CN103031359A

CN103031359A - Application of S100 group protein

Info

Publication number: CN103031359A
Application number: CN2012105797285A
Authority: CN
Inventors: 俞雁; 韩伟; 何虹霖
Original assignee: Shanghai Jiaotong University
Current assignee: Shanghai Jiaotong University
Priority date: 2012-12-27
Filing date: 2012-12-27
Publication date: 2013-04-10

Abstract

The invention discloses an application of S100 group protein in the technical field of biological medicines. The application is characterized in that the S100 group protein serves as a drug target molecule to be used for screening hepatic fibrosis treatment drugs, and an active lead compound is obtained particularly according to a high-throughput drug screening method and a step, through evaluating biological activity of a to-be-screened compound antagonizing the S100 group protein, and via the steps of primary screening, rescreening, thorough screening, screening determination, and the like. The application supplies more action target spots for treating hepatic fibrosis, so as to screen the hepatic fibrosis treatment drugs.

Description

The application of S100 family protein

Technical field

What the present invention relates to is the method in a kind of biological medicine technology field, specifically a kind of application of S100 family protein.

Background technology

Hepatic fibrosis (hepatic fibrosis) be liver after sustaining damage, extracellular matrix is in the pathologic process of injury region over-deposit.Most of chronic hepatic diseases all can cause hepatic fibrosis, its cause of disease is broadly divided into infectivity (viral hepatitis, parasitic infection etc.), chemical toxicant (such as alcohol, paracetamol, methotrexate, excessive vitamin A etc.), autoimmune response (autoimmune hepatitis, primary biliary cirrhosis etc.), inborn errors of metabolism (Wilson's disease, hemochromatosis and various thesaurismosiss etc.), obesity and chronic inflammation disease (such as sarcoidosis) etc.The long-term accumulation of hepatic fibrosis, can finally cause the generation of liver cirrhosis (hepatic cirrhosis), liver lobule structure and blood circulation approach are reconstructed gradually in the liver, liver slowly is out of shape, hardening, stage portal hypertension in various degree occurs and liver function is disorderly, metabolic function is impaired, until cause upper gastrointestinal hemorrhage, liver ascites, even the generation of the complication such as liver cancer, thereby death caused.

Liver cirrhosis occupies the 4-6 position in human major causes of death, be the most deadly disease except several cancers, and the mortality ratio of patient in 5 years is 50%.The number that liver cirrhosis is died from the whole world every year has surpassed 500,000, and the trend that increases is gradually arranged.In western countries, liver cirrhosis patient mostly is due to alcoholic liver disease or the chronic hepatitis C.In China, because chronic hepatitis B patients has reached 2,000 ten thousand people, cause the sickness rate of China's hepatic fibrosis higher, and wherein nearly 25%～30% chronic viral hepatitis B patient can develop into liver cirrhosis.Increasing patient is badly in need of the treatment of medicine and liver transplantation, for the treatment of hepatic fibrosis and liver cirrhosis, is the problem that China and even the whole world all need to solve in a hurry therefore.But also do not have clinically at present too many effectively medicine.

The formation of hepatic fibrosis generally reaches more than ten years, is the process of a very complex, and it has comprised the necrosis of hepatic parenchymal cells, the activation of hepatic stellate cell, the processes such as the deposition of extracellular matrix.Hepatic fibrosis is the physiological process of a complexity, is subjected to the impact of many factors, along with going deep into of research, finds that increasing signal path and cytokine participate in the activation of hepatic stellate cell and regulate hepatic fibrosis on.Therefore, hepatic fibrosis is the regulated and control network of a complexity.

S100 is maximum EF hand-type structure calcium ion-binding protein family, has found that there are 20 members of surpassing in this family.The S100 protein family all is acid small molecular weight protein, and molecular weight and exists only in the vertebrates between 10 to 12kDa.Compare by the sequence to these genes, find that they have the homology of height between species.The albumen of this family structurally is comprised of two different EF hand-type structures, and these two hand-type structures are by a hydrophobic hinge area continuous [Schafer B.W., Heizmann C.W.Trends Biochem Sci, 1996 (4): 134-40.].S100 albumen exists mainly with the dimeric forms of non covalent bond combination, behind S100 albumen and calcium binding, conformation can change, expose the hydrophobic region of active site of protein, be used for and other albumen [DempseyA.C. that mutually combines, Walsh M.P., Shaw G.S.Structure, 2003 (7): 887-97.].Research finds that the S100 protein family is at protein phosphorylation, and regulatory enzyme is active, keep the calcium ion balance, cytoskeleton kinetics, [Donato R.Int J Biochem Cell Biol, 2001 (7): 637-68. play an important role in the physiological activities such as Growth of Cells, migration, differentiation and apoptosis; Santamaria-Kisiel L., Rintala-Dempsey A.C., Shaw G.S.Biochem J, 2006 (2): 201-14.].In addition, find that also they and human some diseases are associated, such as nervous system disorders, cardiomyopathy, [Marenholz I., the Heizmann C.W. such as oncogenesis and inflammation, Fritz G.Biochem Biophys Res Commun, 2004 (4): 1111-22.].

In recent years, increasing research is found, many S100 family members can be secreted into the extracellular, enter the peripheral blood circulation system, bring into play the effect of similar cytokine, comprise S100A4, S100A6, S100A7, S100A8, S100A9, S100A11, S100B, S100P etc., and these members' acceptor all is Advanced Glycation End Product Receptors (receptor for advanced glycation end products, RAGE) [Sparvero L.J., Asafu-A djei D., Kang R., et al.J Transl Med, 2009:17.].RAGE is accredited as the glycosylation of a series of albumen and lipid and the acceptor of intermediate oxidation product at first, [Ramasamy R. all plays a role in inflammation, renal failure, neurodegenerative disease and glycosuria disease, Vannucci S.J., Yan S.S., et al.Glycobiology, 2005 (7): 16R-28R.].Nearest research is found, RAGE is equally also as S100 family member's acceptor, by with the S100 protein binding, thereby the signal path in the activating cells, regulate propagation or apoptosis [LeclercE., Fritz G., the Weibel M. of cell, et al.J Biol Chem, 2007 (43): 31317-31.].

