CN102978278A - Endogenous non-coding micro RNAs and uses thereof - Google Patents
Endogenous non-coding micro RNAs and uses thereof Download PDFInfo
- Publication number
- CN102978278A CN102978278A CN2011102637307A CN201110263730A CN102978278A CN 102978278 A CN102978278 A CN 102978278A CN 2011102637307 A CN2011102637307 A CN 2011102637307A CN 201110263730 A CN201110263730 A CN 201110263730A CN 102978278 A CN102978278 A CN 102978278A
- Authority
- CN
- China
- Prior art keywords
- mirna
- precursor
- expression vector
- test kit
- purposes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The present invention provides a micro RNA miR-644 and precursor sequences thereof, and uses of the micro RNA and the precursor sequences thereof in the diagnosis, prevention, treatment and/or prognosis for malignant tumors. The micro RNA provided by the present invention is nucleotides containing a nucleotide sequence represented in SEQ ID NO: 1 or functional fragments or variants of biological activity thereof: 5'-AGUGUGGCUUUCUUAGAGC-3'; and the micro RNA precursors are nucleotides containing a nucleotide sequence represented in SEQ ID NO: 3 or functional fragments or variants of biological activity thereof. The micro RNA can be used as a novel pharmaceutical composition for the prophylactic and / or therapeutic treatment of malignant tumors. In addition, the micro RNA can also serve as a new biomarker applied to the diagnosis and / or prognosis assessment of malignant tumors.
Description
Technical field
The invention belongs to the biological medicine engineering field, relate to the little RNAs of a kind of endogenic non-coding and application thereof, be specifically related to a kind of Microrna (microRNA, miRNA) and precursor sequence thereof and they and prevent and/or treat application in the test kit of malignancy disease in preparation.
Background technology
Current malignant tumour is the higher disease of whole world mortality ratio, and the sickness rate of malignant tumour increases year by year, and human health in serious threat.Third National coroner's inquest is the result show, China urban and rural residents mortality of malignant tumors belongs to world's higher level, and be lasting rising tendency, and malignant tumour has become the first cause of the death (25%) of China city resident.The in recent years research of relevant tumor invasion mechanism and treatment and prevention of tumour obtains remarkable progress, but in the world, the control of malignant tumour is still a difficult point in current life science field.
Apoptosis plays a significant role in Tumorigenesis, and the inhibition of apoptosis of tumor cells and the genesis of tumour have close relationship.The gene of many apoptosis involvement regulation and control plays a significant role in the genesis of tumour, and these genes can be used as the action target spot of diagnosing tumor and treatment.Therefore, seek the protein factor, miRNA etc. of apoptosis involvement new in the tumour cell and illustrate its mechanism of action in apoptosis of tumor cells and have extremely important using value.
MicroRNA (miRNA) is the endogenous non-coding little RNA of a class length about 22nt, extensively is present in the multiple organisms such as animal, plant, virus.It mainly by with 3 ' UTR of target gene fully or incomplete pairing, degraded target gene mRNA or suppress its translation, thereby participate in the vital movements such as regulation and control body development, apoptosis, propagation and differentiation, prediction all is the miRNA target gene of guarding above 1/3 Human genome.Experimental evidence shows that miRNA can affect generation and the development of tumour by the signal path of its target gene participation of regulation and control, is bringing into play the function that is similar to oncogene or cancer suppressor gene.The research that is found to be Tumorigenesis of miRNA provides new thinking, for tumor diagnosis and therapy provides new strategy.
