CN102994512B - Molecular marker, kit and method for detecting susceptibility of ovarian cancer - Google Patents

Abstract

The invention discloses a molecular marker for detecting the susceptibility of ovarian cancer. The nucleotide sequence of the molecular marker is shown as SEQ ID NO:1, wherein single nucleotide polymorphism G>A exists at a 231st site. A kit for detecting the susceptibility of the ovarian cancer comprises a pair of specific primers with sequences of SEQ ID NO:2 and SEQ ID NO:3. A single nucleotide polymorphism method for detecting whether a sample has an MTDH gene in vitro comprises the following steps of: amplifying the MTDH gene of the sample by the specific primers of the MTDH gene, thus obtaining an amplification product; and performing sequence determination on the amplification product so as to detect whether the amplification product contains the single nucleotide polymorphism 231G>A. The molecular marker, the kit and the method for detecting the susceptibility of the ovarian cancer as well as the single nucleotide polymorphism method for detecting whether the sample has the MTDH gene in vitro are simple, accurate and rapid in detection and high in specificity.

Description

A kind of molecule marker for detection of ovarian cancer susceptibility, test kit and detection method thereof

Technical field

The present invention relates to a kind of molecule marker for detection of ovarian cancer susceptibility, test kit and detection method thereof, relate to particularly single nucleotide polymorphism (the single nucleotide polymorphism of MTDH gene, SNP) and with the dependency of ovarian cancer, and detect method and the test kit of these SNP, belong to molecular biology and medical field.

Background technology

Ovarian cancer is the female reproductive system tumour that lethality rate is the highest, global new cases 225500 people in 2008, dead 140200 people.Due to onset concealment, symptom is not obvious, late period when most of patients is found, 5 years survival rates of Patients with Advanced Ovarian Carcinoma are only 30～45% left and right, poor prognosis, and 5 years survival rates of early ovarian cancer patient are up to 90%, this key of pointing out us to improve ovarian cancer patients prognosis and existence is early to examine, early control, therefore inquire into the biological mechanism that development occurs ovarian cancer, find the molecule marker of qualification ovarian cancer Susceptible population, the molecule marker of ovarian cancer patients molecule parting and prognosis prediction, implement effectively early to examine for high risk population or susceptible individual and ovarian cancer patients, early control with individuation control significant.

In prior art, although had, to exceed 1100 heritable variations in 200 candidate genes and 20 hereditary regions relevant to ovarian cancer susceptibility, little with the heritable variation that ovarian cancer dependency is very strong.And there is no the report of MTDH gene SNP and ovarian cancer dependency.Therefore, ovarian cancer susceptible gene is badly in need of further finding in this area, and exploitation detects method, the test kit of ovarian cancer high risk population and susceptible individual, and relevant medicine.

Summary of the invention

For above-mentioned prior art, present inventor is through research deeply and widely, the SNP of a large amount of candidate genes is measured and analyzed, find that first MTDH is closely related with ovarian cancer susceptibility, can be used as the molecule marker of the detection of ovarian cancer susceptibility or early diagnosis, therefore, the invention provides a kind of test kit for detection of ovarian cancer susceptibility and method thereof, and whether vitro detection sample there is the method for the single nucleotide polymorphism of MTDH gene.

The present invention is achieved by the following technical solutions:

A kind of molecule marker for detection of ovarian cancer susceptibility, its nucleotide sequence is as shown in SEQ ID NO:1, it is compared with normal MTDH gene, difference is: the 231st exists single nucleotide polymorphism a: G>A, the base of the 231st comprises bases G and two kinds of situations of base A, in the time being bases G, is normal MTDH gene, in the time being base A, the MTDH gene for sudden change:

