CN102864234B - Molecular marker for identifying susceptibility of ovarian cancer - Google Patents
Molecular marker for identifying susceptibility of ovarian cancer Download PDFInfo
- Publication number
- CN102864234B CN102864234B CN201210376555.7A CN201210376555A CN102864234B CN 102864234 B CN102864234 B CN 102864234B CN 201210376555 A CN201210376555 A CN 201210376555A CN 102864234 B CN102864234 B CN 102864234B
- Authority
- CN
- China
- Prior art keywords
- ovarian cancer
- seq
- molecular marker
- snp
- susceptibility
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a molecular marker for identifying susceptibility of ovarian cancer. The nucleotide sequence of the molecular marker is presented as SEQ ID NO: 1 and single nucleotide polymorphism (SNP) C) T exists at the 1556 position. A kit for detecting the susceptibility of the ovarian cancer comprises a pair of specific primers provided with sequences of SEQ ID NO: 2 and SEQ ID NO: 3. A method for in vitro detecting whether the SNP of a GADD45A gene exists in a sample includes the steps of amplifying the GADD45A gene of the sample by using the specific primers to obtain amplification products; and performing sequencing on the amplification products to detect whether the SNP 1556C) T exists in the amplification products. According to the molecular marker, the method is simple, accurate and rapid in detection, the specificity is high, and the significance in effective early diagnosis, treatment and individual prevention for high risk groups, susceptible individuals and ovarian cancer patients is provided.
Description
Technical field
The present invention relates to a kind of molecule marker for identification of ovarian cancer susceptibility, test kit and detection method thereof, single nucleotide polymorphism (the single nucleotide polymorphism that relates to particularly GADD45A gene, SNP) and with the dependency of ovarian cancer, and detect method and the test kit of these SNP, belong to molecular biology and medical field.
Background technology
Ovarian cancer is the female reproductive system tumour that lethality rate is the highest, global new cases 225500 people in 2008, dead 140200 people.Due to onset concealment, symptom is not obvious, late period when most of patients is found, 5 years survival rates of Patients with Advanced Ovarian Carcinoma are only 30～45% left and right, poor prognosis, and 5 years survival rates of early ovarian cancer patient are up to 90%, this key of pointing out us to improve ovarian cancer patients prognosis and existence is early to examine, early control, therefore inquire into the biological mechanism that development occurs ovarian cancer, find the molecule marker of identifying ovarian cancer Susceptible population, the molecule marker of ovarian cancer patients molecule parting and prognosis prediction, for high risk population or susceptible individual and ovarian cancer patients, implement effectively early to examine, early control with individuation control significant.
In prior art, although had, to surpass 1100 heritable variations in 200 candidate genes and 20 hereditary regions relevant to ovarian cancer susceptibility, with the very strong heritable variation of ovarian cancer dependency but seldom.And the report that there is no GADD45A gene and ovarian cancer dependency, does not more have the report of GADD45A gene SNP and ovarian cancer dependency.Therefore, ovarian cancer susceptible gene is badly in need of further finding in this area, and exploitation detects method, the test kit of ovarian cancer high risk population and susceptible individual, and relevant medicine.
Summary of the invention
For above-mentioned prior art, present inventor is through research deeply and widely, the SNP of a large amount of candidate genes is measured and analyzed, find that first GADD45A is closely related with ovarian cancer susceptibility, can be used as the molecule marker of the detection of ovarian cancer susceptibility or early diagnosis, therefore, the invention provides a kind of test kit for detection of ovarian cancer susceptibility and method thereof, and whether vitro detection sample there is the method for the single nucleotide polymorphism of GADD45A gene.
The present invention is achieved by the following technical solutions:
A kind of molecule marker for identification of ovarian cancer susceptibility, its nucleotide sequence is as shown in SEQ ID NO:1, it is compared with normal GADD45A gene, difference is: the 1556th exists single nucleotide polymorphism a: C>T, the base of the 1556th comprises base C and two kinds of situations of base T, when being base C, is normal GADD45A gene, when being base T, be the GADD45A gene of sudden change:
A kind of test kit for detection of ovarian cancer susceptibility, comprise Auele Specific Primer, this primer is a pair of, has the sequence of SEQ ID NO:2 and SEQ ID NO:3, can be specific the primer of amplification GADD45A gene, can amplify specifically length 200～2700bp.
Further, test kit also comprises PCR reaction solution, and PCR reaction solution is by dNTP, Mg
2+, Taq enzyme and Buffer form.In PCR reaction solution, each component is conventional with magnitude relation, for one of ordinary skill in the art, is common practise.
Whether vitro detection sample there is a method for the single nucleotide polymorphism of GADD45A gene, and step is as follows:
(1) with the GADD45A gene of GADD45A gene-specific primer amplification sample, obtain amplified production; Described primer is a pair of, has the sequence of SEQ ID NO:2 and SEQ ID NO:3;
(2) amplified production is carried out to sequencing, detect in amplified production whether have following single nucleotide polymorphism: 1556C>T; The sequence of 1556C>T sudden change Position Number based on SEQ ID NO:1.
The method that individual ovarian cancer susceptibility or ill risk are detected or diagnosed, step is as follows:
Detect this individual GADD45A gene, transcript and/or albumen, and compare with normal GADD45A gene, transcript and/or albumen, there are differences and just show that possibility that this individuality has ovarian cancer is lower than normal population.Described difference refers to whether there is single nucleotide polymorphism: 1556C>T; The sequence of 1556C>T sudden change Position Number based on SEQ ID NO:1.
Molecule marker for detection of ovarian cancer susceptibility of the present invention, test kit and method thereof, and whether vitro detection sample there is the method for the single nucleotide polymorphism of GADD45A gene, detect simple, accurate, quick, high specificity, implements effectively early to examine, early controls with individuation control significant for high risk population or susceptible individual and ovarian cancer patients.
Embodiment
Below in conjunction with embodiment, the present invention is further illustrated.
The detection of embodiment 1GADD45A transgenation and with the association analysis of ovarian cancer
1.1 research object
Choose ovarian cancer patients 139 examples, treatment is made a definite diagnosis in Shandong Qilu Hospital year April in September, 2008～2011, and clinical data obtains from case history.Contrast patient 189 examples of age-matched are the Physical Examination Center Physical Examination women of Shandong hospital.Most subjects is Donors in Shandong Province.Get subject's peripheral blood 1.5ml, in-80 ℃ of stored refrigerated.All subjects all require informed consent according to Ethics Committee of Shandong Qilu Hospital.
1.2DNA extract
By conventional phenol chloroform method, extract experimenter's peripheral blood DNA, specific as follows:
(1) getting 400ul blood is added in 1.5ml centrifuge tube.
(2) add 800ul PBS, mix, 3500g, 15min, abandons supernatant; Come again.
(3) add 400ul lysate, 37 ℃, 1h.
(4) add Proteinase K 4ul, concentration 200ug/ml.
(5) 55 ℃ of water-baths digest spend the night (4-12h).
(6) add the saturated phenol of Tris of 400ul, mix and shake 10min.
(7) 5000g, 15min, water intaking phase.
(8) add 100ul NaAc, 800ul dehydrated alcohol ,-20 ℃, 20min.
(9) 12000g, 5min, abandons supernatant.
(10) 600ul70% ice ethanol, 12000g, 5min, abandons supernatant, repeats once.
(11) 12000rpm is centrifugal, 10 minutes.Abandon supernatant, dry.Be dissolved in 100 μ l TE.
(12) measure concentration and purity, packing, frozen in-80 ℃.
1.3 primers, pcr amplification and order-checking
From GenBank, download GADD45A genome sequence (GenBank sequence; AY135686.1; GI:22122007), with primer premier5.0 design primer.Concrete primer details are in Table 1.
Table 1 primer sequence table
| Primer title | Sequence | SEQ?ID?NO： |
| Upstream primer | 5'AGTTTGCACAGGGCAACTCC3' | 2 |
| Downstream primer | 5'CCTGCTAAAGGAATTAGTCACG3' | 3 |
Pcr amplification condition: 94 ℃ 3 minutes, (94 ℃ 30 seconds, 60 ℃ 30 seconds, 72 ℃ 40 seconds) * 35,72 ℃ 7 minutes, 10 ℃ of insulations.Pcr amplification product is 1255bp.
Pcr amplification product is delivered the order-checking of Shanghai Bo Shang biotech company, sequencing result application software Meglign7.0 and Chromas2.33 test and analyze, this enforcement has adopted backward sequencing, by analysis, finds to exist following SNP:1556C>T.
1.4SNP somatotype and association analysis
Application card side (X
2) check the distribution in subject site is carried out to statistical study; When the expectation number of a cell is less than 5, applying Fisher rigorous examination analyzes.All P values are bilateral probability, think and have remarkable statistical significance when P<0.05.Applying the dependency of unconditional logistic regression analysis between ill to genotype frequency, gene frequency and ovarian cancer assesses, calculate its odds ratio (Odds ratio, OR) and 95% credibility interval (confidence interval, CI), and apply SPSS17.0 software (SPSS Inc.Chicago, Illinois, USA) carry out statistical study.
Found that rs532446 (1556C>T) site and ovarian tumors significant correlation in SEQ ID NO:1, wherein the P value of additive inheritance model (C/C vs.C/T vs.T/T) is 0.03.The P value of dominant inheritance model (C/C+C/T vs T/T) is 0.011(OR=1.228,95%CI[1.043～1.445).The P value of recessive inheritance model (T/T vs T/C+C/C) is 0.144(OR=1.817,95%CI[1.112～2.968]), T allelotrope is tumor susceptibility gene (P=0.0101, OR=1.503,95%CI[1.101～2.053]).Detailed results is in Table 2.
Table 21556C>T loci gene type and the distribution of allelotrope in ovarian cancer group and normal healthy controls group
Embodiment 2 ovarian cancer susceptibility detection kit
Therefore because sudden change and the ovarian cancer of 1556C>T in SEQ ID NO:1 are delivered height correlation, can take again patient's DNA based on this sudden change design GADD45A gene-specific primer and expand detection as template.
Prepare a test kit (100 person-times), it contains material as shown in table 3:
Table 3
Extract experimenter's peripheral blood 2ml, ordinary method is extracted DNA.Utilize ovarian cancer susceptibility detection kit to carry out PCR reaction, reaction product is checked order, utilize Meglign7.0 and Chromas2.33 software test and analyze sequencing result.Experimenter's ovarian cancer susceptibility that detected result contains rs532446 (1556C>T) is higher than normal population.
Should be understood that after having read foregoing of the present invention, those skilled in the art can make various modifications or change to the present invention, but the equivalent form of value of these changes or modification drops in limited range of the present invention equally.
Claims (2)
1. the application of Auele Specific Primer in the test kit for the preparation of identification of ovarian cancer susceptibility, is characterized in that: described Auele Specific Primer is a pair of, and its sequence is as shown in SEQ ID NO:2 and SEQ ID NO:3.