Along with the development of science and technology and the conduction of tumour cell signal by way of the deepening continuously of research, become the focus of Effect of Anti tumour medicine as the tumor biotherapy on basis take bio-target molecule.The biotherapy of tumour is replenished with the three large routine treatment effects of Radiotherapy chemotherapy mutually take molecular biology, cytobiology and analysis immunology as the basis, significantly improves the treatment curative effect of tumour.Biotechnology and radiotherapy chemotherapy are combined, introduce the resistance that the molecule of short apoptosis can the reversing tumor cell produces, strengthen tumour cell to the susceptibility of antitumor drug, thereby avoided resistance that traditional radiotherapy chemotherapy method causes and the shortcoming of toxic side effect, reached the effect for the treatment of tumour.This area is in the urgent need to understanding the relevant factor of short apoptosis of tumor cells, its target molecule as pharmacological agent is applied in the clinical treatment, therefore seek the factor and the radiotherapy chemotherapy combined treatment tumor disease relevant with short apoptosis of tumor cells, have broad prospects.
Summary of the invention
The purpose of this invention is to provide a kind of new Microrna with short apoptosis of tumor cells function is miR-644, this miRNA is one section endogenous miRNA in the organism, have the function that promotes apoptosis of tumor cells, in the experiment of tumor models and nude mice lotus knurl model, all strengthened the result for the treatment of of Zorubicin to tumour cell.
For above-mentioned technical purpose, technical scheme of the present invention is as follows:
On the one hand, the invention provides a kind of Microrna for the preparation of the medicine of prevention, treatment and/or prognosis evaluation malignant tumour or the purposes in the test kit, wherein said Microrna is miR-644 and precursor sequence thereof.
Preferably, the sequence of described miRNA-644 is Nucleotide or its bioactive functions fragment or the variant that comprises the nucleotide sequence shown in the following SEQ ID NO:1:
5′-AGUGUGGCUUUCUUAGAGC-3′。
Preferably, the sequence of described miRNA-644 precursor is to comprise the Nucleotide of the nucleotide sequence shown in the following SEQ ID NO:3 or fragment or the variant of its bioactive functions:
5′-UUUUUUUUUAGUAUUUUUCCAUCAGUGUUCAUAAGGAA
UGUUGCUCUGUAGUUUUCUUAUAGUGUGGCUUUCUUAGAGCAAA
GAUGGUUCCCUA-3′。
Preferably, the sequence of described miRNA-644 has been carried out thio-modification, methoxy is modified or cholesterol is modified.
Preferably, the sequence of described miRNA-644 or its precursor contains the expression vector of miRNA-644 or its precursor sequence by changing known expression vector establishment over to, and the expression vector that contains miRNA-644 or its precursor sequence that will make up changes the expressing viral acquisition over to.
Preferably, described known expression vector is pSilencer Adeno CMV1.0 shuttle vectors (pSilencer Adeno CMV1.0shuttle vector), and described virus is adenovirus.
On the other hand, the invention provides a kind of pharmaceutical composition be used to preventing and/or treating malignant tumour, it comprises above-mentioned miR-644 and precursor sequence and pharmaceutically acceptable virus, carrier or the auxiliary material for the treatment of significant quantity, and wherein said Microrna is nucleic acid or its bioactive functions fragment or the variant that comprises following SEQ ID NO:1 sequence: 5 '-AGUGUGGCUUUCUUAGAGC-3 '.
Preferably, described pharmaceutically acceptable carrier or auxiliary material are selected from plasmid expression vector, virus, chitosan, cholesterol, liposome, nano particle etc.
Preferably, the administering mode of described pharmaceutical composition is oral administration or drug administration by injection; More preferably, described drug administration by injection mode is selected from intravenous injection, intramuscular injection, direct tumour intratumor injection etc.
Another aspect, the present invention also provides a kind of test kit for the prognosis evaluation malignant tumour, and described test kit comprises probe or the primer for the above-mentioned miR-644 of specific detection.
Preferably, the probe that comprises in the described test kit or primer have the nucleotide sequence shown in the following SEQ ID NO:4:
5′-GCTCTAAGAAAGCCACACT-3′。
In sum, the inventor is by a large amount of experimental results show that, miRNA-644 (5 '-AGUGUGGCUUUCUUAGAGC-3 ') improve tumour cell to the susceptibility of chemotherapeutics by inducing apoptosis of tumour cell, in tumor prevention, treatment and prognosis evaluation, have important using value.
