CN103041404A

CN103041404A - Preparation method of fish iridovirus DNA (Deoxyribonucleic Acid) vaccine

Info

Publication number: CN103041404A
Application number: CN2012101537081A
Authority: CN
Inventors: 李琦; 滕以刚
Original assignee: SHANGHAI QIHAIFUTAI BIOLOGICAL TECHNOLOGY Co Ltd
Current assignee: SHANGHAI QIHAIFUTAI BIOLOGICAL TECHNOLOGY Co Ltd
Priority date: 2012-05-17
Filing date: 2012-05-17
Publication date: 2013-04-17

Abstract

The invention provides a fish iridovirus DNA (Deoxyribonucleic Acid) vaccine which comprises an eukaryotic transcription promoter, a gene of an iridovirus major capsid protein (MCP), an ankyrinrepeats gene, an eukaryotic transcription terminator, a replication initiation site and a resistance screening marker (shown in figure 1), wherein the replication initiation site and the resistance screening marker are used for amplifying plasmids. The DNA vaccine is recommended to be injected by an intramuscular injection method and can also be taken by oral and soaking modes to enable fish to be immune.

Description

A kind of fish iridovirus dna vaccination preparation method

Technical field

The invention belongs to biomedicine field, particularly dna vaccination preparation method in a kind of aquaculture, the dna vaccination preparation method of preventing and treating specifically irido virus.

Background technology

The present invention relates to coding and express the immunogenic vector construction of fish irido virus, irido virus is a kind of Causative virus of causing massive losses in the fish production, and fatality rate is up to more than 60%.This patent relates to the method for this vaccine of production and preparation, has also related to the inoculation method of irido virus dna vaccination.

Irido virus main infection invertebrates waits vertebrates with hanging down, large-scale 20 body shape DNA viruses, be divided into iridescent virus (Iridovirus), Chloriridovirus belongs to (Chloriridovirus), Lymphocystivirus (Lymphocystivirus), Ranavirus (Ranavirus) and Megalocytivirus belong to (Megalocytivirus).The irido virus that brings about great losses in aquatic products industry has Red snapper irido virus (red sea bream iridovirus), Taiwan grouper irido virus (Taiwan Grouper iridovirus), infectious spleen and kidney necrosis virus (Infectious spleen and kidney necrosis virus), Carnis Pseudosciaenae irido virus (Large yellow croaker iridovirus) and turbot reddish body iridovirus (Turbot reddish body iridovirus).

The virus type disease does not have effective medicine to control, and the vaccination prevention is a kind of cost-effective means for the virus type disease.The irido virus vaccine of using in the world at present only has Japanese madai irido virus vaccine (Kazuhiro Nakajima etc, Effectiveness of a vaccine against red sea bream iridovirus disease in a field trial test, Dis Aquat Org, Vol. 36:73-75,1999), its vaccine adopts the ablation method preparation.Irido virus vaccine in the domestic research and development is also all taked the ablation method preparation, and the cultivation of virus makes the production cost of vaccine very expensive, and this has limited the popularization of vaccine.

Main capsid protein is the important immunogen of irido virus, ankyrin repeat containing protein also has bibliographical information, and it has immunogenicity (Yun Im Kim etc, Production of polyclonal antibody against recombinant ORF 112L of rock bream iridovirus and in vitro neutralization).

The present invention is a kind of dna vaccination; pass through immunity inoculation; make fish oneself expression irido virus major capsid protein and this two-strain albumen of ankyrin repeats containing protein; pass through angtigen presentation; make the immunocyte generation of fish for the antibody of these two kinds of protein, thereby reach the effect of immunoprotection.

Summary of the invention

The objective of the invention is to make up a dna vaccination, by inoculation, Fish self can be expressed the immunogenic protein of having of irido virus, and then produce the antibody to irido virus, and the protection Fish avoid the infringement of irido virus.

Dna vaccination provided by the invention comprises following content:

A) plasmid construction:

The amicillin resistance screening is compared and the protokaryon replication origin is taken from plasmid pBR322, NdeI and EcoRI enzyme action, and Agrose glue reclaims the fragment of 2Kb; MCP gene and ankyrin repeats containing protein gene are that full gene is synthetic, and its front adds eukaryotic promoter, and the back adds terminator.Gene splicing becomes a bar segment, is connected with the amp fragment with the ori of plasmid pBR322 by homologous recombination, transforms escherichia coli DH5a (Fig. 1).Select positive colony, the dna sequencing checking;

B) after the above plasmid that makes up and normal saline, adjuvant mix, obtain dna vaccination.

Description of drawings

Below in conjunction with description of drawings feature of the present invention and beneficial effect.

Fig. 1 is the expression vector schematic diagram.

This dna vaccination is compared with the vaccine that the other technologies route makes up has following advantage:

A, production cost are low, are fit to produce in enormous quantities; Dna molecular is stable, is fit to storage and transportation;

B, safety, what dna vaccination was expressed is one section viral gene, viral inversion can not occur;

C, this dna vaccination are expressed MCP and ankyrin repeats protein simultaneously, and it is two valency vaccines, and simultaneously dna molecular itself just can be used as adjuvant, can with normal saline mixing direct injection.

The specific embodiment

The preparation of embodiment 1:DNA vaccine

Vector construction:

The synthetic fragment Pcmv-MCP-SV40 pA-Pcmv-ankyrin repeats-SV40 pA of full gene, MCP and ankyrin repeats nucleotide sequence see appendix.This fragment is with the 2k fragment homologous recombination (GBI) on the plasmid pBR322, and reaction system is: 15ul GBclonart reactant liquor; 1ul pBR322 fragment; The full gene of 2ul synthesizes fragment; 2ul ddH2O.50 ℃ hatch 30min after, get 5ul and transform escherichia coli DH5a.The screening of ampicillin LB solid plate.Sequence verification is correctly cloned, 500ml LB culture medium amplification culture, and a large amount of extracting plasmids are for subsequent use.The prescription of liquid LB culture medium is: 0.5% yeast extract; 1% peptone; 1% sodium chloride, bar pH value to 7.0,121 ℃, sterilization in 15 minutes.Solid LB culture medium is to add 1.5% agar powder on the basis of liquid LB culture medium;

The dna vaccination prescription:

The normal saline prescription is that 0.65% sodium chloride is dissolved in distilled water, and the concentration of sodium chloride can make between 0.5% to 0.9%.Also can be Ren Shi normal saline or Le Shi normal saline.Recommend the dna vaccination prescription to be: 1ugDNA is dissolved in the 1ul normal saline.

Embodiment 2: the drug administration by injection immunoprotection experiment take turbot as object

The test turbot is divided into 14 groups, every group of 3 tanks, 10 tails/groove at random.The dna vaccination of preparation is adopted the muscle injection mode immunity, and injection volume is 1ug/ tail and 10ug/ tail, contrasts to be normal saline.After 4 weeks of immunity, with irido virus counteracting toxic substances (105CFU/ tail).Observe death toll after 15 days, calculate every group immune protective rate (seeing Table 1).

Table 1

As can be seen from above, this dna vaccination has good prevention effect to irido virus, and immune protective rate is 82%.

1. MCP nucleotide sequence:

atgtctgcaatctcaggtgcgaacgtaaccagtgggttcatcgacatctccgctttcgatgcgatggagacccacttgtacggcggcgacaatgccgtgacatactttgcccgcgagaccgtgcgtagttcctggtacagcaaactacccgtcaccctgtcaaaacagactggccatgccaatttcggccaggagtttagtgtgacggtggccaggggtggcgactacctcattaatgtgtggctgcgtgttaagatcccctccatcacatccagcaaggaaaacagctacattcgctggtgtgacaatctgatgcacaatctggttgaggaggtgtcggtgtcatttaacgacctggtggcacagaccctgaccagcgagttcctcgacttttggaacgcctgcatgatgcccggcagcaaacagtctggctataacaagatgattggcatgcgcagcgacctggtctccggtatcaccaacggtcacactatgcctgctacctacctcaatttgcccatccccctcttcttcacccgcgacacaggccttgcattgcccaccgtgtctctgccgtacaacgaggtgcgcatccacttcaagctgcggcgctgggaggacctgctcatcagccagagcacccaggccgacatggccatctcgaccgtcaccctggccaacattagcaatgtagcacccgcgttgaccaacgtttccgtgatgggcacctacgctgtgctgacaagtgaggagcgcgaggtggtggcccagtctagccgtagcatgctcattgaacagtgccaggtggcgcctcgtgtgcccgtcacacccgcagacaattccttggtgcatctggacctcaggttcagtcatcccgtcaaggccttgttctttgcagtaaagaacgtcacccaccgcaacgtgcaaagcaattacaccgcggccagtcccgtgtatgtcaacaacaaggtcaatctgcctttgctggccaccaatcccctgtccgaggtgtcactcatttacgagaacacccctcggctccaccagatgggagtggactacttcacatccgtcgacccctactactttgcgcccagcatgcctgagatggacggtgttatgacctactgctataccctggacatgggcaatatcaaccccatgggctcgaccaactacggccgcctgtccaacgtcaccctgtcatgtaaggtgtcggacaacgccaagaaaacagcagcgggcggcggaaccaacggcagcggctacacggtcgcccaaaagtttgaactggtcgttattgcagtcaaccacaacatcatgaagattgctgacggcgctgcaggcttccctatcctgtaa

?

2. ankyrin repeats sequence:

atgtatgttctcaagtaccatgaagctgggatgtgtgttatgctccttggccagctgcgccacaaagtcgtcataggtctgcatggcgtgcagttgcgcctcatgccgtgctccattccacaccgtgtgaatggccaacatgtttttttggtaataaaaatggattcccttgtcgacctcatccgggctggcggtgtgcctgatgtggctcaatatgccgatcaggtggatgaatacaatgcggagggcttcacgccgctgatggtggccgtggaagccggcaacgcgggcgccgtacgcgcgctgctcaccatgggtgcggaccccaacgatggccatgcgcatggccaccgcgtgcctcttattgcggcagtaggcgggccatgggatgtgtttgtggctctgttgcagagtccgcggctacgagtcaatgcgcgcaacagtagccacgagaccgctctgcactacgccgcagacgcgggtgacgctcaggccacagaggcgctgttgcgtgccggtgccgacgtgaacgcaatagacatacttggcaacagtccactgtttggggccatcgcaaacgtacaggtggcgtccgtactaatgcacgccggcgccgacgtcaacatcgtcaacaacgcagatcacacgttcgtacagaatgtctttgaacacgtggccacggcgcatgacaaagacgccgtggcagtgccaatggccctagaggcggtgagacacgggctacgcatgacagccacggagctacagcgcatccttgatgtcgagcaccttggcacacctttcgcagtgactatcgtgtcagcgcttgacaacgttgacatgggcatgtgtcatgaaacaggacacgacgctgtacagtacacggtggccataggcctgaccaccgtgacagactttctggtggccttgctggactacgatgtcgacagcctggttcaaatggccgtctcgggccccaacccggctgtcatgatcatgttgattgagaaatacgagatggatgtgcaccagaggcccggcgcgcagcttctgctcaacgccttggtcaacaacaacgtggcttcggcgcgctaccttgcactggaggcaggcgttaccgtggacccctgtgatgtgtccgccctgatcaccgccttaatggtctcacagaactttcagcttgtcaaggacatgtctcgccactacaatttagacatggtgacgccgatagacggccgctcgccgctggacttgctggtatccaccgtggcccaagtcgacgaggactttatagtggactttatcacatatttcacgccgcgacagggggtatcactgttgacgggccaggtcccaccgtacatgtacgtgggccgcgtggggctggcttacactcacatgatgaccctgaggaacatggccatcggggcgctgccgtggcacagccgggattccgcgcagacacacattgactttggggtatataaaacactatga

Claims

1. irido virus dna vaccination preparation method is characterized in that this dna vector:

A) contain the gene of encoding and expressing irido virus capsid protein (MCP);

B) contain coding ankyrin repeats gene;

C) can be the mixture that contains simultaneously capsid protein and two genes of ankyrin repeats.

2. such as right 1 described dna vector, the promoter of the immunogenic gene on the carrier and enhancer can be the strong promoter commonly used such as Pcmv etc., also can be to make eukaryotic cell especially composing type or the tissue-specific promoter in Fish source, such as ATP enzyme promoter, actin promoter etc.

3. the application in the control of preparation cultured fishes irido virus such as right 1 and 2 described dna vaccinations.

4. such as right 3 described application, it is characterized in that, wherein said preparation is: such as right 1 and 2 described dna vectors, normal saline and immunological adjuvant.

5. such as right 3 described application, it is characterized in that, wherein prepared dna vaccination is by the injection system administration, and administration concentration is the 1-10ug/ tail.

6. such as right 3 described application, it is characterized in that, wherein prepared dna vaccination is by soaking administration, and administration concentration is the 1-10ug/ tail.