2. application according to claim 1, is characterized in that: in described test kit, except Auele Specific Primer, also comprise PCR reaction solution, PCR reaction solution is by dNTP, Mg
2+, Taq enzyme and Buffer form.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210376555.7A CN102864234B (en) | 2012-09-29 | 2012-09-29 | Molecular marker for identifying susceptibility of ovarian cancer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210376555.7A CN102864234B (en) | 2012-09-29 | 2012-09-29 | Molecular marker for identifying susceptibility of ovarian cancer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102864234A CN102864234A (en) | 2013-01-09 |
| CN102864234B true CN102864234B (en) | 2014-03-19 |
Family
ID=47443359
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210376555.7A Active CN102864234B (en) | 2012-09-29 | 2012-09-29 | Molecular marker for identifying susceptibility of ovarian cancer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102864234B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106434981A (en) * | 2016-11-24 | 2017-02-22 | 深圳市核子基因科技有限公司 | Kit for detecting ovarian cancer susceptibility and SNP (single nucleotide polymorphism) marker thereof |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101998964B (en) * | 2008-02-15 | 2015-05-06 | 太平洋艾瑞有限公司 | Blocking the metastasis of cancer cells and the uses of new compounds thereof |
| GB0905410D0 (en) * | 2009-03-28 | 2009-05-13 | Gentronix Ltd | Genotoxicity testing |
-
2012
- 2012-09-29 CN CN201210376555.7A patent/CN102864234B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| AY135686.1;Rieder, M.J. et el.;《Genebank》;20020805;variaiton 2441 * |
| Rieder, M.J. et el..AY135686.1.《Genebank》.2002, |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102864234A (en) | 2013-01-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11220713B2 (en) | MicroRNAs as biomarkers for endometriosis | |
| JP6720260B2 (en) | Methods and kits for diagnosing a subject at risk of developing cancer | |
| Bauer et al. | Diagnosis of pancreatic ductal adenocarcinoma and chronic pancreatitis by measurement of microRNA abundance in blood and tissue | |
| CN104651521B (en) | Plasma microRNA for early colorectal cancer detection | |
| WO2021037134A1 (en) | Lung adenocarcinoma molecular typing and survival risk factor gene cluster, diagnostic product, and application | |
| US20200308655A1 (en) | Plasma Microribonucleic Acids as Biomarkers for Endometriosis and Endometriosis-Associated Ovarian Cancer | |
| CN106755344B (en) | Molecular marker for pancreatic cancer clinical prognosis diagnosis and application thereof | |
| WO2009133915A1 (en) | Cancer marker, method for evaluation of cancer by using the cancer marker, and evaluation reagent | |
| US20160312301A1 (en) | Microrna biomarkers for ovarian cancer | |
| EP3122905B1 (en) | Circulating micrornas as biomarkers for endometriosis | |
| US20110166041A1 (en) | Diagnosis/Therapeutic Strategy For Gynecological Cancer by Utilizing Micro-RNA as Biomarker | |
| WO2016176446A2 (en) | Colorectal cancer screening method and device | |
| Tao et al. | Identification of circulating microRNA signatures for upper tract urothelial carcinoma detection | |
| MPath et al. | MicroRNA (miRNA) expression profiling of peripheral blood samples in multiple myeloma patients using microarray | |
| CN104962655A (en) | Ovarian cancer susceptibility-related molecular marker as well as detection primer and kit | |
| US20220154291A1 (en) | Detection method | |
| US20130084241A1 (en) | DEVELOPMENT OF miRNA DIAGNOSTICS TOOLS IN BLADDER CANCER | |
| CN109022583A (en) | Hsa_circ_0021977 is preparing the application on Diagnosis of Breast cancer product | |
| CN102864234B (en) | Molecular marker for identifying susceptibility of ovarian cancer | |
| TW201514311A (en) | Method for determining the prognosis of pancreatic cancer | |
| CN102864236B (en) | Molecular marker for detecting susceptibility of ovarian cancer | |
| CN102851388B (en) | Molecular marker for identifying susceptibility of ovarian cancer, kit and identifying method thereof | |
| CN110029165A (en) | A kind of kit marked for detecting the susceptible correlated inheritance of carcinoma of endometrium | |
| CN102994512B (en) | Molecular marker, kit and method for detecting susceptibility of ovarian cancer | |
| CN102994636B (en) | Molecular marker, kit and method for detecting clinical stages of patient with ovarian cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |