CN102978233A - Rhizopus nigricans hypha liposome direct transformation method - Google Patents

Abstract

The invention relates to a rhizopus nigricans hypha liposome direct transformation method. The method includes the steps of transformation of rhizopus nigricans hypha liposome and subculture. The steps of the transformation of the rhizopus nigricans hypha liposome comprise firstly mixing the tender rhizopus nigricans hypha and mannitol water solutions, grinding and obtaining bacterium suspension for use; secondly uniformly mixing liposome 2000 and plasmid pEGFP-C1, standing 15-60 minutes at the temperature of -5-5 DEG C, then transferring the mixture to the bacterium suspension, uniformly mixing, and standing 15-60 minutes at the temperature of -5-5 DEG C; and thirdly coating the mixing liquid obtained from the second step on a potato dextrose agar (PDA) plate, and cultivating the mixing liquid for 1-5 days at the temperature of 25-30 DEG C. The steps of the subculture comprise picking transformant which is provided with fluorescent though detection of a fluorescent microscope in the third step, inoculating the transformant onto the PDA plate to cultivate the transformant for 1-5 days at the temperature of 25-30 DEG C, and carrying out the subculture for 5-8 times. The method is easy and convenient to carry out, and high in conversion rate, transformant genetic stability is achived, protoplast is needless to be prepared, and complicated devices are needless.

Description

The direct method for transformation of a kind of bread mould mycelia liposome

Technical field

The invention belongs to liposome transformation technology field, be specifically related to the direct method for transformation of a kind of bread mould mycelia liposome.

Background technology

At present, the filamentous fungus genetic transforming method mainly contains the protoplast transformation method of protoplastis electrotransformation, via Particle Bombardment Transformation method, Lithium Acetate mediated transformation method, Agrobacterium_mediated method, PEG mediation and protoplastis liposome conversion method etc.The shortcomings such as these method ubiquity complex operations, device complexity, low conversion rate, transformant are unstable.Need to prepare protoplastis such as some, preparation process is complicated, comprises protoplast transformation method and the protoplastis liposome conversion method of protoplastis electrotransformation, PEG mediation.Some method does not need to prepare protoplastis, but device is complicated, the conversion cost is high, such as the via Particle Bombardment Transformation method.The conversion that only only limits to a few species filamentous fungus that has is such as Lithium Acetate mediated transformation method.The transformation efficiency that has is unstable, and transformation efficiency is subjected to the impact of many factors, is subjected to the impact of agrobacterium strains type, plasmid vector type and the many factors such as match condition, medium component and inductive condition between the two such as Agrobacterium-mediated Transformation method transformation efficiency.

Summary of the invention

The object of the invention is to overcome the prior art deficiency, provides a kind of bread mould mycelia liposome direct method for transformation, and the method is easy, quick, transformation efficiency is high, the transformant inheritance stability, does not need to prepare protoplastis, does not need complex appts.

For achieving the above object, the present invention adopts following technical scheme:

The direct method for transformation of a kind of bread mould mycelia liposome, it may further comprise the steps:

One) bread mould mycelia liposome transforms:

1) the wet mycelia of the tender bread mould of children is mixed rear the grinding with Osmitrol, get bacteria suspension, for subsequent use;

2) with liposome 2000 and plasmid pEGFP-C1 mixing, in-5-5 ℃ placement 15-60min, then be transferred in the bacteria suspension, mixing, in-5-5 ℃ placement 15-60min;

3) with step 2) the gained mixed solution smears the PDA flat board, cultivated 1-5 days for 25-30 ℃;

Two) cultivation of going down to posterity:

4) the picking step 3) detects transformant with fluorescence through fluorescent microscope and is inoculated on the PDA flat board 25-30 ℃ and cultivated 1-5 days, goes down to posterity altogether and cultivates 5-8 time.

Preferably, described step 1) is specially: get the wet mycelia of the tender bread mould of 0.05-0.2g children and mix with the Osmitrol of 0.5-2ml, concentration 0.5-1.0mol/l.

Described step 2) is specially: get 30-100 μ l liposome 2000 and 30-100 μ l plasmid pEGFP-C1 mixing.

Be compared with existing technology, the direct method for transformation of bread mould mycelia liposome of the present invention has easy, quick, and transformation efficiency is high, the transformant inheritance stability, and do not need to prepare protoplastis, do not need the advantages such as complex appts.As selective marker, can directly carry out somatoscopy with green fluorescence protein gene, need not add the alternative medicines such as other microbiotic, and can be used for easily the elimination of monitoring transformant selectable marker gene.

Description of drawings

Fig. 1 is that the bread mould liposome transforms GFP gene by fluorescence detection (magnification 10 * 20);

Fig. 2 is the total DNA electrophorogram of bread mould transformant; G1, G2, G3, G4, G5, G6 are the six generation bread mould spore mycelia DNA that go down to posterity after transforming, and M is the hind-III, and total genome is approximately 20kbp;

Fig. 3 is that PCR detects GFP gene electrophorogram among the total DNA of bread mould transformant; G1, G2, G3, G4, G5, G6 for after transforming six generation the bread mould spore total Genomic PCR amplification of the mycelia GFP gene electrophorogram that goes down to posterity, M is 1kb plus;

Fig. 4 is bread mould transformant southern results of hybridization; CK is unconverted bread mould mycelia genome, G1, G2, G3, G4, G5, G6 for after transforming six generation the bread mould spore go down to posterity the mycelia genome through Sac I single endonuclease digestion after southern hybridization figure.

Embodiment

The present invention is further illustrated by the following examples, but protection scope of the present invention is not limited to this.

Embodiment 1

One, experiment material

1. bacterial classification and plasmid rhizopus stolonifer (bread mould) Rhizopus stolonifer

Bread mould (Rhizopus stolonifer) is available from Institute of Microorganism, Academia Sinica China common micro-organisms preservation administrative center, and numbering is 3.4098.Plasmid pEGFP-C1 is by Zhengzhou University's Cell Biology Experiment chamber present.

2. substratum

PDA substratum (1L): potato 200g(peeling stripping and slicing adds water boil 15 minutes and gets filtrate with four layers of filtered through gauze), agar (Agar) 20g, glucose 20g, water is supplied 1000ml, high pressure steam sterilization after the packing.

3. liposome

Liposome 2000(Lipofectamine 2000), Invitrogen, Carlsbad, California, USA.

Two, experimental technique

The direct method for transformation of a kind of bread mould mycelia liposome, it may further comprise the steps:

One) bread mould mycelia liposome transforms:

1) get the wet mycelia of the tender bread mould of 0.1g children in the mortar of the bacterium of going out, add the Osmitrol of 1ml, concentration 0.6mol/l, grind after mixing, get bacteria suspension, be transferred in the 1.5ml centrifuge tube, for subsequent use;

2) get 50 μ l liposomes 2000 and 50 μ l plasmid pEGFP-C1 mixings, in 0 ℃ of placement 30min, then be transferred in the bacteria suspension, mixing in 0 ℃ of placement 30min, gets mixed solution;

3) get 100 μ l steps 2) the gained mixed solution smears PDA flat board (smearing altogether 10 flat boards), cultivated 2 days for 28 ℃;

Two) cultivation of going down to posterity:

4) the picking step 3) is inoculated in the dull and stereotyped upper 28 ℃ of cultivations of PDA 3 days through the transformant that fluorescent microscope detects with fluorescence, goes down to posterity altogether and cultivates 6 times.

PCR to transformant detects

(1) design of primers

Auele Specific Primer according to goal gene EGFP sequences Design among the pEGFP-C1:

GFP-S atggtgagcaagggcgaggagc

GFP-X ttatctagatccggtggatccc

(2) utilize the CTAB method to extract the total DNA of bread mould transformant

(3) pcr amplification of goal gene (being fluorescence protein gene-GFP gene)

Bread mould genome after going down to posterity take conversion is template, and the PCR reaction system is as follows, cumulative volume 25 microlitres:

DNA 1μl

dNTP mixture 4μl

Upstream primer GFP-S (25mM) 0.5 μ l

Downstream primer GFP-X (25mM) 0.5 μ l

10×LA PCR Buffer (Mg2+Plus) 2.5μl

TaLaRa LA Taq(5u/ul) 0.5μl

ddH ₂O 16μl

The pcr amplification program is as follows: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 55 ℃ of annealing 40s, 72 ℃ are extended 1min, 30 circulations; 72 ℃ are extended 10min.

After the PCR reaction finishes, get 5 μ lPCR reaction solutions and carry out electrophoresis detection (the results are shown in Figure 2 and 3) with 1.0% sepharose.