Find through the retrieval to prior art, Chinese patent literature CN101275951, open day 2008-10-01 has put down in writing a kind of " identifying molecule marker and the microarray system plate thereof of hepatic fibrosis and liver cirrhosis ", and this technology comprises albumin; Anpep; ANX2L4; APOF; Amyloid-beta (A4) precursor protein; α 2-glycoprotein 1, the zinc combination; Betaine homocysteine methyl transferase; Complement component 8, the α peptide; Chemokine (C-C primitive) aglucon 19; Complement factor H relevant 4; Complement factor H relevant 5; Collagen, I, α 2; Collagen, III, α 1; Collagen, XVIII, α 1; Decorin; DPT; FTCD; GYS2; Gelsolin; Interferon-gamma; Lactate dehydrogenase B; Inner chamber albumen; Middle α (sphaeroprotein) supressor H1; Platelet derived growth factor receptor, the α peptide; S100A4; The pth receptor associated protein 1; TIMP metallopeptidase inhibitor 1; And tumour necrosis factor; One of them or comprise at least these protein of encoding gene one of them, wherein there are 8 to be the adjusted gene at these protein or gene, 13 is lower regulatory gene, 9 are the treatment target, this technology is the molecule marker of tool screening capacity, with the generation of the serious hepatic fibrosis of early warning or liver cirrhosis, this molecule marker also is as the target to medicinal design tool potentiality.But this technology only discloses the up-regulated of S100A4 in liver fibrosis process, but does not provide any industrial application.

Summary of the invention

The present invention is directed to the prior art above shortcomings, propose a kind of application of S100 family protein, for the treatment hepatic fibrosis provides more action target spot, with screening treating liver fibrosis medicine.

The present invention is achieved by the following technical solutions:

The present invention relates to a kind of application of S100 family protein, the S100 family protein is used for screening treating liver fibrosis medicine as the medicine target molecule.

Described S100 family protein includes but not limited to be S100A4, S100A6, S100A7, S100A8, S100A9, S100A11, S100B, S100P etc., one of is preferably among S100A4, S100A6, S100A8, S100A9 or the S100A11; More preferably S100A6 albumen and mutant thereof, its functional activity fragment or its analogue.

The aminoacid sequence of described S100A6 albumen is shown in SEQ ID NO.1.

Described application, concrete by method and step according to high-flux medicaments sifting, by estimating compound antagonism S100 family protein biological activity to be screened, through primary dcreening operation, multiple sieve, deeply screening, determine the steps such as screening, obtain active lead compound.

The invention still further relates to described sRAGE albumen and can treat the method for hepatic fibrosis disease as activeconstituents, the method comprises the above-mentioned sRAGE albumen that gives patient's effective dose.

Described effective dose, namely therapeutic dose refers to: the amount that is enough to produce curative effect.Significant quantity can divide one or multiple dosing.Usually, significant quantity is enough to relax, improve, stablize, slow down or postpone further developing of disease.

Used activeconstituents, its effective dose can change with the severity of mode of administration and disease to be treated.For most of large mammal, the total dose that imposes effective constituent every day is about 0.01-1000mg.Usually, the scope of adult's clinical administration amount is 0.01-200mg/ day, is preferably 0.05-100mg/ day.

Described screening treating liver fibrosis medicine refers to: will apply and carry out drug screening according to cell viability after the treating liver fibrosis medicine is also cultivated through after adding described S100 family protein in the hungry cultured cells, obtain active compound.

Described hungry the cultivation refers to: cell is seeded in the 96 porocyte plates, cultivates cell death inducing under the condition of serum-free.

The consumption of described S100 family protein is 50 μ gmL.

The described treating liver fibrosis medicine that applies refers to: add the compound to be screened of different concns and cultivated two days when adding the S100 family protein.

Described cell includes but not limited to animal isolated cells cell, is preferably tumour cell, more preferably neuroblastoma cell.

The invention further relates to the purposes of a kind of sRAGE albumen in preparation treating liver fibrosis medicine.

Described sRAGE albumen, be solubility RAGE(soluble RAGE, sRAGE) be the RAGE(Advanced Glycation End Product Receptors, receptor for advanced glycation end products) extracellular region, sRAGE is by combining with RAGE part in the peripheral-system, cause these parts to combine with the normal RAGE acceptor on the film, thereby played the hormesis of block ligand, sRAGE is the natural agonist of RAGE part in the body.

Described sRAGE albumen of the present invention is preferably hsRAGE and mutant thereof; Its functional activity fragment or its analogue; Have the homologue of high homology and coding and comprise the carrier dna vector (plasmid or virus) for example of the protein of the aminoacid sequence that SEQ IDNO.2 describes.Functional activity fragment or analogue can form by one or more amino-acid residue that adds, inserts, modifies, replaces or lack in the above listed aminoacid sequence.

Described sRAGE albumen, its aminoacid sequence is shown in SEQ ID NO.2.

The present invention relates to a kind of pharmaceutical composition, comprise above-mentioned sRAGE albumen and carrier or vehicle as activeconstituents.

The formulation of described pharmaceutical composition comprises: tablet, capsule, powder, granule, syrup, solution, oral liquid, spirit, tincture, aerosol, powder inhalation, injection, injectable sterile powder, suppository etc., be preferably solid-state composition, especially lyophilized injectable powder.

Described carrier refers to: acceptable solvent, suspension agent or the vehicle pharmaceutically or on the food that are used for syzygy albumen of the present invention is sent to the animal or human.Carrier can be liquid or solid.

On the other hand, the invention discloses described sRAGE and can prevent or treat the method for hepatic fibrosis disease as activeconstituents, the method comprises the above-mentioned sRAGE that gives patient's effective dose.

The present invention finds that first having closely of S100 family protein and hepatic fibrosis contacts, proved that excessive S100A6 can increase the weight of hepatic fibrosis, and with the S100 family protein as the medicine target molecule at screening treating liver fibrosis albumen sRAGE, it can effectively treat hepatic fibrosis, for the treatment of hepatic fibrosis provides new Research Thinking, also provide new drug candidate Screening Platform and drug candidate for the treatment hepatic fibrosis.

Medicinal compositions of the present invention can prepare according to the method that the pharmaceutical manufacturing of knowing and generally acknowledge requires.Medicinal compositions is suitable to comprise protein of the present invention and pharmaceutically acceptable carrier, and is suitably unit dosage form.Medicinal compositions of the present invention can comprise the protein of the present invention of prodrug forms, and this prodrug can change at recipient's host intracellular metabolite the activity form of thing of the present invention.

Medicinal compositions of the present invention also can with the other therapies combined utilization, as simultaneously, sequential or use respectively.Medicinal compositions of the present invention can include other active function thing.

Description of drawings

Fig. 1 be in the liver fibrosis process S100 family member transcribe the variation synoptic diagram.

Fig. 2 is the Masson dyeing synoptic diagram of mouse liver section after the hepatic fibrosis modeling.

Fig. 3 be in hepatic fibrosis formation and the recovery process S100 family member transcribe the variation synoptic diagram.

Fig. 4 is hepatic fibrosis modeling hepatic fibrosis in mice area statistics synoptic diagram in various degree.