Process through the chemotherapeutics Zorubicin, miRNA-644 expresses significantly and raises in the tumour cell, and the rise of miRNA-644 may participate in the generation of apoptosis of tumor cells.Cross in the tumour cell and express the generation that miRNA-644 can inducing apoptosis of tumour cell.MiRNA-644 is combined with suitable carrier forms medicine, import in tumor locus or the body, will have prevention and therapeutic action to malignant tumor patient.The contriver can cross adenovirus infection gastric cancer SGC-7901 cell line system and the cancer Hela cells of expressing miRNA-644 by making up, find that miRNA-644 can induce two kinds of tumor cell line apoptosis, proved that at cell levels miRNA-644 reaches the latent effect for the treatment of tumour by inducing apoptosis of tumour cell.Expression by miRNA-644 antisense oligonucleotide inhibition miRNA-644 can suppress the apoptosis of tumor cells that Zorubicin is induced.Nude mice by subcutaneous inoculated tumour cell, inoculation position is injected the miRNA-644 stand-in simultaneously, can significantly suppress the nude mice by subcutaneous tumor growth.Potential prevention, the therapeutic action of miRNA-644 have also been proved in the whole animal level.
Cross expression miRNA-644 in the tumour cell, use the Zorubicin than low dosage to get final product inducing apoptosis of tumour cell, improved the susceptibility of tumour cell to medicine, in oncotherapy, can overcome toxic side effect and the chemical sproof formation of chemotherapeutics.
Therefore, the invention provides miRNA-644 and precursor thereof are become medicine with suitable packaging shapes such as carrier or auxiliary material such as eukaryotic gene expression vector, adenovirus, chitosan, cholesterol, liposome, nano particle, mode by oral, intravenous injection, intramuscular injection or direct tumor locus injection is used for preventing and/or treating malignant tumour.
Description of drawings
Below, describe by reference to the accompanying drawings embodiment of the present invention in detail, wherein:
Fig. 1 is the experimental result synoptic diagram that Zorubicin is processed the variation of miRNA-644 expression level in the inducing apoptosis of tumour cell process; Wherein Figure 1A is miRNA-644 expression level experimental result synoptic diagram in the SGC-7901 tumour cell; Figure 1B is miRNA-644 expression level experimental result synoptic diagram in the Hela tumour cell;
Fig. 2 changes the experimental result synoptic diagram that the rear miRNA-644 of virus expresses over to after miRNA-644 crosses expression adenovirus construction carrier; Wherein Fig. 2 A is the synoptic diagram that contains the pSilencer Adeno CMV1.0 shuttle vectors of miRNA-644; Fig. 2 B is the electrophorogram of the positive colony of the PCR checking pSilencer Adeno CMV1.0 shuttle vectors that obtains to contain miRNA-644, and 1 be dna marker (DNA Marker) among the figure, the 2 miRNA-644 fragments for amplification acquisition 610bp; Fig. 2 C is miRNA-644 adenovirus infection SGC-7901 tumour cell miRNA-644 expression level test experience result schematic diagram; Fig. 2 D is miRNA-644 adenovirus infection Hela tumour cell miRNA-644 expression level test experience result schematic diagram;
Fig. 3 expresses the experimental result synoptic diagram that miRNA-644 can inducing apoptosis of tumour cell for crossing by adenovirus; Wherein Fig. 3 A is the experimental result synoptic diagram of SGC-7901 apoptosis of tumor cells; Fig. 3 B is the experimental result synoptic diagram of apoptosis in the Hela tumour cell;
Fig. 4 expresses the experimental result synoptic diagram that miRNA-644 can inducing apoptosis of tumour cell for crossing by the miRNA-644 stand-in of transfection synthetic; Wherein Fig. 4 A, 4B are SGC-7901 tumour cell and Hela tumour cell transfection miRNA-644 stand-in after 24 hours, and real time fluorescence quantifying PCR method detects the result schematic diagram of miR-644 expression level; Fig. 4 C, 4D are the experimental result synoptic diagram of apoptosis of tumor cells behind SGC-7901 and the Hela tumour cell transfection miRNA-644 stand-in;
Fig. 5 is the growth curve that nude mice by subcutaneous inoculated tumour position injection miRNA stand-in lump forms;
Fig. 6 is for expressing by miRNA-644 in the miRNA-644 antisense oligonucleotide inhibition tumor cell, the experimental result synoptic diagram that the apoptosis susceptibility that tumour cell is induced Zorubicin strengthens, after wherein Fig. 6 A is Hela cell transfecting miRNA-644 antisense oligonucleotide, the experimental result synoptic diagram of the expression of miRNA-644; Fig. 6 B is after suppressing endogenous miRNA-644, the experimental result synoptic diagram of the apoptosis situation of Hela cell under the effect of low dosage Zorubicin.