gctacaaatt?agtaggaaaa?gaatagtgcc?gcccacgggc?tttccaactt?ttgaattctg?60

gggactaaca?acagagagca?agagtgaatg?agccaaacga?cgcaaacgtg?ccctcgccag?120

gctggcaact?ggtaggcacg?cagtgtatta?gttgccctgg?agagaaacac?cctggagaga?180

aatacccaat?ttgtgaacta?aacctaggtc?ccggaagaac?agtgttcggc?rtcagactcc?240

231, r=G or A

gttgagctca?ttctggaagg?atccaactgg?cgccaccagg?gagaaaaagc?gattccacct?300

caataacact?ccagaaaaag?gcatgaagag?ccctatacct?gccagggcga?ctttgaccta?360

gacccggtga?cccggttcct?agcgctgcag?ccctacccgc?cccccgcccg?cccccgcctt?420

gcacggagcc?cctcctctgt?actcattcgt?tgcgccacgt?ctcctaactc?tgcgccacca?480

gccaccccgc?gaaggcgtcc?accaattaac?ccctcccagc?ttctggtcta?cagtaacggg?540

tccccaacgc?cgcgtcttaa?ccaggcccga?accgaccacc?gccaaccttc?cctgacacgc?600

ctttgcccca?cccgaccccg?cccgccccca?cgtgacgccc?acgccccgcc?cactggcgcc?660

cacgtgaccc?acggtcgtcc?ccgcgcgcgg?cgtggatcgc?ggcccaagcc?gccattgttc?720

cgccgaggga?ggacagcggg?gcctggcgct?ggcgccgaga?cgccgcttag?cggccgccac?780

tggagacact?ccctcccgcc?tcccgggtct?cctggcggcg?gcggagtgag?gctgacagcg?840

gggaacctgg?gagacccctc?cgccctcccc?gcggtggcag?cggccgatcc?ccggctccgg?900

cgcgagggac?ggccgcgatg?cgctcggcct?gaggttaccc?ggcccggccc?ttcctcgctt?960

ccctcgacta?ttccactgcg?tctccgcgcc?ccggcgtcat?cctgcgagtc?cctctgacgg?1020

gagggaagat?ggctgcacgg?agctggcagg?acgagctggc?ccagcaggcc?gaggagggct?1080

cggcccggct?gcgggaaatg?ctctcggtcg?gcctaggctt?tctgcgcacc?gagctgggcc?1140

tcgacctggg?gctggagccg?aaacggtacc?1170

A kind of test kit for detection of ovarian cancer susceptibility, comprise Auele Specific Primer, this primer is a pair of, has the sequence of SEQ ID NO:2 and SEQ ID NO:3, can be specific the primer of amplification MTDH gene, can amplify specifically length 200～2700bp.

Further, test kit also comprises PCR reaction solution, and PCR reaction solution is by dNTP, Mg ²⁺, Taq enzyme and Buffer composition.In PCR reaction solution, each component is conventional with magnitude relation, is common practise for one of ordinary skill in the art.

Whether vitro detection sample there is a method for the single nucleotide polymorphism of MTDH gene, and step is as follows:

(1) with the MTDH gene of MTDH gene-specific primer amplification sample, obtain amplified production; Described primer is a pair of, has the sequence of SEQ ID NO:2 and SEQ ID NO:3;

(2) amplified production is carried out to sequencing, detect in amplified production whether have following single nucleotide polymorphism: 231G>A; The sequence of 231G>A sudden change Position Number based on SEQ ID NO:1.

The method that individual ovarian cancer susceptibility or ill risk are detected or diagnosed, step is as follows:

Detect this individual MTDH gene, transcript and/or albumen, and compare with normal MTDH gene, transcript and/or albumen, there are differences and just show that possibility that this individuality has ovarian cancer is lower than normal population.Described difference refers to whether there is single nucleotide polymorphism: 231G>A; The sequence of 231G>A sudden change Position Number based on SEQ ID NO:1.

Molecule marker for detection of ovarian cancer susceptibility of the present invention, test kit and method thereof, and whether vitro detection sample there is the method for the single nucleotide polymorphism of MTDH gene, detect simple, accurate, quick, high specificity, implements effectively early to examine, early controls with individuation control significant for high risk population or susceptible individual and ovarian cancer patients.

Embodiment

Below in conjunction with embodiment, the present invention is further illustrated.

The detection of embodiment 1 MTDH transgenation and with the association analysis of ovarian cancer

1.1 research object

Choose ovarian cancer patients 145 examples, treatment is made a definite diagnosis in Shandong Qilu Hospital year April in September, 2008～2011, and clinical data obtains from case history.Contrast patient 254 examples of age-matched are the Physical Examination Center Physical Examination women of Shandong hospital.Most subjects is Donors in Shandong Province.Get subject's peripheral blood 1.5ml, in-80 DEG C of stored refrigerated.All subjects all require informed consent according to Ethics Committee of Shandong Qilu Hospital.

1.2DNA extract

With conventional phenol chloroform method extraction experimenter peripheral blood DNA, specific as follows:

(1) getting 400ul blood is added in 1.5ml centrifuge tube.

