression plasmid
(1) enzyme action is identified correct recon electricity changes among the intermediate host bacterium x3730.Because of plasmid copy number in the reorganization salmonella is lower, utilize the PCR method to identify, PCR is identified that correct recon electricity changes among the final host bacterium x4550, method is the same, and identifies (Fig. 9) through the PCR method.
(2) because of respectively containing an AfaI single endonuclease digestion site in the gene order of IntiminC300 and Stx2B, therefore three fragments fusion gene EspA-IntiminC300-Stx2B enzyme action can being grown into 1049bp, 660bp and 58bp.
(3) target gene sequences is measured: give birth to worker company by Shanghai and finish (gene order of fusion gene EspA-IntiminC300-Stx2B is shown in SEQ ID NO:9).
(2)
The inventor also repeats to have made up recombinant expression plasmid pYA3149-EspA-IntiminC300-Stx2B in addition, and the mensuration of target gene sequences is finished by Beijing China major company, and is specific as follows:
The structure of recombinant expression plasmid pYA3149-EspA-IntiminC300-Stx2B
Extracting pMD18-EspA-IntiminC300-Stx2B plasmid, behind the EcoRI+HindIII double digestion, reclaim genes of interest EspA-IntiminC300-Stx2B fragment, be connected construction recombination plasmid pYA3149-EspA-IntiminC300-Stx2B with the pYA3149 carrier segments that behind the EcoRI+HindIII double digestion, reclaims equally.
1 '. plasmid extraction
Extracting plasmid pYA3149 and pMD18-EspA-IntiminC300-Stx2B, operational approach is the same.
2 '. endonuclease reaction
Carrier pYA3149 and pMD18-EspA-IntiminC300-Stx2B all use the EcoRI+HindIII double digestion, and reaction system is as follows:
pYA3149 pMD?18-EspA-IntiminC300-Stx2B
Plasmid DNA 30 μ l 30 μ l
EcoRI 3μl 3μl
HindIII 3μl 3μl
10 * M buffer, 5 μ l, 5 μ l
ddH
2O 9μl 9μl
Cumulative volume 50 μ l 50 μ l
Mixing, 37 ℃ of enzyme action 4 hours.
3 '. the segmental recovery of purpose behind the enzyme action
Record 1.0% agarose and reclaim glue, 10 μ l, 10 * Loadingbuffer will respectively be added in the above-mentioned endonuclease reaction system, the 80V electrophoresis treats that indicator stops electrophoresis when migrating to apart from gel forward position 1.5cm, cutting contains the agarose gel of the big fragment (about 3726bp) of the fragment (about 1767bp) of EspA-IntiminC300-Stx2B and pYA3149 respectively, Omega glue reclaims test kit and reclaims required fragment, and concrete operations are the same.
4 '. coupled reaction
UV spectrophotometer measuring genes of interest EspA-IntiminC300-Stx2B fragment, the about 100ng/ μ of nucleic acid content l, the about 1767bp of clip size; PYA3149 reclaims the about 100ng/ μ of fragment concentrations l, and size is about 3726bp.According to inserting fragment and carrier mole ratio is 5～10: 1 principle, and it is as follows to design the coupled reaction system: (setting up the matched group that does not add exogenous dna fragment simultaneously)
The sample contrast
EspA-IntiminC300-Stx2B fragment (50ng/ μ l) 9 μ l 0 μ l
PYA3149 fragment (100ng/ μ l) 8 μ l 1 μ l
T
4Dna ligase 1 μ l 1 μ l
ddH
2O 0 7μl
10 * connection buffer, 2 μ l, 11 μ l
Cumulative volume 20 μ l 20 μ l
22 ℃ of connections are spent the night.
5 '. connect product and transform the host bacterium
(1) E.coli x6097 electricity changes the preparation of competence bacteria: the same.
(2) salmonella x3730, it is the same that the x4550 electricity changes competent preparation.
(3) contain the preparation of the LB flat board of DAP: the preparation of the SOC flat board that contains DAP of seing before.
(4) connecting product transforms: with (one).
The evaluation of 6 ' recombinant expression plasmid
(1) enzyme action is identified correct recon electricity changes among the intermediate host bacterium x3730.Because of plasmid copy number in the reorganization salmonella is lower, utilize the PCR method to identify, PCR is identified that correct recon electricity changes among the final host bacterium x4550, method is the same, and identifies correct through the PCR method.
(2) because of respectively containing an AfaI single endonuclease digestion site in the gene order of IntiminC300 and Stx2B, therefore three fragments fusion gene EspA-IntiminC300-Stx2B enzyme action can being grown into 1049bp, 660bp and 58bp.