Fig. 5 is the content synoptic diagram of oxyproline in the hepatic fibrosis modeling mouse liver in various degree.

Fig. 6 be under the different degree of hepatic fibrosis S100 family member transcribe the variation synoptic diagram.

Fig. 7 is that immunohistochemistry is identified expression and the cellular localization synoptic diagram of S100A6 in liver fibrosis process.

Fig. 8 is the immunohistochemical methods synoptic diagram of Normal Human Liver tissue and hepatic fibrosis patient liver tissue slices Masson dyeing and S100A6.

Fig. 9 is the effect experiment liver tissue slices Masson dyeing synoptic diagram of rhS100A6 recombinant protein in the hepatic fibrosis in mice process.

Figure 10 is the hepatic fibrosis area statistics synoptic diagram of the effect experiment of rhS100A6 recombinant protein in the hepatic fibrosis in mice process.

Figure 11 is the assay synoptic diagram of serum Laminin.

Figure 12 is the mensuration synoptic diagram of hydroxyproline content in the liver.

Figure 13 be Col1 α 1 gene transcribe the variation synoptic diagram.

Figure 14 is the Masson dyeing synoptic diagram of the generation experiment of the independent inducing mouse hepatic fibrosis of rhS100A6 recombinant protein.

Figure 15 is the cell viability synoptic diagram that rhS100A6 can improve former generation hepatic stellate cell.

Figure 16 be flow cytometry rhS100A6 on former generation hepatic stellate cell cell cycle affect synoptic diagram.

Figure 17 is the mensuration of rhsRAGE protein biological activity

Figure 18 is the effect experiment liver tissue slices Masson dyeing synoptic diagram of rhsRAGE recombinant protein in the hepatic fibrosis in mice process.

Figure 19 is the hepatic fibrosis area statistics synoptic diagram of the effect experiment of rhsRAGE recombinant protein in the hepatic fibrosis in mice process.

Figure 20 is the mensuration synoptic diagram of hydroxyproline content in the liver.

Figure 21 be Col1 α 1 and Col3 α 1 gene transcribe the variation synoptic diagram.

Embodiment

The below elaborates to embodiments of the invention, and present embodiment is implemented under take technical solution of the present invention as prerequisite, provided detailed embodiment and concrete operating process, but protection scope of the present invention is not limited to following embodiment.

One, the preparation of animal model

1, hepatic fibrosis in mice forms and the recovery model

Reference literature (Aoyama T., Inokuchi S., Brenner D.A., Seki E..CX3CL1-CX3CR1Interaction Prevents Carbon Tetrachloride-Induced Liver Inflammation and fibrosis in mice.Hepatology, 2010,52 (4): 1390-400) set up mouse model, roughly step is as follows:

With male C57BL/6 mouse, press the dosage abdominal injection CCl of 0.5mL/kg body weight ₄, injected continuously for 9 weeks, stop weekly injection after twice, 9 week, make mouse begin self-recovery; CCl before injection respectively ₄, 6 weeks after the modeling, 9 weeks after the modeling, 6 weeks after stopping to inject, stop to get 6 mouse 12 weeks after the injection, with the dosage anesthetized mice of phenylethyl barbituric acid by 10 μ L/g body weight, by putting to death mouse behind the eyeball collection peripheral blood, obtain liver organization;

2, hepatic fibrosis in mice model in various degree

Male C57BL/6 is divided into 4 groups, 6 every group.One group is control group, and other three groups is experimental group.Experimental group is injected respectively the CCl of high, normal, basic various dose with the abdominal cavity ₄Solution injected for 9 weeks continuously, twice weekly; After 9 weeks, with the dosage anesthetized mice of phenylethyl barbituric acid by 10 μ L/g body weight, by putting to death mouse behind the eyeball collection peripheral blood, obtain liver organization;

Two, former generation hepatic stellate cell preparation and cultivation

Reference literature (Weiskirchen R., Gressner A.M..Isolation and Culture of Hepatic Stellate Cells, Methods Mol Med, 2005,117:99-113.), separation and purification and cultivation mouse primary hepatic stellate cell, roughly step is as follows:

To mouse liver perfusion IV Collagenase Type, liver is digested to individual cells, utilizes gradient centrifugation that nonparenchymal cell is separated with hepatic parenchymal cells, the method for recycling differential velocity adherent, hepatic stellate cell is separated with other nonparenchymal cell, thereby obtain the Mouse Liver stellate cell in former generation.

Three, the preparation of recombinant human S100A6 albumen

Reference literature (He H, Yang T, Jia S, Zhang R, Tu P, Gao J, Yuan Y, Han W, Yu Y.Expression and purification of bioactive high-purity human S100A6in Escherichia coli.Protein Expr Purif, 2012,83 (1): 98-103.) utilize escherichia coli prokaryotic expression system to express S100A6, the restructuring rhS100A6 albumen that purifying obtains, roughly step is as follows:

Be inserted in the pET28 plasmid by the S100A6 gene that from Hep G2 cell, obtains the people, thereby obtain the hS100A6 prokaryotic expression carrier, again with the Plasmid Transformation that builds in intestinal bacteria, by the IPTG abduction delivering, again with the intestinal bacteria ultrasonication, obtain total protein liquid, next albumen is carried out purifying, the restructuring rhS100A6 albumen that finally obtains through anion column displacement chromatography and molecular sieve two-stage process.

Described Hep G2 cell is available from No.320, Yueyang Road, Shanghai City Shanghai Inst. of Life Science, CAS cell resource center, is kept in the liquid nitrogen after suspending with the DMEM nutrient solution of the DMSO that contains 20% foetal calf serum and 10%.

Four, the preparation of restructuring rhsRAGE albumen

Reference literature (Ostendorp T., Weibel M., Leclerc E., et al.Biochem Biophys Res Commun, 2006 (1): 4-11) utilize the pichia spp eukaryotic expression system to express sRAGE, the restructuring rhsRAGE albumen that purifying obtains, roughly step is as follows:

People's sRAGE gene is inserted in the pPICZ α A plasmid, thereby obtain the hsRAGE Yeast expression carrier, again with the Plasmid Transformation that builds in yeast, pass through abduction delivering, adopt cation seperation column displacement chromatography and molecular sieve two-stage process albumen to be carried out purifying, the restructuring rhsRAGE albumen that finally obtains in the albumen in the culture supernatant.

Five, experimental technique

1, liver tissue slices preparation and Masson dyeing are observed

Carry out liver tissue slices preparation and Masson dyeing according to ordinary method, the liver tissue slices of simultaneously Masson dyeing is by having chosen at random 5 ~ 6 100 times of visuals field to each individuality, the liver organization area of about 0.3mm2, the hepatic fibrosis area wherein that utilized the NIS-Elements software statistics calculates the per-cent that the fibrosis area accounts for Area of fetal liver.