Embodiment
Referring to specific embodiment the present invention is described.It will be appreciated by those skilled in the art that these embodiment only are used for explanation the present invention, the scope that it does not limit the present invention in any way.
2uM Zorubicin treatment S GC-7901 and Hela tumour cell (all available from Chinese Academy of Sciences's Shanghai cell bank) 3h is used respectively in this experiment, 6h, 12h, collecting cell behind the 24h, extract total RNA with Trizol, the method of employing real-time fluorescence quantitative PCR detects the expression level of miR-644, and the expression of observing miR-644 in the process of Zorubicin processing tumour cell changes.As shown in Figure 1, along with Zorubicin treatment S GC-7901 and the increase of Hela tumour cell time, the expression level of miR-644 all presents the trend of obvious rising in two kinds of tumour cells.
The structure of embodiment 2miRNA-644 adenovirus
Adopt the pSilencer Adeno 1.0-CMV carrier system of Ambion company to make up miRNA-644 over-express vector or adenovirus.Make up respective carrier and adenovirus according to company's specification sheets.
Take the rat gene group as template, each sequence of 300 bp nearly of pcr amplification miRNA-644 and upstream and downstream two ends thereof, amplification obtains the about 600bp of segment (SEQ ID NO:2, as follows), and amplimer is as follows:
F：5′-CTAGTGTTTCCTATCCCTGTTGTG-3′(SEQ?ID?NO：7)；
R：5′-GGTAATGATGTGGTGTAAGTCCTG-3′(SEQ?ID?NO：8)。
The amplified fragments sequence is as follows:
CTAGTGTTTCCTATCCCTGTTGTGGAGTGTTTTATCATGAAAGTGTATTAAATTTTG
TAAAATCCTTTTTTGGTATCAATTGAGATGATCATGTGATTTTTTTCCCCCCCTCAT
TCTGTTAATGTGGTATATTATGTTGATTTTTCATAGGTTGAACCTTTTTTGCATTCC
AGGAATAAATCCTACTTAGTCAAAAGGATTAAAGTGTGCTTTTAATATGCTGCTGA
GATTTTTTTGCTGATTTTTTTTTAGTATTTTTCCATCAGTGTTCATAAGGAATGTTGC
TCTGTAGTTTTCTTATAGTGTGGCTTTCTTAGAGCAAAGATGGTTCCCTATTACTTT
CTAATTTTATACTTCTACACATTAACAACTTTTATATTTAAAGCAGAAACTGGAAA
ATCAGGCCAATTTGGTATTAATGAAATTACAGAGGTAATTTAGATATGGGAATAA
ATTACCGATAATATTATTCTATCATTCATTTTAGTTACAATAAGTTTGGGTGCATAT
AATAGAAAACACTAAAATAATAGTGGTTTATGTAAGATAGAAGTGTATTTGTCCCC
ATTATTTAAAAATAGTCCAGCAGGACTTACACCACATCATTACC
The segment that amplification obtains is cloned into the T carrier, and subclone enters pSilencer Adeno CMV1.0 shuttle vectors (pSilencer Adeno CMV1.0shuttle vector), obtains to contain the carrier (such as Fig. 2 A) of miRNA-644.Obtain to contain the clone of miRNA-644 carrier by PCR and sequence verification, PCR the results are shown in Figure 2B.This carrier of Pac I linearization for enzyme restriction and adenovirus skeleton (Adenovirus LacZ Backbone), cotransfection HEK-293 cell (available from U.S. ATCC), encapsidated adenovirus virus, virus is collected in amplification, measures virus titer.Real-time quantitative PCR (Real-time PCR) is identified the expression of miRNA-644.