(3) mensuration of target gene sequences: China major company finishes (gene order of fusion gene EspA-IntiminC300-Stx2B is shown in SEQ ID NO:9) by Beijing.
(3)
The inventor also detects the vaccine strain vitro stability that makes up, and is specific as follows:
To recombinate bacterium x4550 (pYA3149-EspA), x4550 (pYA3149-EspA-IntiminC300), x4550 (pYA3149-EspA-IntiminC300-Stx2B) respectively after selection pressure (not containing DAP) being arranged and not having 10 generations of going down to posterity under the selection pressure condition of (containing DAP) at random 100 colony inoculations of picking in the LB that does not contain DAP dull and stereotyped and contain cultivate on the LB flat board of DAP after, no matter the result has or not selection pressure institute 100 bacterium colonies 99% of picking all to grow, 20 of random choose bacterium colony extracting plasmids therefrom, 95% bacterium colony all contains recombiant plasmid.
The expression of embodiment 5O157:H7 antigen protein in recombination attenuated salmonella typhimurium; Salmonella typhimurium is in the detection of mice spleen, mesenteric lymph node, terminal ileum field planting; The immunogenicity of carrier bacterin bacterial strain detects
(1) expression of recombinant attenuated salmonella typhi vaccine strain x4550 (pYA3149-EspA-IntiminC300), x4550 (pYA3149-EspA-IntiminC300-Stx2B)
1. recombination engineering induces
Recombination engineering is inoculated in the 3ml LB culture fluid 37 ℃ of shaking table overnight incubation.Next day with the recombination engineering of incubated overnight in 1% ratio transferred species in 20ml LB culture fluid, 37 ℃ of shaking tables are cultivated (200r/ minute) when treating OD600 ≈ 0.8, adding IPTG is that 1mmol/L begins to induce to final concentration, in inducing sampling in 0,4,8,12,24 hour and measuring its OD600 value, do the empty carrier bacterium simultaneously and induce contrast.
2.SDS-PAGE detect the expression of EspA-IntiminC300, EspA-IntiminC300-Stx2B
By formula: the sampling of bacterium liquid measure (ml)=1/OD600 is centrifugal, and the resuspended precipitation of 100 μ l distilled waters adds 100 μ l, 2 * sample-loading buffer, mixing, boil 15 minutes standby.Preparation SDS-PAGE polyacrylamide gel, treat the complete polymerization of gel after, extract sample and comb, blot moisture in the hole with sample hole on the cathode buffer solution for cleaning and with filter paper.Sample to be tested and molecular weight of albumen standard go up sample simultaneously, stop electrophoresis when Coomassie brilliant blue arrives the gel bottom.Gel is fixed 30～60 minutes in fixative, Coomassie brilliant blue is heated to 60 ℃ of dyeing 20 minutes, and destaining solution decolours colourless to background.UVP scanning analysis electrophoresis result.
3.Western immunoblotting detects the immunoreactivity (Figure 11) of EspA-IntiminC300, EspA-IntiminC300-Stx2B:
(1) carries out the SDS-PAGE electrophoresis according to the method described above earlier.
(2) get 6 filter paper, 1 NC film, size is identical with the gel size, is soaked in the transfering buffering liquid stand-by.
(3) take out gel, after deionized water and the flushing of electrotransfer liquid, by sponge-filter paper-NC film-gel-filter paper-successively overlapping putting well of sponge order, the emptying bubble moves in the electrotransfer groove, and the NC film is positioned at side of the positive electrode, and gel is in negative side, 100 volts of transfer printings 1 hour.
(4) take out the NC film and dyeed 60 seconds in 0.2% Ponceau S, labelled protein molecule Marker is with ddH
2O rinsing NC film changes water number therebetween and is white in color until background.
(5) the NC film is placed confining liquid, the jolting sealing is 2 hours gently.
(6) the NC film after will sealing places mouse-anti EspA, the IntiminC300 serum of dilution in 1: 1000,37 ℃ of shaking tables reactions 60 minutes.
(7) TTBS liquid is washed film 4 times, each 10～15 minutes.
(8) HRP labelling sheep anti-mouse igg is done dilution in 1: 20000, and 37 ℃ were reacted 60 minutes.
(9) repeating step 7.
(10) add freshly prepared substrate reactions liquid, after jog extremely develops the color, ddH
2O rinsing color development stopping.
(2) mice spleen, mesenteric lymph node and the terminal ileum of Salmonella typhimurium after vaccine immunity is got in the detection of mice spleen, mesenteric lymph node, terminal ileum field planting carries out Salmonella field planting detection: carry out SS and select cultivation, invA gene test and immunofluorescence to detect (Figure 12 A-Figure 12 F).
(3) immunogenicity of recombinant attenuated salmonella typhi carrier bacterin detects
Detect immunity back mice serum EspA, IntiminC300 and the specific antibody titer of Stx2B respectively, the result shows that the GMT value of the anti-EspA of mice serum, IntiminC300, Stx2B is all than significant difference (Figure 12 A-Figure 12 F) has been arranged before the immunity.
The counteracting toxic substances protection experiment of the recombination attenuated salmonella typhimurium carrier vaccine of embodiment 6O157:H7
1. the counteracting toxic substances preparation of O157 bacterium liquid
To protect kind of an O157-SMR2 bacterium and be inoculated in the LB culture medium, (count results is about 4 * 10 to 37 ℃ of shaken cultivation 6h after doubling dilution pours into cultivation
9CFU/ml), abandon supernatant after centrifugal, with aseptic LB washing 2 times, with the resuspended thalline of aseptic LB liquid, adjustment concentration is 1.5 * 109CFU/ml at last again.
2. animal model is undertaken by the method for applicant's laboratory foundation
For solving mice the O157 bacterium is infected insensitive problem, the method of selecting with antibiotic makes the drug resistance of O157 acquisition to streptomycin earlier, the effect of streptomycin is other normal flora that suppresses intestinal, makes O157 become dominant microflora in intestinal, helps its infection.The Balb/c mice O157 bacterium infected animal model (Cheng Jianping that has set up according to applicant's laboratory, Zou Quanming, Mao Xuhu etc. enterorrhagia Bacillus coil 0157: the foundation of H7 infected animal model. Chinese Amphixenosis's magazine 2005,21 (4): 276-278), give the aseptic aqueous solution that mice contains the streptomycin of 5g/L before the counteracting toxic substances and drink 3d, again with the full bacterium liquid of the O157-SMR2 counteracting toxic substances of anti-streptomycin.
3. counteracting toxic substances protection experiment
Mice is drunk 3d in the back aseptic aqueous solution that contained the 5g/L streptomycin in 10 days of omnidistance immunity, again with 1 * 10
9The full bacterium liquid of the O157-SMR2 of CFU/ dosage at twice; 6 hours at interval; per os pours into mouse GI tract, attack close observation mice behind the bacterium activity, ingest and the change of the mental status, calculate death toll, infection rate and the protective rate of mice when 28 day observation period finished.Infection rate is that stool in mice O157 cultivates positive rate after attacking bacterium by detection, comprises that the feces cultivation positive rate of dead mice is judged.
1) judgement of O157 infection:
(1) from its feces, turns out the O157 bacterium dead mouse time.
(2) the not dead group of mice was turned out the O157 bacterium in 14 days from stool in mice.
2) calculating of infection rate and protective rate:
3) attack the culture identification of stool in mice O157 behind the bacterium
Get behind the mice counteracting toxic substances 3,7,14,28d feces number, physiological saline solution is resuspended, vortex mixer shakes broken, coat SMAC selective medium flat board (peptone 20g, cholate 5g, sodium chloride 10g, sorbitol 10g, 0.5% dimethyl diaminophenazine chloride 5ml, agar 18g, except that sorbitol, dimethyl diaminophenazine chloride, all the other heating are water-soluble, it is 7.2 that hydro-oxidation sodium is transferred pH, add sorbitol, dimethyl diaminophenazine chloride again, be settled to 1000ml, autoclaving).
4) adopt the relatively infection protective rate of each group of Breslow-Day statistical method.
Behind the recombinant attenuated as can be seen salmonella typhi carrier bacterin of the result immune mouse, with having the O157-SMR2 bacterium counteracting toxic substances of streptomycin resistance, be 89% through the mice counteracting toxic substances postoperative infection protective rate of booster immunization; Show that the protective antigen gene IntiminC300 of O157 and Stx2B in the field planting of anti-O157 bacterium with produce and brought into play better action aspect the toxin, have produced the good immune protection effect.
Though the present invention discloses as above with preferred embodiment; right its is not in order to limit the present invention; any person of ordinary skill in the field; without departing from the spirit and scope of the present invention; when can doing a little change and improvement, so protection scope of the present invention is as the criterion when looking the claim person of defining.
Sequence table
＜110〉Military Medical Univ No.3, P.L.A
＜120〉a kind of recombination attenuated salmonella typhimurium carrier vaccine and preparation method
<130>8P99013-CN
<160>9
<170>PatentIn?version?3.2
<210>1
<211>28
<212>DNA
＜213〉the forward primer sequence of the amplification fusion gene EspA-Intimin-C300 of synthetic
<400>1
cggaattcat?ggatacatca?aatgcaac 28
<210>2
<211>28
<212>DNA
＜213〉the downstream primer sequence of the amplification fusion gene EspA-Intimin-C300 of synthetic
<400>2
cgaagctttc?attctacaca?aaccgcat 28
<210>3
<211>29
<212>DNA
＜213〉the forward primer sequence of the amplification fusion gene EspA-IntiminC300-Stx2B of synthetic
<400>3
ggaattcgat?acatcaaatg?caacatccg 29
<210>4
<211>36
<212>DNA
＜213〉the downstream primer sequence of the amplification fusion gene EspA-IntiminC300-Stx2B of synthetic
<400>4
cgcaagcttt?cagtcattat?taaactgcac?ttcagc 36
<210>5
<211>579
<212>DNA
＜213〉gene order of EspA
<400>5
gaattcgata?catcaaatgc?aacatccgtt?gttaatgtga?gtgcgagttc?ttcgacatcg 60
acgatctatg?acttaggtaa?tatgtcgaag?gatgaggtgg?ttaagctatt?tgaggaactc 120
ggtgtttttc?aggctgcgat?tctcatgttt?tcttatatgt?atcaggcaca?aagtaatctg 180
tcgattgcaa?agtttgctga?tatgaatgag?gcatctaaag?cgtcaaccac?ggcacaaaag 240
atggctaatc?ttgtggatgc?caaaattgct?gatgttcaga?gtagcactga?taagaatgcg 300
aaagccaaac?ttcctcaaga?cgtgattgac?tatataaacg?atccacgtaa?tgacataagt 360
gtaactggta?ttcgtgatct?tagtggtgat?ttaagcgctg?gtgatctgca?aacagtgaag 420
gcggctattt?cagctaaagc?gaataacctg?acaacggtag?tgaataatag?ccagctcgaa 480
attcagcaaa?tgtcgaatac?attaaatctc?ttaacgagtg?cacgttctga?tgtgcaatct 540
ctacaatata?gaactatttc?agcaatatcc?cttggtaaa 579
<210>6
<211>879
<212>DNA
＜213〉gene order of IntiminC300
<400>6
acttcagcac?ttaatgccag?tgcggttata?ttttttgatc?aaaccaaggc?cagcattact 60
gagattaagg?ctgataagac?aactgcagta?gcaaatggta?aggatgctat?taaatatact 120
gtaaaagtta?tgaaaaacgg?tcagccagtt?aataatcaat?ccgttacatt?ctcaacaaac 180
tttgggatgt?tcaacggtaa?gtctcaaacg?caagcaacca?cgggaaatga?tggtcgtgcg 240
acgataacac?taacttccag?ttccgccggt?aaagcgactg?ttagtgcgac?agtcagtgat 300
ggggctgagg?ttaaagcgac?tgaggtcact?ttttttgatg?aactgaaaat?tgacaacaag 360
gttgatatta?ttggtaacaa?tgtcagaggc?gagttgccta?atatttggct?gcaatatggt 420
cagtttaaac?tgaaagcaag?cggtggtgat?ggtacatatt?catggtattc?agaaaatacc 480
agtatcgcga?ctgtcgatgc?atcagggaaa?gtcactttga?atggtaaagg?cagtgtcgta 540
attaaagcca?catctggtga?taagcaaaca?gtaagttaca?ctataaaagc?accgtcgtat 600
atgataaaag?tggataagca?agcctattat?gctgatgcta?tgtccatttg?caaaaattta 660
ttaccatcca?cacagacggt?attgtcagat?atttatgact?catggggggc?tgcaaataaa 720
tatagccatt?atagttctat?gaactcaata?actgcttgga?ttaaacagac?atctagtgag 780
cagcgttctg?gagtatcaag?cacttataac?ctaataacac?aaaaccctct?tcctggggtt 840
aatgttaata?ctccaaatgt?ctatgcggtt?tgtgtagaa 879
<210>7
<211>292
<212>DNA
＜213〉gene order of Stx2B
<400>7
aggaagtggt?ggcagtggca?agaagatgtt?tatggcggtt?ttatttgcat?tagcttctgt 60
taatgcaatg?gcggcggatt?gtgctaaagg?taaaattgag?ttttccaagt?ataatgagga 120
tgacacattt?acagtgaagg?ttgacgggaa?agaatactgg?accagtcgct?ggaatctgca 180
accgttactg?caaagtgctc?agttgacagg?aatgactgtc?acaatcaaat?ccagtacctg 240
tgaatcaggc?tccggatttg?ctgaagtgca?gtttaataat?gactgaaagc?tt 292
<210>8
<211>1312
<212>DNA