Hybridization check

(1) the recovery purifying of PCR product

1) with PCR product electrophoresis in 1% sepharose, use the AxyPrep dna gel to reclaim test kit and reclaim goal gene, concrete operation step is with reference to as follows:

2) under ultraviolet lamp, downcut the sepharose that contains target DNA, exhaust gel surface liquid and chopping with paper handkerchief.Calculated for gel weight (recording in advance 1.5 ml centrifuge tube weight), this weight is as a gel volume (such as 100 mg=100 μ l volumes)

3) the Buffer DE-A of 3 gel volumes of adding in 75 ° of C heating, is interrupted and mixes (every 2-3 min), until gel piece melts (about 6-8 min) fully after mixing.

4) add the Buffer DE-B of 0.5 Buffer DE-A volume, mix; When the DNA fragment of separating during less than 400bp, add the Virahol of 1 gel volume.

5) mixed solution in the absorption 3 is transferred to DNA preparation pipe (placing 2 ml centrifuge tubes), centrifugal 1 min of 12000g.Abandon filtrate.

6) will prepare pipe and put back centrifuge tube, and add 0.5 ml Buffer W1, centrifugal 30 s of 12000g abandon filtrate.

7) will prepare pipe and put back centrifuge tube, and add 0.7 ml Buffer W2, centrifugal 30 s of 12000g abandon filtrate, wash centrifugal 1 min of 12000g with 0.7 ml Buffer W2 again with same method.

8) will prepare pipe and place 2 ml centrifuge tubes, centrifugal 1 min of 12000g.

9) will prepare pipe and place 1.5 clean ml centrifuge tubes, and prepare the film centre at DNA and add 25-30 μ l water or Eluent, room temperature leaves standstill 1 min.The centrifugal 1 min eluted dna of 12000g.

10) get an amount of electrophoresis detection organic efficiency.

(2) Southern hybridization check

Use efficient DNA digoxigenin labeled and detection kit I(DIG-high prime DNA labeling and detection Starter kit I, available from U.S. Luo Shi (Roche) company), operation steps following (but concrete reference reagent box specification sheets):

1) the CTAB method is extracted the head mold genomic dna, and with Sac I single endonuclease digestion 5-10 μ g head mold genomic dna, 50 μ l systems, minute 5 pipes, 37 ℃ of enzymes that spend the night are cut 12h;

2) ethanol precipitation, concentration of DNA behind the complete degestion, is cut liquid merging, constant volume with 5 pipe enzymes, adds 1/5 volume 5M NaCl (50 μ l), 2 times of volume dehydrated alcohols (500 μ l); After-20 ℃ of sedimentations, the centrifugal supernatant that goes, 70% washing with alcohol once, room temperature was placed several minutes, after the alcohol volatilization, added the dissolving of 25 μ l sterilized waters, NanoDrop ND1000 UV spectrophotometer measuring concentration, control DNA concentration is about 0.5 μ g/ μ l;

3) electrophoresis: each sample is got 10 μ l application of samples, 1.0% sepharose, and 60 volts of voltages, electrophoresis 4h takes pictures;

4) DNA sex change: excise unnecessary gel and make marks at one jiao, gel is dipped in 15min in the ealkaline buffer, and gently vibration; Change liquid once, continue to soak 20min;

5) nylon membrane is prepared: clip one positively charged nylon membrane, every limit be than the large 1mm of gel, and making marks with the same angle of gel, soak 5min in transfering buffering liquid;

6) capillary tube technique transferring film trace upwards: put into a upholder in glass dish, filter paper is placed support surface, the filter paper two ends are sagging, pour alkaline transfering buffering liquid into, and liquid level is concordant with upholder; With the gel upset, the bottom surface is placed on the filter paper up, guarantees between gel and filter paper without bubble; The positively charged nylon membrane is placed on the gel, make two marks overlapping, then put into two moistening filter paper and a folded thieving paper, thickness 5-8cm puts into about 400g weight again, shifts 16h, takes off nylon membrane;

7) DNA fixes: nylon membrane is immersed in the neutralization buffer, and room temperature is placed 15min, takes out to place on the dry filter paper, with UV-crosslinked method fixed dna, ultra violet lamp 5min;

8) preparation probe: probe is take plasmid pEGFP-C1 as template, the PCR product that utilizes probe primer GFP-S atggtgagcaagggcgaggagc and GFP-X ttatctagatccggtggatccc amplification to obtain, recovery is by boiling water boiling 10min, centrifugal after the cooling rapidly, get 4 μ l, add 1 μ l DIG mark enzyme mixture by the explanation of DIG High Prime DNA Labeling and Detection Starter Kit test kit, after mixing in 37 ℃ spend the night (16h), finish put behind the mark-20 ℃ for subsequent use.

9) hybridization

Prehybridization: the nylon membrane in connection with DNA soaks 2min in 6 * SSC solution; Film is put into hybridization bag, add test kit prehybridization solution DIG EasyHyb, extrude air, sealing, 42 ℃ of water-bath 1h;

Probe is prepared: get 2 μ l probes, be added in the PCR pipe that 100 μ l hybridization solution DIG EasyHyb are arranged approximately, lid is buckled, and caping is put in boiling water heating 5min with pinprick, is put into rapidly cooled on ice, adds the hybridization solution of an amount of preheating again;

Hybridization: hybridization bag is taken out from water-bath, pour out prehybridization solution; The dna probe of sex change is added among an amount of prehybridization solution DIG EasyHyb, and changes solution over to hybridization bag, extrude air, sealing is spent the night at 42 ℃ of shaking baths (hybrid heater);

Wash film: take out Hybond membrane from hybridization bag, with containing in a large number 2 * SSC and 0.1% SDS solution washes twice in room temperature, each 5min washes twice, each 15min with the solution that contains 0.5 * SSC and 0.1%SDS in 65 ℃ again.With washings rinsing film 3-5min;

Sealing: use 10mL test kit confining liquid Blocking Solution in room temperature incubation 30min, bathe 30min with enzyme len antibody solution anti-DIG-AP solution in the room temperature temperature afterwards, wash twice with washings again, each 15min, then balance 2-5min in detecting liquid;

10) colour developing: add the NBT/BCIP nitrite ion in the front of film, the dark place colour developing after hybridization signal is clear, is transferred to TE(or deionized water with film) in soak 5min with termination reaction;

11) picture scanning and preservation: use the scanner scanning picture, film is stored in the sealing bag being put in natural air drying on the filter paper after the scanning.

Three, experimental result

1. transformant fluoroscopic examination

The picking mycelia is at the fluorescence microscopy Microscopic observation, and the contrast mycelia does not have fluorescence at burst of ultraviolel, and produced strong green fluorescence (see figure 1) through the transformant that liposome changes the GFP gene over to behind burst of ultraviolel.122 of statistical average transformants, transformation efficiency is: 8.19/μ g.

2 transformant PCR detect

Select at random a transformant, through the spore cultivation of going down to posterity of 6 generations, the fluorescence microscopy Microscopic observation all can detect fluorescence, extracts the total DNA(of mycelia and sees Fig. 2), carry out PCR with fluorescence protein gene primer GFP-S, GFP-X and detect, passed for 6 generations all can detect the fluorescence protein gene (see figure 3).

3. Southern results of hybridization

With extract 6 generation spore go down to posterity and carry out Southern hybridization behind total DNA purifying of cultivating mycelia, after the result showed that liposome transforms, the GFP gene integration only had a copy number in the bread mould genome, and the stable (see figure 4) that goes down to posterity.

Claims (3)

1. the direct method for transformation of bread mould mycelia liposome is characterized in that, may further comprise the steps:

One) bread mould mycelia liposome transforms:

1) the wet mycelia of the tender bread mould of children is mixed rear the grinding with Osmitrol, get bacteria suspension, for subsequent use;

2) with liposome 2000 and plasmid pEGFP-C1 mixing, in-5-5 ℃ placement 15-60min, then be transferred in the bacteria suspension, mixing, in-5-5 ℃ placement 15-60min;

3) with step 2) the gained mixed solution smears the PDA flat board, cultivated 1-5 days for 25-30 ℃;

Two) cultivation of going down to posterity:

4) the picking step 3) is inoculated on the PDA flat board 25-30 ℃ with the transformant of fluorescence after testing and cultivated 1-5 days, goes down to posterity altogether and cultivates 5-8 time.

2. the direct method for transformation of bread mould mycelia liposome as claimed in claim 1 is characterized in that described step 1) is specially: the wet mycelia of the tender bread mould of 0.05-0.2g children is mixed with the Osmitrol of 0.5-2ml, concentration 0.5-1.0mol/l.

3. the direct method for transformation of bread mould mycelia liposome as claimed in claim 1 is characterized in that described step 2) be specially: get 30-100 μ l liposome 2000 and 30-100 μ l plasmid pEGFP-C1 mixing.

Images