The miRNA-644 mutant virus makes up: miR-644pSilencer Adeno CMV1.0 shuttle vectors is suddenlyd change by the method for site-directed point mutation, and ((Stratagene company) carries out site-directed point mutation by QuikChange rite-directed mutagenesis test kit for four bases of miRNA-644 sequence, concrete grammar reference reagent box description operation), mutant primer is as follows, and the base of sudden change is drawn horizontal line and marked:
5′-GCTCTGTAGTTTTCTTATAGT
TGACCTTTCTTAGAGCAAAGATGG-3′(SEQ?ID?NO：5)
5′-CCATCTTTGCTCTAAGAAAG
GTCAACTATAAGAAAACTACAGAGC-3′(SEQ?ID?NO：6)。
MiR-644pSilencer Adeno CMV1.0 shuttle vectors after obtaining suddenling change makes up miRNA-644 mutant adenovirus according to above-mentioned identical method.Virus all is dissolved in serum free medium, and-80 ℃ store for future use.
With miRNA-644 adenovirus infection SGC-7901 and Hela tumour cell, after 24 hours, collecting cell, extract RNA, Real-time PCR detects the miRNA-644 expression level, and the result shows that the cell miRNA-644 expression amount that infects the miRNA-644 adenovirus obviously raises, and the cell miRNA-644 expression of infection miRNA-644 mutant virus does not change, (such as Fig. 2 C, 2D).
With miRNA-644 adenovirus infection SGC-7901 and Hela tumour cell, adenovirus infection 12, after 24,36,48 hours detects the apoptosis situation by the terminal breach labelling method of original position (TUNEL).As shown in Figure 3, cross and to express SGC-7901 and Hela tumour cell behind the miRNA-644 and all have apoptosis to occur along with the prolongation of time.
Embodiment 4miRNA-644 stand-in are crossed expression miRNA-644 and can be withered by inducing tumor cell
Die
(stand-in are synthetic in Shanghai Ji Ma company with the miRNA-644 stand-in of SGC-7901 and Hela tumour cell transfection synthetic, be 2 '-oligonucleotide sequence that methoxy is modified, its sequence is SEQ ID NO:1), after the transfection 12,24,48 hours, detect the apoptosis situation by the terminal breach labelling method of original position (TUNEL).As shown in Figure 4, cross and to express SGC-7901 and Hela tumour cell behind the miRNA-644 and all have apoptosis to occur along with the prolongation of time.
It is bent that embodiment 5 nude mice by subcutaneous inoculated tumour positions injection miRNA stand-in lump forms growth
Line
Cultivate the Hela tumour cell, trysinization collecting cell, inoculation 1 * 10
7Cell is subcutaneous in athymic BALB/c nude mice (available from Beijing dimension tonneau China animal experimentation on animals company limited) back.Behind the inoculating cell 3 days, in inoculation position injection miRNA-644 stand-in (same with the miRNA-644 stand-in among the embodiment 4) (stand-in are synthetic in Shanghai Ji Ma company), injection miRNA stand-in negative control is organized in contrast.Every group of 6 BALB/c nude mices are tested, measured the knurl block size every 3 days behind the inoculated tumour cell, in 4 weeks of Continuous Observation, by formula: the lump volume is calculated in long * wide 2/2, draw tumor growth curve, observe miR-644 on the nude mice level on swollen neoplastic impact.As shown in Figure 5, the nude mice tumor growth of injection miRNA-644 is slow than control group, becomes the knurl small volume.