＜213〉gene order of fusion gene EspA-IntiminC300
<400>8
acaaagtaat?ctgtcgattg?caaagtttgc?tgatatgaat?gaggcatcta?aagcgtcaac 60
cacggcacaa?aagatggcta?atcttgtgga?tgccaaaatt?gctgatgttc?agagtagcac 120
tgataagaat?gcgaaagcca?aacttcctca?agacgtgatt?gactatataa?acgatccacg 180
taatgacata?agtgtaactg?gtattcgtga?tcttagtggt?gatttaagcg?ctggtgatct 240
gcaaacagtg?aaggcggcta?tttcagctaa?agcgaataac?ctgacaacgg?tagtgaataa 300
tagccagctc?gaaattcagc?aaatgtcgaa?tacattaaat?ctcttaacga?gtgcacgttc 360
tgatgtgcaa?tctctacaat?atagaactat?ttcagcaata?tcccttggta?aatacgcgcc 420
gcaggatcct?acttcagcac?ttaatgccag?tgcggttata?ttttttgatc?aaaccaaggc 480
cagcattact?gagattaagg?ctgataagac?aactgcagta?gcaaatggta?aggatgctat 540
taaatatact?gtaaaagtta?tgaaaaacgg?tcagccagtt?aataatcaat?ccgttacatt 600
ctcaacaaac?tttgggatgt?tcaacggtaa?gtctcaaacg?caagcaacca?cgggaaatga 660
tggtcgtgcg?acgataacac?taacttccag?ttccgccggt?aaagcgactg?ttagtgcgac 720
agtcagtgat?ggggctgagg?ttaaagcgac?tgaggtcact?ttttttgatg?aactgaaaat 780
tgacaacaag?gttgatatta?ttggtaacaa?tgtcagaggc?gagttgccta?atatttggct 840
gcaatatggt?cagtttaaac?tgaaagcaag?cggtggtgat?ggtacatatt?catggtattc 900
agaaaatacc?agtatcgcga?ctgtcgatgc?atcagggaaa?gtcactttga?atggtaaagg 960
cagtgtcgta?attaaagcca?catctggtga?taagcaaaca?gtaagttaca?ctataaaagc?1020
accgtcgtat?atgataaaag?tggataagca?agcctattat?gctgatgcta?tgtccatttg?1080
caaaaattta?ttaccatcca?cacagacggt?attgtcagat?atttatgact?catggggggc?1140
tgcaaataaa?tatagccatt?atagttctat?gaactcaata?actgcttgga?ttaaacagac?1200
atctagtgag?cagcgttctg?gagtatcaag?cacttataac?ctaataacac?aaaaccctct?1260
tcctggggtt?aatgttaata?ctccaaatgt?ctatgcggtt?tgtgtagaat?ga 1312
<210>9
<211>1767
<212>DNA
＜213〉gene order of fusion gene EspA-IntiminC300-Stx2B
<400>9
gaattcgata?catcaaatgc?aacatccgtt?gttaatgtga?gtgcgagttc?ttcgacatcg 60
acgatctatg?acttaggtaa?tatgtcgaag?gatgaggtgg?ttaagctatt?tgaggaactc 120
ggtgtttttc?aggctgcgat?tctcatgttt?tcttatatgt?atcaggcaca?aagtaatctg 180
tcgattgcaa?agtttgctga?tatgaatgag?gcatctaaag?cgtcaaccac?ggcacaaaag 240
atggctaatc?ttgtggatgc?caaaattgct?gatgttcaga?gtagcactga?taagaatgcg 300
aaagccaaac?ttcctcaaga?cgtgattgac?tatataaacg?atccacgtaa?tgacataagt 360
gtaactggta?ttcgtgatct?tagtggtgat?ttaagcgctg?gtgatctgca?aacagtgaag 420
gcggctattt?cagctaaagc?gaataacctg?acaacggtag?tgaataatag?ccagctcgaa 480
attcagcaaa?tgtcgaatac?attaaatctc?ttaacgagtg?cacgttctga?tgtgcaatct 540
ctacaatata?gaactatttc?agcaatatcc?cttggtaaat?acgcgccgca?ggatcctact 600
tcagcactta?atgccagtgc?ggttatattt?tttgatcaaa?ccaaggccag?cattactgag 660
attaaggctg?ataagacaac?tgcagtagca?aatggtaagg?atgctattaa?atatactgta 720
aaagttatga?aaaacggtca?gccagttaat?aatcaatccg?ttacattctc?aacaaacttt 780
gggatgttca?acggtaagtc?tcaaacgcaa?gcaaccacgg?gaaatgatgg?tcgtgcgacg 840
ataacactaa?cttccagttc?cgccggtaaa?gcgactgtta?gtgcgacagt?cagtgatggg 900
gctgaggtta?aagcgactga?ggtcactttt?tttgatgaac?tgaaaattga?caacaaggtt 960
gatattattg?gtaacaatgt?cagaggcgag?ttgcctaata?tttggctgca?atatggtcag 1020
tttaaactga?aagcaagcgg?tggtgatggt?acatattcat?ggtattcaga?aaataccagt 1080
atcgcgactg?tcgatgcatc?agggaaagtc?actttgaatg?gtaaaggcag?tgtcgtaatt 1140
aaagccacat?ctggtgataa?gcaaacagta?agttacacta?taaaagcacc?gtcgtatatg 1200
ataaaagtgg?ataagcaagc?ctattatgct?gatgctatgt?ccatttgcaa?aaatttatta 1260
ccatccacac?agacggtatt?gtcagatatt?tatgactcat?ggggggctgc?aaataaatat 1320
agccattata?gttctatgaa?ctcaataact?gcttggatta?aacagacatc?tagtgagcag 1380
cgttctggag?tatcaagcac?ttataaccta?ataacacaaa?accctcttcc?tggggttaat 1440
gttaatactc?caaatgtcta?tgcggtttgt?gtagaaggaa?gtggtggcag?tggcaagaag 1500
atgtttatgg?cggttttatt?tgcattagct?tctgttaatg?caatggcggc?ggattgtgct 1560
aaaggtaaaa?ttgagttttc?caagtataat?gaggatgaca?catttacagt?gaaggttgac 1620
gggaaagaat?actggaccag?tcgctggaat?ctgcaaccgt?tactgcaaag?tgctcagttg 1680
acaggaatga?ctgtcacaat?caaatccagt?acctgtgaat?caggctccgg?atttgctgaa 1740
gtgcagttta?ataatgactg?aaagctt 1767
Claims (10)
1. a recombination attenuated salmonella typhimurium carrier vaccine is characterized in that comprising the antigen subunit for deriving from fusion rotein EspA-IntiminC300 or the EspA-IntiminC300-Stx2B of enterorrhagia Bacillus coil 0157: H7.
2. the preparation method of the recombination attenuated salmonella typhimurium carrier vaccine of a claim 1 is characterized in that may further comprise the steps:
1) obtains fusion gene EspA-IntiminC300, EspA-IntiminC300-Stx2B by PCR method;
2) fusion gene is connected with expression vector respectively, obtains recombinant expression plasmid;
3) recombinant expression plasmid transforms first intermediate host's bacterial strain, obtains recon;
4) recon transforms seocnd intermediate host's bacterial strain, identifies positive recombinant;
5) identify in the step 4) that correct positive recombinant transforms the final host bacterial strain;
6) abduction delivering obtains recombination attenuated salmonella typhimurium carrier vaccine;
7) authentication step 6) in the expression of EspA, IntiminC300, Stx2B in the recombination attenuated salmonella typhimurium carrier vaccine that obtains;
8) immunogenicity of EspA, IntiminC300, Stx2B in the recombination attenuated salmonella typhimurium carrier vaccine that obtains in the detection step 6);
9) recombination attenuated salmonella typhimurium carrier vaccine counteracting toxic substances protection experiment;
10) having, carrying out subculture in vitro separately under the situation of no selection pressure and cultivate, identify recombination attenuated salmonella typhimurium carrier vaccine stability.
3. preparation method according to claim 2, the PCR primer that uses when it is characterized in that in the step 1) obtaining EspA-IntiminC300 by PCR method is shown in SEQ ID NO:1-2.
4. preparation method according to claim 2, the PCR primer that uses when it is characterized in that in the step 1) obtaining EspA-IntiminC300-Stx2B by PCR method is shown in SEQ ID NO:3-4.
5. preparation method according to claim 2 is characterized in that step 2) described in expression vector be pYA3149.
6. preparation method according to claim 2 is characterized in that the first intermediate host's bacterial strain described in the step 3) is escherichia coli X6097.
7. preparation method according to claim 2 is characterized in that the seocnd intermediate host's bacterial strain described in the step 4) is attenuated salmonella typhimurium X3730.
8. preparation method according to claim 2 is characterized in that the final host bacterial strain described in the step 5) is attenuated salmonella typhimurium X4550.
9. preparation method according to claim 8 is characterized in that described attenuated salmonella typhimurium X4550 is an asd gene defection type bacterial strain.
10. preparation method according to claim 2 is characterized in that passing through in the step 8) immunogenicity that the Western immunoblotting detects EspA, IntiminC300, Stx2B.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810069320A CN101234197B (en) | 2008-01-29 | 2008-01-29 | Recombination attenuation salmonella typhimurium vector vaccine and preparation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810069320A CN101234197B (en) | 2008-01-29 | 2008-01-29 | Recombination attenuation salmonella typhimurium vector vaccine and preparation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101234197A CN101234197A (en) | 2008-08-06 |
| CN101234197B true CN101234197B (en) | 2010-05-12 |
Family
ID=39918265
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200810069320A Expired - Fee Related CN101234197B (en) | 2008-01-29 | 2008-01-29 | Recombination attenuation salmonella typhimurium vector vaccine and preparation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101234197B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8524887B2 (en) | 2009-04-15 | 2013-09-03 | Eastman Chemical Company | Regioselectively substituted cellulose esters produced in a tetraalkylammonium alkylphosphate ionic liquid process and products produced therefrom |
| US8729253B2 (en) | 2011-04-13 | 2014-05-20 | Eastman Chemical Company | Cellulose ester optical films |
| US9156918B2 (en) | 2008-02-13 | 2015-10-13 | Eastman Chemical Company | Treatment of cellulose esters |
| US9175096B2 (en) | 2008-02-13 | 2015-11-03 | Eastman Chemical Company | Regioselectively substituted cellulose esters produced in a halogenated ionic liquid process and products produced therefrom |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8148518B2 (en) | 2007-02-14 | 2012-04-03 | Eastman Chemical Company | Cellulose esters and their production in carboxylated ionic liquids |
| US10174129B2 (en) | 2007-02-14 | 2019-01-08 | Eastman Chemical Company | Regioselectively substituted cellulose esters produced in a carboxylated ionic liquid process and products produced therefrom |
| US9834516B2 (en) | 2007-02-14 | 2017-12-05 | Eastman Chemical Company | Regioselectively substituted cellulose esters produced in a carboxylated ionic liquid process and products produced therefrom |
| US9777074B2 (en) | 2008-02-13 | 2017-10-03 | Eastman Chemical Company | Regioselectively substituted cellulose esters produced in a halogenated ionic liquid process and products produced therefrom |
| US8158777B2 (en) | 2008-02-13 | 2012-04-17 | Eastman Chemical Company | Cellulose esters and their production in halogenated ionic liquids |
| CN105754919B (en) * | 2016-03-22 | 2019-08-30 | 南方医科大学 | A kind of EHEC O157:H7 recombination lactobacillus acidophilus carrier bacterin and its preparation method and application |
| CN106591365A (en) * | 2016-12-07 | 2017-04-26 | 南昌大学 | Attenuated salmonella typhimurium mediated eukaryocyte plasmid transfection method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101062410A (en) * | 2007-02-05 | 2007-10-31 | 中国人民解放军第三军医大学 | Genetic engineering vaccine of enterohemorrhagic escherichia coli 0157:H7 and the preparing method thereof |
-
2008
- 2008-01-29 CN CN200810069320A patent/CN101234197B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101062410A (en) * | 2007-02-05 | 2007-10-31 | 中国人民解放军第三军医大学 | Genetic engineering vaccine of enterohemorrhagic escherichia coli 0157:H7 and the preparing method thereof |
Non-Patent Citations (6)
| Title |
|---|
| 刘艳青等.肠出血性大肠杆菌O157∶H7 EspA与IntiminC300融合蛋白的构建表达.中国人兽共患病学报第23卷 第2期.2007,第23卷(第2期),第106-109页. |
| 刘艳青等.肠出血性大肠杆菌O157∶H7 EspA与IntiminC300融合蛋白的构建表达.中国人兽共患病学报第23卷 第2期.2007,第23卷(第2期),第106-109页. * |
| 宁元元等.表达肠出血性大肠杆菌O157:H7 EspA抗原的减毒沙门氏菌株的构建.免疫学杂志第23卷 第2期.2007,第23卷(第2期),第187-190页. |
| 宁元元等.表达肠出血性大肠杆菌O157:H7 EspA抗原的减毒沙门氏菌株的构建.免疫学杂志第23卷 第2期.2007,第23卷(第2期),第187-190页. * |