2, the mensuration of proline content in the liver organization

Adopt Nanjing to build up the content that the oxyproline testing cassete is measured oxyproline in the mouse liver tissue, concrete steps operate according to the test kit specification sheets.

3, quantitative PCR

Adopt SYBR Premix ExTaq quantitative PCR reagent (TaKaRa company), detect respectively that I type and III Collagen Type VI, mouse s100 and β-actin carry out quantitative fluorescent PCR in the liver organization, primer is as follows, corresponding SeqIDNo.3 ~ SeqIDNo.18.

Mouse s100a4 CAGCACTTCCTCTCTCTTGGTC

CCCTCTTTGCCTGAGTATTTGT

Mouse s100a6 CCAGACTGCGACACATTCCAT

TTGTCACCTTCCTTGCCAGAGT

Mouse s100a8 ATGCCCTCTACAAGAATGACT

AGATGCCACACCCACTTTTAT

Mouse s100a9 CGACACCTTCCATCAATACTCTA

ATCAGCATCATACACTCCTCAAA

Mouse s100a11 GCCACCGTCAGCCACAGTC

TTGTTTCCATCCTTCCCGCT

Mouse β-actin AGCCTTCCTTCTTGGGTATG

GTGTTGGCATAGAGGTCTTTAC

Mouse col1a1 CAGACCTGTGTGTTCCCTACTCA

GGATAGCGACATCGGCGG

Mouse col3a1 GCGAGCGGCTGAGTTTTATG

TAGGACTGACCAAGGTGGCTG

4, S100A6 and RAGE immunohistochemical staining

According to the Immunohistochemistry method, adopt anti-mouse S100A6 and RAGE to detect respectively S100A6 and RAGE in the liver organization.

5, the radioimmunoassay method detects the content of serum Laminin

Adopt Shang Haihai to grind medical biotechnology company limited ln radioimmunoassay test kit and come the content of oxyproline in the mice serum is measured, concrete steps operate according to the requirement of test kit specification sheets.

6, the cell cycle is detected

According to conventional fluidic cell method, detect the cell cycle of former generation hepatic stellate cell.

7, the detection of cell viability

According to the CCK-8 method, detect the cell viability of former generation hepatic stellate cell.

Embodiment 1

The hepatic fibrosis in mice model gene chip detection that CCl4 induces

The hepatic fibrosis in mice model that CCl4 induces, by continuous 9 weeks injecting CCl4 to mouse peritoneal, induce the formation of hepatic fibrosis, then before having gathered respectively injection, after injecting rear 6 weeks, 9 weeks and stopping the CCl4 injection, liver begins the mouse liver tissue in 6 weeks of self-recovery, 12 weeks, detects by gene chip (Affymetrix company)

The result:

Carry out cluster analysis, the gene that whole Expression In The Process changes is classified.Discovery is the trend of obvious increase along with Fibrotic generation has the expression amount of 254 genes approximately, but has arrived the recovery stage, and their expression amount has returned to again normal level.In these genes, except comprising collagen protein, matrix metalloproteinase, outside inflammatory factor etc. and the gene that hepatic fibrosis is associated, therefrom also found class calcium ion-binding protein family---a S100 protein family, its a lot of members can along with the generation of hepatic fibrosis, the situation (Fig. 1) that gene expression amount raises occur.

Embodiment 2

The S100 family gene is expressed and is changed in the liver fibrosis process

2.1 hepatic fibrosis in mice forms and recovers the S100 family gene expression variation of model

Step with reference to the front animal model, the preparation hepatic fibrosis in mice forms and the recovery model, collected the liver samples that comprises the front normal mouse of injection, and the liver samples of the hepatic fibrosis pathogenic process in 6 weeks of modeling and 9 weeks, stop in addition injecting the liver samples in 6 weeks of relief mouse self-recovery and 12 weeks, these liver organizations are made paraffin section, carry out Masson dyeing, the degree of checking hepatic fibrosis, such as Fig. 2, dye by Masson, nucleus is by the phenodin purple, and tenuigenin is dyed redness by ponceau, and fibrous tissue can be by the fast green green (arrow indication position among Fig. 2) of dying, can see that from section normal liver organization seldom has (Fig. 2-A) of Fibrotic the existence.And after 6 weeks of modeling, the central vein district in liver begin to occur fibrous tissue (Fig. 2-B), after 9 weeks of modeling, fibrous tissue is on the increase, and along the central vein district to around diffusion (Fig. 2-C).Stop CCl4 injection, allow after 6 weeks of liver self-recovery, find that fibrous tissue reduces gradually, only concentrate on central vein zone (Fig. 2-D).When returning to for 12 whens week, almost there is not fibrous tissue (Fig. 2-E) in the liver.Can be clear that from coloration result institute's modeling type meets the formation of hepatic fibrosis in mice and recovers whole process.

Gather the liver samples of different times, verify that by quantitative PCR the S100 gene family is in the formation of hepatic fibrosis and the changes in gene expression of recovery process.Chosen in the S100 family five members---S100A4, S100A6, S100A8, S100A9 and S100A11 are as the target gene of quantitative PCR.

Result such as Fig. 3.By seeing among the figure, along with the generation of hepatic fibrosis, obvious rising has all occured in the transcriptional level of these 5 genes of S100A4, S100A6, S100A8, S100A9 and S100A11, reaches maximum during to the 9th week.Than normal liver, when the 9th week, S100A4 and S100A6 have all improved more than 2 times, and S100A11 has improved 3 times, and S100A8 and S100A9 have improved respectively 5 times and 7 times.After 9 weeks, along with the recovery of hepatic fibrosis, the transcriptional level of 5 genes shows very fast downtrending, and to the 15th when week, its transcriptional level is being on close level when normal basically, and only the S100A4 expression amount still is higher than normal liver, but also obviously descends.During to the 21st week, the transcriptional level of 5 genes has been got back to normal level substantially.

Above result basic with early stage gene chip the result match, the gene transcription level of S100 family all is to improve along with the generation of hepatic fibrosis, and along with the recovery of liver self, expression amount returns to again normal level.

2.2 expressing, the S100 family gene of hepatic fibrosis in mice model in various degree changes

Step with reference to the front animal model, by the CCl4 to mouse peritoneal injection various dose, obtain hepatic fibrosis in mice model in various degree, liver organization is made paraffin section, carry out Masson dyeing, the degree of checking hepatic fibrosis calculates the per-cent that the fibrosis area accounts for Area of fetal liver, such as Fig. 4.The mouse liver of injection 0.25mL/kg body weight CCl4 dosage, its fibrosis accounts for 3.5% of whole liver, the mouse liver of injection 0.5mL/kg body weight CCl4 dosage, its fibrosis accounts for 6% of whole liver, and the mouse liver of injection 1mL/kg body weight CCl4 dosage, its fibrosis has accounted for about 8% of whole liver.