(2) add 800ul PBS, mix, 3500g, 15min, abandons supernatant; Come again.

(3) add 400ul lysate, 37 DEG C, 1h.

(4) add Proteinase K 4ul, concentration 200ug/ml.

(5) 55 DEG C of water-baths digest spend the night (4-12h).

(6) add the saturated phenol of Tris of 400ul, mix shake 10min.

(7) 5000g, 15min, water intaking phase.

(8) add 100ul NaAc, 800ul dehydrated alcohol ,-20 DEG C, 20min.

(9) 12000g, 5min, abandons supernatant.

(10) 600ul 70% ice ethanol, 12000g, 5min, abandons supernatant, repeats once.

(11) 12000rpm is centrifugal, 10 minutes.Abandon supernatant, dry.Be dissolved in 100 μ l TE.

(12) measure concentration and purity, packing, frozen in-80 DEG C.

1.3 primers, pcr amplification and order-checking

Download MTDH genome sequence (Gene ID:92140 from GenBank; Nucleotide:AC_000140.1GI:157734173), with primer premier5.0 design primer.Concrete primer details are in table 1.

Table 1 primer sequence table

Primer title	Sequence	SEQ?ID?NO：
			Upstream primer	5'CTGGCAACTGGTAGGCACGC?3'	2
Downstream primer	5'GAGGGACTCGCAGGATGACG?3'	3

Pcr amplification condition: 94 DEG C 3 minutes, (94 DEG C 30 seconds, 60 DEG C 30 seconds, 72 DEG C 40 seconds) × 35,72 DEG C 7 minutes, 10 DEG C of insulations.Pcr amplification product is 1255bp.

Pcr amplification product is delivered the order-checking of Shanghai Bo Shang biotech company, sequencing result application software Meglign 7.0 and Chromas 2.33 test and analyze, this enforcement has adopted backward sequencing, by analysis, finds to exist following SNP:231G>A.

1.4SNP somatotype and association analysis

Application card side (X ²) check the distribution in subject site is carried out to statistical study; In the time that the expectation number of a cell is less than 5, applying Fisher rigorous examination analyzes.All P values are bilateral probability, think and have remarkable statistical significance in the time of P<0.05.Applying the dependency of unconditional logistic regression analysis between ill to genotype frequency, gene frequency and ovarian cancer assesses, calculate its odds ratio (Odds ratio, OR) and 95% credibility interval (confidence interval, CI), and apply SPSS17.0 software (SPSS Inc.Chicago, Illinois, USA) carry out statistical study.

Found that rs16896059 (231G>A) site and ovarian tumors significant correlation in SEQ ID NO:1, wherein the P value of additive inheritance model (G/G vs.G/A vs A/A) is 0.042.The P value of dominant inheritance model (G/G+G/A vs A/A) is 0.0198(OR=0.33,95%CI[0.12～0.78])., A allelotrope is protectiveness allelotrope (P=0.0175, OR=0.66,95%CI[0.46～0.93]).Detailed results is in table 2.

The distribution in ovarian cancer group and normal healthy controls group of table 2 231G>A loci gene type and allelotrope

Embodiment 2 ovarian cancer susceptibility detection kit

Because sudden change and the ovarian cancer of 231G>A in SEQ ID NO:1 are delivered height correlation, therefore can expand detection taking patient's DNA as template again based on this sudden change design MTDH gene-specific primer.

Prepare a test kit (100 person-times), it contains material as shown in table 3:

Table 3

Extract experimenter's peripheral blood 2ml, ordinary method is extracted DNA.Utilize ovarian cancer susceptibility detection kit to carry out PCR reaction, reaction product is checked order, utilize Meglign 7.0 and Chromas 2.33 softwares test and analyze sequencing result.Experimenter's ovarian cancer susceptibility that detected result contains rs16896059 (231G>A) is lower than normal population.

Should be understood that after having read foregoing of the present invention, those skilled in the art can make various amendments or change to the present invention, but the equivalent form of value of these changes or amendment drops in limited range of the present invention equally.

Claims (2)

1. the application of Auele Specific Primer in the test kit for the preparation of detection ovarian cancer susceptibility, is characterized in that: Auele Specific Primer is a pair of having the sequence of SEQ ID NO:2 and SEQ ID NO:3.

2. application according to claim 1, is characterized in that: in described test kit, except Auele Specific Primer, also comprise PCR reaction solution, PCR reaction solution is by dNTP, Mg ²⁺, Taq enzyme and Buffer composition.