| 易勇等.Stx2B与IntiminC300融合蛋白的构建、表达及免疫保护研究.中华微生物学和免疫学杂志第25卷 第3期.2005,第25卷(第3期),第227-233页. |
| 易勇等.Stx2B与IntiminC300融合蛋白的构建、表达及免疫保护研究.中华微生物学和免疫学杂志第25卷 第3期.2005,第25卷(第3期),第227-233页. * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9156918B2 (en) | 2008-02-13 | 2015-10-13 | Eastman Chemical Company | Treatment of cellulose esters |
| US9175096B2 (en) | 2008-02-13 | 2015-11-03 | Eastman Chemical Company | Regioselectively substituted cellulose esters produced in a halogenated ionic liquid process and products produced therefrom |
| US8524887B2 (en) | 2009-04-15 | 2013-09-03 | Eastman Chemical Company | Regioselectively substituted cellulose esters produced in a tetraalkylammonium alkylphosphate ionic liquid process and products produced therefrom |
| US8871924B2 (en) | 2009-04-15 | 2014-10-28 | Eastman Chemical Company | Regioselectively substituted cellulose esters produced in a tetraalkylammonium alkylphosphate ionic liquid process and products produced therefrom |
| US8729253B2 (en) | 2011-04-13 | 2014-05-20 | Eastman Chemical Company | Cellulose ester optical films |
| US9096691B2 (en) | 2011-04-13 | 2015-08-04 | Eastman Chemical Company | Cellulose ester optical films |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101234197A (en) | 2008-08-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101234197B (en) | Recombination attenuation salmonella typhimurium vector vaccine and preparation | |
| Morgan et al. | Immunization of suckling pigs against enterotoxigenic Escherichia coli-induced diarrheal disease by vaccinating dams with purified 987 or K99 pili: protection correlates with pilus homology of vaccine and challenge | |
| Gaastra et al. | Host-specific fimbrial adhesins of noninvasive enterotoxigenic Escherichia coli strains | |
| Law | Adhesion and its role in the virulence of enteropathogenic Escherichia coli | |
| ES2199944T3 (en) | PROCEDURE FOR THE ELABORATION OF A GENETICALLY STABLE MUTANT CEPA OF VIBRIO CHOLERAE. | |
| CN101522210B (en) | Compositions and methods of enhancing immune responses | |
| ES2322213T3 (en) | NAP PROTEIN OF HELICOBACTER PYLORI. | |
| AU683454B2 (en) | Heterologous antigens in live cell vaccine strains | |
| CN100478028C (en) | Genetic engineering vaccine of enterohemorrhagic escherichia coli O157:H7 and the preparing method thereof | |
| Barry et al. | Expression and immunogenicity of pertussis toxin S1 subunit-tetanus toxin fragment C fusions in Salmonella typhi vaccine strain CVD 908 | |
| CN101905018B (en) | Recombinant fusion protein vaccine and attenuated live vector vaccine for treating and preventing helicobacter pylori (Hp) infection | |
| AU763898B2 (en) | Attenuated microorganisms for the treatment of infection | |
| ES2244182T3 (en) | BACTERIA ATTENTIONED BY A MUTATION NOT REVERSIBLE IN EACH OF THE AROC, AMPF AND OMPC GENES, USEFUL AS VACCINES. | |
| CN102838680B (en) | Helicobacter pylori multiple-epitope fusion protein and multiple-epitope vaccine prepared by helicobacter pylori multiple-epitope fusion protein | |
| US7157245B2 (en) | Neisserial vaccine compositions and methods | |
| CN1748791B (en) | Haemorrhagic E, coli 0157:H7 vaccine for human and livestock prevention and preparing method | |
| JPH08503136A (en) | P. Infection protective agent against pasteurellosis caused by MULTOCIDA | |
| CN103450353B (en) | Application of protein AIG_01780 in Rickettsia rickettsii resistant immune protection | |
| EP1531861A2 (en) | Mycoplasma gallisepticum formulation | |
| CN102741414B (en) | By recombination yeast oral/method of mucosal vaccination vaccine | |
| RU2130970C1 (en) | Culture vibrio cholerae, method of deletion mutants producing | |
| CN103483430B (en) | Application of protein A1G_07050 to Rickettsia rickettsii-resisting immunoprotection | |
| Calva et al. | Research opportunities in typhoid fever: epidemiology and molecular biology | |
| CN110003345A (en) | A kind of the TAT-EseD recombinant protein and purposes of anti-Edwardsiella tarda | |
| CA2684742C (en) | V. cholerae hyperexpressing recombinant cholera toxin b subunit showing dual immunogenicity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100512 Termination date: 20140129 |