Oxyproline is the fibriilar indispensable amino acid of synthetical glue, so the content of oxyproline can react the synthetic speed of fiber, shows to a certain extent the degree of hepatic fibrosis.Therefore, adopt the Hydroxyproline assay test kit that the oxyproline in the liver is measured, discovery is along with the increase of CCl4 injected dose, the content of oxyproline also increases in the liver, during injection 1mL/kg body weight CCl4 dosage, the content of oxyproline can reach 0.5 μ g/mg weight in wet base in the liver, near 2 times (Fig. 5) of normal liver.

After having set up 3 kinds of hepatic fibrosis in mice models in various degree, chosen in the S100 family five members---S100A4, S100A6, S100A8, S100A9 and S100A11 are as the target gene of quantitative PCR, studied under different degree of hepatic fibrosis, these genes are with respect to the changing conditions of control group expression amount, result such as Fig. 6, can find out from the result of quantitative PCR, the transcriptional level of these 5 genes of S100A4, S100A6, S100A8, S100A9 and S100A11, all the intensification along with fibrosis raises.Under the CCl4 of 0.25mL/kg dosage, 5 genes are with respect to normal mouse, and the raising degree of its transcriptional level is not clearly, has only improved the level less than 1 times.And under the CCl4 of 0.5mL/kg dosage, the expression of 5 genes all has a very significant increase, and improves the standard between 3-5 times.Under the CCl4 of 1mL/kg dosage, the expression level of 5 genes is in 4 groups maximum.Than normal mouse, S100A4 has improved 3.5 times, and S100A6 has improved 3.3 times, and S100A11 has improved 4 times, and S100A8 has improved 7 times, and S100A9 improves at most, has improved 8 times.

2.3S100A6 the location of express cell in liver

After the expression of having determined the S100 family gene and hepatic fibrosis have dependency, identify the location that the S100 family protein is expressed in the liver by immunohistochemical staining.Chosen S100A6 albumen in the S100 family as research object, the liver of normal mouse and fibrosis mouse has been carried out immunohistochemical staining.By dyeing, the cell of expressing S100A6 can show Vandyke brown, therefore, such as Fig. 7, find, than normal mouse (Fig. 7-A and C), the expression amount of S100A6 more remarkable (Fig. 7-B and D) in the fibrosis mouse liver, it is consistent that this expression with quantitative PCR discovery hepatic fibrosis S100A6 in period is higher than normal mouse.In addition, the expression position of observing discovery S100A6 all concentrates on blood vessel and Fibrotic position occurs on every side, and is present in (Fig. 7-B and D, arrow indication position) in the nonparenchymal cell, and the expression in hepatic parenchymal cells is not obvious.

2.4 S100A6 immunohistochemistry in hepatic fibrosis patient's the liver

Obtained people's liver tissue slices from the Shanghai City Sixth People's Hospital, normal hepatic tissue (Fig. 8-A) and the tissue of hepatic fibrosis have been comprised, dye by Masson, can see a large amount of fibrous tissue has been arranged in the liver of suffering from hepatic fibrosis that (Fig. 8-B), it is early stage to confirm that patient has entered liver cirrhosis.By S100A6 is carried out immunohistochemical methods, discovery is in normal liver, the S100A6 expression amount remains on very low level (Fig. 8-C and E) equally, and in the early stage liver of liver cirrhosis, S100A6 exists great expression (Fig. 8-D and F at the fiber position of area vasculosa, as shown by arrows in FIG.), and concentrate in the nonparenchymal cell, the result is consistent with the hepatic fibrosis in mice model that adopts CCl4 to induce, thereby has illustrated that also the hepatic fibrosis in mice model that CCl4 induces can reflect the performance that hepatic fibrosis is clinical preferably.

Studied respectively S100 family member's the variation of transcribing from two aspects of severity of the pathogenic process of hepatic fibrosis and hepatic fibrosis, discovery is along with the generation of hepatic fibrosis, S100 family member's expression amount significantly improves, and hepatic fibrosis is when recovering, and the expression amount of S100 has been got back to again normal level.In addition, S100 family member's expression amount also becomes positive correlation with the severity of hepatic fibrosis, i.e. hepatic fibrosis is more serious, and its expression amount is higher.The important relation that has of S100 family member and hepatic fibrosis has been described thus.

What adopt is the hepatic fibrosis in mice model that CCl4 induces, may exist difference with the clinical pathogeny of hepatic fibrosis owing to consider it, therefore by immunohistochemical methods people's liver section is carried out research and comparison, discovery is early stage liver cirrhosis, the expression amount of S100A6 will be higher than normal liver significantly, its result with the CCl4 hepatic fibrosis in mice model of inducing consistent, therefore shown that also the hepatic fibrosis in mice model that CCl4 induces can reflect the pathogeny that hepatic fibrosis is clinical preferably.

Because the gene of S100 family is arranged in the genome with a bunch shape, the mechanism of its transcriptional control is also comparatively similar, and therefore except S100A6, the member of other family of S100 also probably expresses in nonparenchymal cell.And hepatic stellate cell directly is associated with hepatic fibrosis especially, therefore predicts that the albumen of S100 family probably directly acts on the hepatic stellate cell.

Embodiment 3

The effect research of S100A6 in liver fibrosis process

3.1rhS100A6 the Hepatic Fibrosis of Animal of recombinant protein experiment

Hepatic fibrosis in mice model and protein medicine-feeding method

CCl4 solution with male C57BL/6 mouse peritoneal injection 1mL/kg body weight dosage, injected for 11 weeks continuously, inject weekly twice, since the 9th week mouse being divided into two groups, one group is control group, and another group is experimental group, the rhS100A6 of the mouse subcutaneous injection 0.5mg/kg body weight of experimental group, the PBS of control group injection equal volume, inject once every day, continuous three weeks; 11 weeks finished rear collection peripheral blood and obtained liver organization and carry out follow-up test;

The result shows:

Paraffin section by liver organization carries out the degree that Masson dyes to analyze hepatic fibrosis, in addition, also to the Laminin Contents in the serum, hydroxyproline content in the hepatic tissue, and the index of several reflection hepatic fibrosis such as expression amount of type i collagen in the hepatic tissue is come the hepatic fibrosis in mice degree after the experiment is evaluated.Carry out Masson dyeing by the paraffin section to liver organization, find that with respect to normal liver organization apparent in view hepatic fibrosis has all appearred in control group and experimental group, such as Fig. 9.In the control group, fibrosis all concentrates on the central vein district, has formed fiber bridge joint (Fig. 9-A and B) between the part central vein.Than control group, the mouse of injection rhS100A6, its fibrosis is more serious, fibrosis zone, central vein district thicker (Fig. 9-C and D, arrow indication position among the figure), and nearly all forms the fiber bridge joint between the central vein, even fibrosis also occurred in the portal area.The hepatic fibrosis area wherein that utilized the NIS-Elements software statistics, calculate the per-cent that the fibrosis area accounts for Area of fetal liver, as shown in the figure, the liver fiber area of control group accounts for 10% of liver organization area, and the hepatic fibrosis area of experimental group has reached 16%, both have significant difference (p＜0.001), such as Figure 10.

Then, adopt the radioimmunoassay test kit to detect normal mouse, the content of injection PBS mouse and this serum Laminin of three groups of injection rhS100A6 mouse.Ln is as extracellular matrix, can great expression in liver fibrosis process, and what of its expression amount can reflect Fibrotic degree.Content through the ln in the mice serum that detect to find to have injected rhS100A6 is 36.9ngmL, is higher than the 24.7ngmL(p of control group＜0.05), such as Figure 11.Therefore from this index of serum Laminin content, its degree of hepatic fibrosis of mouse of having injected rhS100A6 will be higher than the mouse of control group.

Such as Figure 12, the content of finding the interior oxyproline of mouse liver of control group is 0.5 μ g/mg weight in wet base, and the content of oxyproline can reach 0.7 μ g/mg weight in wet base in the mouse liver of injection rhS100A6, the contrast group exceeds 40%(p＜0.001), the synthetic showed increased of the interior oxyproline of mouse liver of injection rhS100A6 is described, also reflected synthetic the increasing of collagen from a side, fibrosis is more serious.

Pass through quantitative PCR, discovery is than normal liver organization, the expression amount of Col1 α 1 gene has improved about 10 times in the mouse liver of PBS group, and the expression amount of Col1 α 1 gene has improved above 16 times in the mouse liver of injection rhS100A6, such as Figure 13, the synthetic far more than control group (p＜0.05) of its Col1 α 1 is described, shown that also its fibrosis contrast group mouse is serious.

Can sum up from top experiment and to draw, by the injected in mice rhS100A6 recombinant protein to CCl4 hepatic fibrosis modeling, can significantly increase the weight of the degree of hepatic fibrosis.

3.2rhS100A6 the separately experimentation on animals of inducing mouse hepatic fibrosis generation

Male C57BL/6 mouse is divided into two groups, the S100A6 of experimental mice subcutaneous injection 0.5mg/kg body weight, and the PBS of control group injection equal volume, inject once every day, continuous three weeks; After 3 weeks finished, the collection peripheral blood also obtained liver organization and carries out follow-up test.

The result:

After three weeks, the liver organization paraffin section of mouse is carried out Masson dyeing, such as Figure 14, find no matter be injection PBS, or rhS100A6, significant hepatic fibrosis does not appear in the liver of mouse, the necrosis of a large amount of hepatic parenchymal cellses do not occur yet.Illustrated that thus S100A6 can not induce separately the generation of hepatic fibrosis, also can not activate hepatic stellate cell independently.In the hepatic fibrosis experiment that CCl4 induces before, S100A6 is to the aggravation effect of hepatic fibrosis, show that S100A6 is not the first stage that acts on hepatic stellate cell activator probably, and may be to play a role at second stage, namely keep the propagation of hepatic stellate cell.

Embodiment 4

S100A6 is to the effect of former generation hepatic stellate cell

4.1S100A6 the impact of cell viability on former generation hepatic stellate cell

1) with former generation hepatic stellate cell be seeded in the RPMI1640 nutrient solution (containing 10%FBS), minute in 96 orifice plates, every hole 200 μ L, 5,000/hole;

2) cultivate after 24 hours, change the RPMI1640 nutrient solution that contains 1%FBS and cultivate 24h;

3) change in the serum-free RPMI1640 nutrient solution of the S100A6 that contains different concns, cultivate 48h, contrast adds the PBS of equivalent;

4) carefully suck supernatant, add the fresh RPMI1640 nutrient solution of 90 μ L, add again 10 μ L CCK-8 solution, continue to cultivate 4h;

5) the zeroing hole is set simultaneously, sets 6 multiple holes for every group;

6) per half hour, measured the light absorption value in each hole at enzyme-linked immunosorbent assay instrument 450nm place;

7) the relatively calculating of cell viability:

Result: former generation hepatic stellate cell that separation and purification obtains is cultivated in 96 porocyte plates, under starvation, the rhS100A6 that adds different concns, cultivate the vigor that detects two days later cell with CCK-8 reagent, such as Figure 15, discovery 0.3 μ g/mL be rhS100A6 on former generation hepatic stellate cell almost without impact, but the increase along with rhS100A6 dosage, in former generation,, the vigor of hepatic stellate cell also obviously increased, and when rhS100A6 concentration was 1 μ g/mL, cell viability had improved 20%, when rhS100A6 concentration is brought up to 10 μ g/mL, cell viability has improved 80%, and when rhS100A6 concentration when 50 μ g/mL are above, cell viability has nearly improved 100%.This shows that external, the rhS100A6 of 1 μ g/mL just can significantly improve the cell viability of hepatic stellate cell, and improves along with the rising of rhS100A6 dosage, until reach capacity during 50 μ g/mL.

4.2S100A6 the Control of cellcycle to former generation hepatic stellate cell

1) with former generation hepatic stellate cell cultivate in the 6cm culture dish;

2) behind the cultivation 24h, change the RPMI1640 nutrient solution that contains 1%FBS and cultivated 24 hours;

3) change in the RPMI1640 nutrient solution of 1% or the 3%FBS that contain 5 μ M S100A6, cultivated 48 hours, contrast adds the PBS of equivalent;

4) with pancreatin with former generation hepatic stellate cell digest, the centrifugal 5min of 1,000rpm removes supernatant;

5) add PBS and wash once, the centrifugal 5min of 1,000rpm removes supernatant;

6) use 3mL PBS with cell suspension, dropwise join in the 7mL dehydrated alcohol of-20 ℃ of C precoolings, making the ethanol final concentration is 70%, puts into-20 ℃ of C refrigerator overnight, makes cell fully fixing;

7) spend the night after, the centrifugal 5min of 1,000rpm removes supernatant;

8) add the PI staining fluid, the room temperature lucifuge is processed 30min;

9) wash once with PBS, the centrifugal 5min of 1,000rpm removes supernatant;

10) add 500 μ L PBS, fully suspension cell is transferred in the streaming pipe, carries out flow cytometer showed.

Result: by flow cytometer the cycle of cell is analyzed, found that the cell quantity of control group G1 phase accounts for 88.4% under the 1%FBS culture condition, more than 83.9% of the cell that adds rhS100A6 albumen in the nutrient solution.The cell quantity of control group S phase accounts for 8.6%, G2 issue amount only has 3%, and add cell (Figure 16-A) of rhS100A6 albumen in the nutrient solution, S issue amount accounts for 8.9%, the G2 phase especially quantity be increased to 7.2%(Figure 16 B), the quantity of contrast S phase and M phase cell illustrates that rhS100A6 can promote the synthetic and cell proliferation of DNA.Under the 3%FBS culture condition, the cell quantity of control group G1 phase accounts for 75.1%, equally more than 70.5% of the cell that adds rhS100A6 albumen in the nutrient solution, the cell quantity of control group S phase accounts for 18.4%, G2 issue amount is 6.5%(Figure 16 C), and the cell of adding rhS100A6 albumen in the nutrient solution, its S issue amount is 8.8%, comparing control group will lack, but G2 issue amount but has been increased to 20.7%(Figure 16 D).Can draw thus, not have under the extraneous stimulation, under the 1%FBS culture condition, the G1 phase that is in that the cell of control group is more, seldom carry out DNA and synthesize.And under the 3%FBS culture condition, though the cell of control group has part to carry out DNA and synthesizes, mostly all be in the S phase.And add rhS100A6 in the nutrient solution, and can not only irritation cell enter into the S phase from the G1 phase, can also enter the G2 phase from the S phase, illustrate that therefore S100A6 has the effect of the cell cycle of accelerating hepatic stellate cell.(Figure 16 flow cytometry rhS100A6 is on the impact of cell cycle of former generation hepatic stellate cell.Add PBS(A under the 1%FBS condition) or rhS100A6(B), add PBS(C under the 3%FBS condition) or rhS100A6(D)).

Embodiment 5

The screening of S100 family protein activity inhibitor

Known S100 family protein is by being attached to the cell of expressing the RAGE acceptor, thereby brings out intracellular signal path, and sRAGE is the natural agonist of RAGE part in the body.Find the obvious dependency that has of S100 family and hepatic fibrosis in the experiment in front, the experimentation on animals by S100A6 has proved that also S100A6 can stimulate the propagation of hepatic stellate cell, causes increasing the weight of of hepatic fibrosis.Therefore, plan adopts sRAGE as this characteristic of natural antagonist of RAGE in the body, comes the activation for RAGE of antagonism S100A6.In addition, other member of S100 family also is take RAGE as acceptor, equally probably stimulates hepatic stellate cell in liver fibrosis process by RAGE, and dimension can play many-sided antagonistic action by sRAGE.Because the similarity of the S100 family protein of people and mouse is more than 85%, the similarity of sRAGE is 80%, and people and mouse are lower on the similarity of other part of RAGE, therefore select to adopt people's sRAGE as the medicine of hepatic fibrosis in mice treatment, the first, people's sRAGE is same and have the mouse S100 family protein of high similarity that higher affinity, second are arranged, can avoid the combination of people's sRAGE and other part of mouse RAGE, avoid producing more interference.

SH-SY5Y cell (human neuroblastoma cell) is seeded in the 96 porocyte plates, under the condition of serum-free, cell is carried out hunger to be cultivated, cell death inducing, on the basis that adds 50 μ g/mL rhS100A6, the rhsRAGE that adds simultaneously different concns cultivates two days later, with the CCK-8 test kit cell viability is measured.

Result: find that 10 μ g/mL rhsRAGE can both significantly suppress rhS100A6 and promote apoptotic effect, and than the PBS contrast, the vigor of cell also has significant the raising, such as Figure 17.When concentration reaches 50 μ g/mL, compare according to cell viability being improved 80%.

Described human neuroblastoma cell SH-SY5Y cell is available from No.320, Yueyang Road, Shanghai City Shanghai Inst. of Life Science, CAS cell resource center, is kept in the liquid nitrogen after suspending with the RPMI1640 nutrient solution of the DMSO that contains 20% foetal calf serum and 10%.

Embodiment 6

The effect of sRAGE treatment hepatic fibrosis

By abdominal injection CCl4, continuous 11 weeks, the hepatic fibrosis of inducing mouse, since the 9th week mouse being divided into 5 groups, 10 every group, wherein 4 groups is experimental group, every day, the subcutaneous rhsRAGE that injects respectively 0.5mg/kg body weight and 1.5mg/kg body weight injected for 3 weeks continuously.Other one group is control group, the PBS of subcutaneous injection every day equal volume.After experiment finishes, obtain liver organization and the serum of 5 groups of mouse.Carry out the degree that Masson dyes to analyze hepatic fibrosis by the paraffin section that adopts liver organization, in addition, also detected hydroxyproline content in the hepatic tissue, and type i collagen in the hepatic tissue, the index of several reflection hepatic fibrosis such as expression amount of III Collagen Type VI is evaluated the hepatic fibrosis in mice degree after the experiment.

Result: carry out Masson dyeing by the paraffin section to liver organization, such as Figure 18, find that the liver of control group mice has formed apparent in view hepatic fibrosis in the central vein district, formed fiber bridge joint (Figure 18 A and B) between the central vein.The mouse of injection rhsRAGE, when 0.5mg/kg body weight dosage, there is not significant difference (Figure 18 C and D) with control mice, and when 1.5mg/kg body weight dosage, find that its fibrosis has alleviating to a certain degree, at the fibrous tissue in central vein district zone less, invade the fiber also less (Figure 18 E and F) in the tissue.The hepatic fibrosis area wherein that utilized the NIS-Elements software statistics, calculate the per-cent that the fibrosis area accounts for Area of fetal liver, as shown in figure 19, the liver fiber area of control group accounts for 9.6% of liver organization area, the mouse of the rhsRAGE of injection 0.5mg/kg body weight, its fibrosis area accounts for 7.8% of Area of fetal liver, although contrast slightly reduces, does not have equally statistically significant difference.And the mouse of the rhsRAGE of injection 1.5mg/kg body weight, its fibrosis area accounts for 7.1% of Area of fetal liver, compare control group and descended about 25%, pass through statistical test, have significant difference (p＜0.01) with control group mice, thereby the rhsRAGE of explanation 1.5mg/kg body weight can alleviate hepatic fibrosis significantly.

Recycling Hydroxyproline assay test kit is measured the oxyproline in the liver, such as Figure 20, the content of finding the interior oxyproline of mouse liver of control group is 0.4 μ g/mg weight in wet base, and the content of oxyproline is respectively 0.30 and 0.29 μ g/mg weight in wet base in the injection 0.5mg/kg mouse liver with the rhsRAGE 1.5mg/kg body weight body weight, compare with control group statistically significant difference is all arranged, illustrate that the synthetic of oxyproline obviously reduces in the mouse liver of having injected rhsRAGE, also reflected the synthetic minimizing of collagen from a side, it is light to show that its degree of hepatic fibrosis is compared control group.

Adopt again the method for quantitative PCR to detect that the expression amount of type i

collagen Col1 α

1 and 1 two genes of III Collagen Type VI Col3 α changes in the liver organization.Such as Figure 21, discovery is than control group, 1 two genes of Col1 α 1 and Col3 α are compared control group and are all significantly decreased in its liver of rhsRAGE mouse of injection 1.5mg/kg body weight dosage, the expression amount of Col1 α 1 gene has descended 55%, the expression amount of Col3 α 1 gene has descended 40%, and the rhsRAGE that injection 1.5mg/kg body weight dosage therefore has been described can significantly reduce the expression amount of I type and III Collagen Type VI in the liver.

Can find out from above experiment, by the hepatic fibrosis injected in mice rhsRAGE recombinant protein to the CCl4 modeling, come the RAGE part in the antagonism Mice Body, S100 family protein particularly, find that r rhsRAGE2 but has the curative effect of obvious reduction hepatic fibrosis in mice, especially when the dosage of rhsRAGE reaches the 1.5mg/kg body weight, can significantly alleviate the degree of hepatic fibrosis in mice.

Part technological operation information is the conventional cognitive of those skilled in the art in above-described embodiment, and the practitioner can be referring to textbook and the comment of cells involved biology, weave construction and embry standard.Comprise that Teratocarcinomas and embryonic stem cell:A practical approach[E.J.Robertson compiles, IRL publishes company limited, 1987]; The volumes such as Guide to techniques in mouse Development[P.M.Wasserman, academic press, 1993]; Embryonic Stem Cell Differentiation in Vitro[M.V.Wiles, Meth.Enzymol.225:900,1993]; Properties and uses of Embryonic Stem Cells:Prospects for Application to Human Biology and Gene Therapy[P.D.Rathjen etc., Reprod.Fertil.Dev.10:31,1998].

Cytobiology, protein chemistry and antibody technique can be at " the current scheme in the albumen science " [editor such as J.E.Colligan, Wiley﹠amp; Sons], " the current scheme in the cytobiology " [J.S.Bonifacino etc., Wiley﹠amp; Sons] and " during the rabbit epidemiology merit also scheme " [editor such as J.E.Colligan, Wiley﹠amp; Sons] in find.Reagent related to the present invention, cloning vector and genetic manipulation test kit can obtain from commercial supplier, for example BioRad, Stratagene, Invitrogen, ClonTech and sigma-Aldrich company.

Usually (R.I.Freshney edits latest edition cell culture processes, Wiley﹠amp in " animal cell culture: basic fundamental handbook "; Sons); " cell cultures general technology " (M.A.Harrison and I.F.Rae, Cambridge University publishes); In " embryonic stem cell: method and operational provisions " (K.Turksen edits, and Humana publishes) description is arranged.Tissue culture medium (TCM) and reagent can obtain from commercial supplier, for example Gibco/BRL, Nalgene-Nunc International, Sigma Chemical Co. and ICN Biomedicals.

Sequence table

Claims

1. the application of a S100 family protein is characterized in that, the S100 family protein is used for screening treating liver fibrosis medicine as the medicine target molecule.

2. application according to claim 1 is characterized in that, described S100 family protein comprises S100A4, S100A6, S100A7, S100A8, S100A9, S100A11, S100B, S100P.

3. application according to claim 1 is characterized in that, described S100 family protein is one of among S100A4, S100A6, S100A8, S100A9 or the S100A11.

4. application according to claim 1 is characterized in that, described S100 family protein is S100A6 albumen and mutant thereof, its functional activity fragment or its analogue.

5. according to claim 2 or 3 or 4 described application, it is characterized in that the aminoacid sequence of described S100A6 albumen is shown in SEQ ID NO.1.

6. application according to claim 1, it is characterized in that, described screening treating liver fibrosis medicine refers to: will be through after adding described S100 family protein in the hungry cultured cells, carry out drug screening according to cell viability after applying treating liver fibrosis medicine and cultivation, obtain active compound.

7. application according to claim 6 is characterized in that, described hungry the cultivation refers to: cell is seeded in the 96 porocyte plates, cultivates cell death inducing under the condition of serum-free.

8. according to claim 1 or 6 described application, it is characterized in that the consumption of described S100 family protein is 50 μ g/mL.

9. application according to claim 6 is characterized in that, the described treating liver fibrosis medicine that applies refers to: add the compound to be screened of different concns and cultivated two days when adding the S100 family protein.

10. the application of a sRAGE albumen is characterized in that, for the preparation of the treating liver fibrosis medicine.

11. application according to claim 10, it is characterized in that, described sRAGE albumen, it is the extracellular region of solubility Advanced Glycation End Product Receptors, sRAGE is by combining with RAGE part in the peripheral-system, cause these parts to combine with the normal RAGE acceptor on the film, thereby played the hormesis of block ligand.

12. according to claim 10 or 11 described application, it is characterized in that described sRAGE albumen refers to: hsRAGE and mutant thereof; Its functional activity fragment or its analogue; Carrier with protein of the homologue of high homology and the aminoacid sequence that coding comprises SEQ ID NO.2 description.

13. according to claim 10 or 11 described application, it is characterized in that, described sRAGE albumen, its aminoacid sequence is shown in SEQ ID NO.2.

14. a pharmaceutical composition is characterized in that, comprises as activeconstituents, such as arbitrary described sRAGE albumen and carrier or vehicle among the claim 13-17.

15. composition according to claim 14, it is characterized in that the formulation of described pharmaceutical composition comprises: tablet, capsule, powder, granule, syrup, solution, oral liquid, spirit, tincture, aerosol, powder inhalation, injection, injectable sterile powder or suppository.

16. composition according to claim 14 is characterized in that, the formulation of described pharmaceutical composition is solid-state composition.

17. composition according to claim 14 is characterized in that, the formulation of described pharmaceutical composition is lyophilized injectable powder.

18. composition according to claim 14 is characterized in that, described carrier refers to: acceptable solvent, suspension agent or the vehicle pharmaceutically or on the food that are used for syzygy albumen of the present invention is sent to the animal or human.