Cross expression miRNA-644 in embodiment 6 tumour cells, tumour cell is induced Zorubicin
Apoptosis susceptibility strengthens
SGC-7901 and Hela tumour cell infect miRNA-644 adenovirus and mutant virus thereof, infect after 24 hours, use the Zorubicin (0.2 μ M) of low dosage to process cell, detect the apoptosis situation by the terminal breach labelling method of original position (TUNEL) after 24 hours.As shown in Figure 6, use Zorubicin (0.2 μ M) treatment S GC-7901 and the Hela tumour cell of low dosage, apoptosis of tumor cells is not too obvious.After crossing expression miRNA-644, then can obviously promote the generation of apoptosis of tumor cells with the Zorubicin of this dosage, namely cross and express the susceptibility that miRNA-644 can increase the apoptosis of tumor cells that Zorubicin induces.
Claims (9)
1. a human miRNAs-644 and precursor thereof are for the preparation of the pharmaceutical composition of diagnosis, prevention, treatment and/or prognosis evaluation malignant tumour or the purposes in the test kit.
2. purposes according to claim 1 is characterized in that, described miRNA-644 is Nucleotide or its bioactive functions fragment or the variant that comprises the nucleotide sequence shown in the following SEQ ID NO:1:
5′-AGUGUGGCUUUCUUAGAGC-3′。
3. purposes according to claim 1 is characterized in that, the sequence of described miRNA-644 precursor is to comprise the Nucleotide of the nucleotide sequence shown in the following SEQ ID NO:3 or fragment or the variant of its bioactive functions:
5′-UUUUUUUUUAGUAUUUUUCCAUCAGUGUUCAUAAGGA
AUGUUGCUCUGUAGUUUUCUUAUAGUGUGGCUUUCUUAGAGCAA
AGAUGGUUCCCUA-3′。
4. according to claim 1 to 3 each described purposes, it is characterized in that the sequence of described miRNA-644 has been carried out thio-modification, methoxy is modified or cholesterol is modified.
5. according to claim 1 to 4 each described purposes, it is characterized in that, described miRNA-644 or its precursor contain the expression vector of miRNA-644 or its precursor by changing known expression vector establishment over to, and the expression vector that contains miRNA-644 or its precursor that will make up changes the expressing viral acquisition over to.
6. purposes according to claim 5 is characterized in that, described known expression vector is pSilencer Adeno CMV1.0 shuttle vectors, and described virus is adenovirus.
7. pharmaceutical composition that is used for preventing and/or treating malignant tumour, described pharmaceutical composition comprises human miRNAs-644 and precursor and pharmaceutically acceptable virus, carrier or the auxiliary material for the treatment of significant quantity, and wherein said Microrna is nucleic acid or its bioactive functions fragment or the variant that comprises following SEQ ID NO:1 sequence: 5 '-AGUGUGGCUUUCUUAGAGC-3 ';
Preferably, described pharmaceutically acceptable virus, carrier or auxiliary material all are selected from adenovirus, slow virus, plasmid expression vector, chitosan, cholesterol, liposome and nano particle.
8. test kit that is used for diagnosis and/or prognosis evaluation heart disease, described test kit comprises for the probe of specific detection human miRNAs-644 or primer.
9. test kit according to claim 8 is characterized in that, the probe that comprises in the described test kit or primer have the nucleotide sequence shown in the following SEQ ID NO:4:
5′-GCTCTAAGAAAGCCACACT-3′。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110263730.7A CN102978278B (en) | 2011-09-07 | 2011-09-07 | Endogenic non-coding tiny RNA s and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110263730.7A CN102978278B (en) | 2011-09-07 | 2011-09-07 | Endogenic non-coding tiny RNA s and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102978278A true CN102978278A (en) | 2013-03-20 |
| CN102978278B CN102978278B (en) | 2016-09-28 |
Family
ID=47852612
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110263730.7A Active CN102978278B (en) | 2011-09-07 | 2011-09-07 | Endogenic non-coding tiny RNA s and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102978278B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007112754A2 (en) * | 2006-04-03 | 2007-10-11 | Santaris Pharma A/S | Pharmaceutical compositions comprising anti-mirna antisense oligonucleotides |
| CN101386848A (en) * | 2008-08-12 | 2009-03-18 | 南京大学 | MiRNA with cell corpuscule as vector and preparation research approach thereof and application |
-
2011
- 2011-09-07 CN CN201110263730.7A patent/CN102978278B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007112754A2 (en) * | 2006-04-03 | 2007-10-11 | Santaris Pharma A/S | Pharmaceutical compositions comprising anti-mirna antisense oligonucleotides |
| CN101386848A (en) * | 2008-08-12 | 2009-03-18 | 南京大学 | MiRNA with cell corpuscule as vector and preparation research approach thereof and application |
Non-Patent Citations (1)
| Title |
|---|
| JORDAN M. CUMMINS等: "The colorectal microRNAome", 《PROC.NATL.ACAD.SCI. U.S.A.》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102978278B (en) | 2016-09-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105079821A (en) | Application of long noncoding RNA HNF1A-AS1 ((hepatocyte nuclear factor-1Alpha Antisense 1) in preparation of drugs for treating human malignant solid tumors | |
| CN102453713B (en) | HULC siRNA and use of HULC siRNA in preparation of drugs for treatment of liver cancer | |
| CN106701900A (en) | Long-chain noncoding RNA HERC2P3 gene and application thereof in gastric cancer | |
| CN107760784A (en) | Circular rna circ FOXP1 purposes | |
| CN107630092A (en) | The 3p of miR 505 are applied to diagnosis, prognosis and the treatment of prostate cancer with osseous metastasis | |
| CN107828888A (en) | Circular rna circ PTPRA purposes | |
| CN104498500A (en) | Aptamer for recognizing adriamycin-resistant breast cancer cells as well as screening method and application of aptamer | |
| CN105861551B (en) | The carrier and its construction method of Combined expression microRNAs inhibition Cells Proliferation of Human Breast Cancer and application | |
| CN104721811B (en) | Application of the polypeptide in preventing and treating glioma medicine is prepared | |
| CN106929577A (en) | A kind of lncRNA biomarker related to adenocarcinoma of lung | |
| CN106244590B (en) | Modified siRNA molecule, RNAi molecule mixture and its application | |
| CN111041001B (en) | Safe coxsackie virus for treating KRAS mutant tumor and pharmaceutical composition thereof | |
| CN110423812A (en) | Skiv2l2(MTR4) purposes of the gene in oncotherapy | |
| CN102978278A (en) | Endogenous non-coding micro RNAs and uses thereof | |
| CN106995857A (en) | Applications of the biomarker ENSG00000267416 in cancer | |
| CN104357451B (en) | For the siRNA of DD3 gene and expression vector establishment thereof and application | |
| CN105087418B (en) | Salmonella strains, its preparation method and the application disturbed for RNA in mammalian cell | |
| CN106729756A (en) | Application of the biomarker as target in adenocarcinoma of lung diagnosis and treatment | |
| CN101596316A (en) | Express recombinant adenovirus and the application in oncotherapy and prevention thereof of FoxM1siRNA | |
| CN109224076B (en) | Gene miR-140-3P related to lung cancer diagnosis and treatment, and mimics and application thereof | |
| CN108283646A (en) | Hsa-miRNA-155-5p is preparing the application in inhibiting human enterovirus 71 drug | |
| CN101096670A (en) | siRNA interfering human a-fetoprotein gene and recombinant adenovirus | |
| CN104531711A (en) | LNA oligonucleotide with anti-tumor and radiotherapy sensitization effects and based on competitive endogenesis RNA mechanism | |
| CN104922697B (en) | Reduce pyridoxine phosphate oxidation enzyme treatment oophoroma | |
| CN109061193A (en) | Glycosylate purposes of the dependent cell adhesion molecule 1 as antitumor drug resistance target spot |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |