CN102936593B - Nucleic acid detection method applying multiplex PCR array technology - Google Patents
Nucleic acid detection method applying multiplex PCR array technology Download PDFInfo
- Publication number
- CN102936593B CN102936593B CN201210289505.5A CN201210289505A CN102936593B CN 102936593 B CN102936593 B CN 102936593B CN 201210289505 A CN201210289505 A CN 201210289505A CN 102936593 B CN102936593 B CN 102936593B
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- detection
- mpcr
- tetramer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The present invention discloses a nucleic acid detection method applying a multiplex PCR array technology, and further relates to universal tag (UT) sequences, a primer pair comprising the universal tag sequences and specific detection primers (5'-UT primer+specific detection primer-3'), a kit containing the universal tag sequences or the primer pair, and applications of the sequences, the primer pair and the kit in nucleic acid biological detection, wherein the UT sequences meet the following conditions: 1) the UT sequences of the upstream primer and the downstream primer are different, and Tm value difference does not exceed +-1 DEG C, and is about 5-10 DEG C greater than a detection primer Tm value; and 2) the UT sequences are the randomly-designed DNA fragments, and do not have homology with the sequence of the organism requiring detection. According to the detection method, sensitivity and specificity of nucleic acid detection are increased through combination of the mPCR and the universal tag sequences.
Description
One, technical field
The present invention relates to a kind of nucleic acid detection method, particularly application multiplex PCR array technique detects the method for nucleic acid, belongs to biological technical field.
Two, background technology
Multiple PCR technique (multiplex PCR, mPCR) has been since the eighties in last century, round pcr was born, the another large innovation of this technical field.Normal PCR technology is only used pair of primers, by amplification, produces a nucleic acid fragment, is used for the evaluation of single purpose sequence.And mPCR applies more than two pairs primers in same PCR reaction system, amplify the PCR reaction of a plurality of nucleic acid fragments simultaneously, its reaction principle, reaction reagent is identical with classical PCR with operating process.
The feature of mPCR maximum is exactly to have improved the efficiency detecting, make PCR become a kind of high-throughout means: (1) high efficiency, in same PCR reaction tubes, detect multiple target thing to be measured simultaneously, or to there being the goal gene of a plurality of types to carry out somatotype, particularly with a sample, just can detect multiple target; (2) systematicness, mPCR is suitable for target in groups very much, as detected when different pathogens in the classifications such as hepatitis virus, enteron aisle pathogenic bacteria, venereal disease, food microorganisms and bacterial warfare agent; (3) economy, multiple target detects in same reaction system simultaneously, expending of aspect such as time, reagent, expensess, is all very large saving.
MPCR technology is widely used at biomedical sector.In the time of such as multiple pathogenic microorganisms, detect or identify, the Classification Identification of some inherited disease and oncogene etc.For object to be checked many types of not, or the problem such as multidigit point gene sudden change, mPCR can improve its recall rate.In concrete application, in order to improve the specificity of detection, the design of primer seems particularly important with selection.For a plurality of gene target sequences, carry out PCR detection simultaneously, often occur in order to guarantee the specificity of primer, and make multipair different in size, GC content has Tm value between the primer of notable difference to be difficult to unified phenomenon, bring difficulty to the annealing temperature programming of whole mPCR system, thereby lowered the sensitivity that mPCR detects.The present invention is directed to this problem, by mPCR technology in conjunction with universal tag sequence (universal tag, UT) method, 5 ' the end at every original detection primer adds a UT primer designed, designed, Tm primary system one, make multipair primer in amplification, realize the unification of annealing temperature, improve the efficiency of reaction.Meanwhile, when also can realizing many species mixing sample, a plurality of mPCR system, this invention implements, i.e. mPCR array.Generally speaking, for common mPCR, principal feature of the present invention is that the different annealing temperature of multi-primers in mPCR is unified, and has promoted the carrying out of reaction, improves detection sensitivity.In addition,, because the relatively common detection primer of Tm value of UT in reaction system is higher, the specificity of PCR is also increased.
Three, summary of the invention
The object of the present invention is to provide a kind of nucleic acid detection method, the method by mPCR in conjunction with UT, to improve sensitivity and the specificity of detection of nucleic acids.
Technical scheme of the present invention: a kind of nucleic acid detection method of applying mPCR array technique
An object of the present invention is to provide universal tag (UT) sequence, it,, by 20-24 based composition, is characterized in that: 1. different, the Tm value of the UT sequence of upstream and downstream primer differ and be no more than ± 1 ℃, and be greater than detection 5-10 ℃ of left and right of primer Tm value; 2. the DNA fragmentation that UT sequence is Random Design, and between the nucleotide sequence of biology to be detected without homology.
Preferably, described UT sequence by the random tetramer of organizing four based compositions more, and this tetramer should meet: it is mutually different between (1) tetramer, at least will having two bases; (2) can not be complimentary to one another between the tetramer; (3) tetramer should self not match; (4) tetramer can not be comprised of two repetition base pairs.More preferably, described UT sequence, it is comprised of 6 groups of random tetramers.Further preferably, described UT sequence is comprised of following 6 groups of random tetramers: CAGC, GGTA, GACC, ACCT, ATCG, TGCG.Further preferably, UT sequence is specifically:
F：CAGCGGTAGACCACCTATCGTGCG；
R:CTGTAGCCGGACTTGAAGCCGGAC; And/or
F：GGTAACCTTGCGCAGCATCGGACC；
R:AGCCTTGAGGACCTGTAGCCGGAC; And/or
F：TGCGCAGCATCGACCTGGTAGACC；
R：GGACCTGTAGCCTTGAAGCCGGAC。
Another object of the present invention is to provide a kind of primer pair, contains above-mentioned UT sequence and detects primer pair, and wherein UT sequence is added in every 5 ' end that detects primer.
Preferably, primer pair is:
F：CAGCGGTAGACCACCTATCGTGCGCCTGAATCTTCTGGTAAAAC；
R:CTGTAGCCGGACTTGAAGCCGGACGTTTCTGGGCTGCCAAACATTAC; And/or
F：CAGCGGTAGACCACCTATCGTGCGCATTATCACGGTAATTAGTG；
R:CTGTAGCCGGACTTGAAGCCGGACAGAGCACTGTGCACTTAAG; And/or
F：CAGCGGTAGACCACCTATCGTGCGTAATGCTTTGATCGGCTT；
R：CTGTAGCCGGACTTGAAGCCGGACTGGATTGCACTTCATCTTGG。
Preferably, primer pair is:
F：CAGCGGTAGACCACCTATCGTGCGCAACCGTACAGAATGAAGCGG；
R:CTGTAGCCGGACTTGAAGCCGGACTTATTCGTGCAATACTCGTGCG; And/or
F：CAGCGGTAGACCACCTATCGTGCGATTTCTGTAACAGCTACCAACGA；
R:CTGTAGCCGGACTTGAAGCCGGACGAATTCCCTGTCTTTTCAAAGTC; And/or
F ：
CAGCGGTAGACCACCTATCGTGCGGCCCTAATAAATTGGAGGATCTAATGA；
R ：
CTGTAGCCGGACTTGAAGCCGGACGACCAGAAGTTGTATCTTTTTTTCCG。
Also preferred, primer pair is:
F：GGTAACCTTGCGCAGCATCGGACCGCTGCGGTAGGTGGTTCAA；
R:AGCCTTGAGGACCTGTAGCCGGACTTGTCGCGGATTTGCAACTA and/or
F ：
GGTAACCTTGCGCAGCATCGGACCGCTGGCGCCGCTGGCAACAAAATTC；
R:AGCCTTGAGGACCTGTAGCCGGACCTTCTGCAGATTGCGGCGTGCCGT; And/or
F：GGTAACCTTGCGCAGCATCGGACCCGGCTCGTTTATCGGCTT；
R：AGCCTTGAGGACCTGTAGCCGGACGGTATTTCGTTTCAGCCAAGC。
Still preferred, primer pair is:
F ：
TGCGCAGCATCGACCTGGTAGACCGAGTACCAAACTGCTAACACAGGTACTC；
R:GGACCTGTAGCCTTGAAGCCGGACAGCTGGTTTGCAGCTTC; And/or
F：TGCGCAGCATCGACCTGGTAGACCGCTGATTTAAGAGATAGAGGAACA；
R:GGACCTGTAGCCTTGAAGCCGGACTTTATGTGGTTATTTGCTGTC; And/or
F：TGCGCAGCATCGACCTGGTAGACCTCCGCCTGCAAGTCCTAAG；
R：CTGTAGCCGGACTTGAAGCCGGACTGGATTGCACTTCATCTTGG。
Another object of the present invention is to provide a kind of test kit, wherein contain above-mentioned UT sequence or primer pair.
Another object of the present invention is provides above-mentioned UT sequence, primer pair, the application of test kit in the biological detection of non-diagnostic purpose.
Another object of the present invention is that above-mentioned UT sequence, primer pair, test kit are for detection of Acinetobacter bauamnnii (Acinetobacter baumannii), especially its recA, 16S-23S ITS, OXA-51 sample gene.
Another object of the present invention is that above-mentioned UT sequence, primer pair, test kit are for detection of streptococcus pneumoniae (Streptococcus pneumoniae), Neisseria meningitidis (Neisseria meningitidis), Listeria monocytogenes (Listeria monocytogenes), the especially lytA of streptococcus pneumoniae, ply and psaA gene; The ctrA of Neisseria meningitidis, crgA and porA gene; The iap of Listeria monocytogenes, actA and hly gene.
(1) determined nucleic acid sequence obtains
From ncbi database (http://www.ncbi.nlm.nih.gov/), obtain the complete sequence (individual gene or full genome) of nucleic acid to be checked, for each sequence, determine 3 specific detection sections, by multiple spot, detect to improve the specificity of detection.
(2) design of PCR specific detection primer
For every kind of nucleotide sequence to be checked, determine that respectively 3 place's specific gene sections are as target sequence, and for each shot design PCR diagnostic primers.The nucleotide sequence to be checked obtaining according to ncbi database, the BLAST instrument (http://blast.ncbi.nlm.nih.gov/Blast.cgi) that adopts primer-design software to be combined in NCBI website screens, for each grappling target sequence design PCR primer in every kind of sequence to be checked.Every kind of sequence to be checked will independently be carried out the mPCR of its 3 target sequences in detection system at one respectively simultaneously, and amplified production will be identified by agarose gel electrophoresis.Therefore, design of primers has following principle: 1. the Auele Specific Primer Tm value of every kind of sequence to be checked is between 50-60 ℃; 2. in every kind of sequence to be checked, the PCR product length of 3 target area sections avoids approaching, is convenient to the agarose gel electrophoresis analysis after detecting, if positive findings, every kind of bacterium occurs that 3 vary in size, distinguish electrophoretic band clearly; 3. the sequence of every pair of primer all needs to carry out sequence analysis by the blast program of NCBI, avoids occurring intersecting between primer; 4. the amplified production of every pair of primer is convenient to the enforcement of PCR with interior for well at 1kb, and shortens as far as possible proliferation time.
(3) design of UT primer
So-called UT, is in fact the nucleotide sequence that is connected to the unified length of specific detection primer 5 ' end of one section of artificial design, and length is generally 20-24 base, and itself and specific detection primer form combined type primer, i.e. 5 '-UT primer+specific detection primer-3 '.In the detection of each determined nucleic acid, for 3 pairs of primers of 3 detection shot designs, 5 ' of these 3 pairs of primers are held public 1 couple of UT (every pair of required UT sequence of upstream and downstream that detects primer is different), thereby form a unified mPCR system.Following principle is followed in the design of UT: 1. upstream and downstream UT sequence is different, Tm value is similar (differ be no more than ± 1 ℃), and is greater than detection 5-10 ℃ of left and right of primer Tm value; 2. the DNA fragmentation that UT is Random Design, and between the sequence of biology to be detected without homology.Described UT sequence can generate by primer-design software.Traditionally, the multiple that the base number of UT is 4, to facilitate the design of UT sequence.Can design in advance many groups by the random tetramer of four based compositions, from wherein selecting 6 groups to arrange, can form a UT.If change these tetrameric putting in order, can form other UT.The tetramer, when selecting, should be noted: it is mutually different between (1) tetramer, at least will having two bases; (2) tetramer complimentary to one another can not select, as GACC and GTCC; (3) tetramer self matching can not select, as TGCA; (4) tetramer can not be comprised of the base pair of two repetitions, as CACA.The sequence primary design of UT primer well after, need analyze by the online BLAST in NCBI website, determine that this sequence and determined nucleic acid, without homology, can be used.In addition, the UT primer of designing according to this kind of method, its Tm value is mostly more than 60.
The species that detect according to need or nucleotide sequence quantity design the UT sequence pair of respective numbers, are similar to forward UT and the reverse UT of PCR primer.Primer divides two groups to synthesize: one group is simple UT sequence; The complex body primer that another group is " Auele Specific Primer-3 ' of 5 '-UT+ nucleotide sequence to be checked ", 5 ' the end at every specific detection primer adds the preceding paragraph UT sequence.Every pair of Auele Specific Primer need link different UT fragments.With nucleic acid to be checked 3 couple detect primer can public a pair of UT sequence.In addition, design and synthesize mPCR system quality and control required positive fragment, negative fragment and corresponding primer.
(4) enforcement of mPCR
Obtain every kind of determined nucleic acid sample, the detection of every kind of nucleic acid is 1 independently PCR unit, and each unit is a mPCR system that comprises 1 couple of UT, 3 pairs of UT+ specific detection primer complex bodys.If relate to multiple species or multiple nucleic acids sequence detects simultaneously, by 8 PCR pipes or 96 hole PCR plates, completed, each single tube comprises a mPCR system, multitube associating forms mPCR array.For two-wheeled before amplification makes the special primer of different detecting sections, all can anneal smoothly, can adopt thermograde program, a series of annealing temperatures are set within the scope of 10 ℃, guarantee that specific target sequence is successfully caught, thereby also strengthen the sensitivity detecting.
(5) mPCR interpretation of result
Adopt agarose gel electrophoresis to detect mPCR amplification.If certain determined nucleic acid is successfully detected, according to the size (adding the UT sequence of 48 bases that downstream primer adds altogether) that detects 3 pairs of primer extension products that this nucleic acid uses, by gel imaging analysis, can on sepharose, there is the clear band of 3 corresponding length.
(6) expansion of mPCR detecting pattern
This invention relates to technology and can detect for same nucleic acid-templated different target sequences simultaneously, also can detect for the different target fragments that are distributed on different IPs acid template simultaneously, and the quantity of specific detection primer also can increase and decrease according to the actual requirements.
Four, accompanying drawing explanation
Fig. 1 is the mPCR system implementation conceptual scheme based on UT.
Five, embodiment
Below in conjunction with specific embodiment, the invention will be further described, but the present invention is not limited to following examples.
Embodiment mono-mPCR detects the application in single detected object
The detection of Acinetobacter bauamnnii (Acinetobacter baumannii, Ab) culture of take is example, and the application that the present invention relates to mPCR system is described.Because adopted sample is known Ab culture, so this example is intended to the inventive method and the detection sensitivity that does not add the common mPCR of UT sequence to describe.
1, sample collection.
From localized disease prevention, obtain Ab clinical separation strain with control center (CDC).
2, Ab genomic information obtains.
From GenBank, obtain Ab whole genome sequence information.Determine 3 specific detection sections, each section institute grappling gene relates separately to recA gene, 16S-23S ITS region and OXA-51 sample gene, by mPCR, detects, and improves the specificity that Ab identifies.
3, for three detector segments, select specific PCR primer, and be designed for the UT sequence of mPCR.
Selection detects for Ab for the higher primer of said gene section specificity.The primer upstream and downstream that respectively detects target spot for Ab connects respectively the different UT of two sequences.In this detection, Ab detects and relates to 3 pairs of primers, and 3 pairs of primers are by public 1 couple of UT, thus a unified mPCR system of composition.For Ab, detect designed UT to being respectively:
UTAb1-F:5 '-CAGCGGTAGACCACCTATCGTGCG-3 ' and UTAb2-R:5 '-CTGTAGCCGGACTTGAAGCCGGAC-3 '.When design UT primer, can design in advance some random Nucleotide tetramers, such as above-mentioned UTAb1-F primer 5 '-CAGCGGTAGACCACCTATCGTGCG-3 ', to arrange and form by tetramers such as CAGC, GGTA, GACC, ACCT, ATCG, TGCG, if change these tetrameric putting in order, can form other UT primers.
Because every pair of 5 ' end that detects primer in mPCR amplification system all comprises the almost identical UT primer pair of Tm value, therefore, the mPCR system that can under identical amplification condition, 3 pairs of primers be formed is come together, and efficiently completes the amplification of the different sections of Ab.Concrete primer sequence information is as shown in subordinate list 1A.
Being provided with simultaneously and not adding UT primer complex body, is only the common mPCR control group of specific detection primer.Concrete primer sequence information is as shown in subordinate list 1B.
4, mPCR detection system is implemented.
(1) mPCR template preparation.
In detection, adopt 40 parts of Ab clinical separation strain cultures directly as the template to be checked of mPCR system.In order to evaluate the sensitivity of this system, to the overnight culture of Ab, (OD600=0.8-1.0 is about 10
8individual bacterium/ml) carry out 10 times of serial dilutions.Each dilution gradient is got 2 μ l as template;
(2) mPCR detects.
Reaction system comprises: 1 * PCR damping fluid (10mM Tris-HCl (pH 8.3), 50mM KCl, 1.5mMMgCl
2), each 250nM of dNTP, UT primer 0.3 μ M, UT+ specific detection primer complex body 0.1 μ M, TaqDNA polysaccharase 2.5U/100 μ l PCR system, through the Ab of gradient dilution bacterium liquid template 2 μ l.Reaction conditions: mPCR testing process is divided into two stages, first stage is 5 circulations of program amplification that adopt " 95 ℃ of sex change 30s; 50-55 ℃ of each 30s of Gradient annealing; 72 ℃ extend 45s " in reaction, and object is to allow second half section---the first grappling of specific detection primer target sequence separately in UT+ specific detection primer complex body; Then, adopt 25-30 the circulation of program amplification of " 72 ℃ extend 45s for 95 ℃ of sex change 30s, 60 ℃ of Gradient annealing 30s ", now, because annealing temperature raises, the primer that participates in detecting is mainly that Tm is at more than 60 simple UT primers.Because UT sequence has been accomplished Tm primary system one when designing as far as possible, thereby can under the annealing temperature of homogeneous, realize 3 high-efficiency multiples amplifications that detect target spots.The quality control of mPCR system, as the positive, feminine gender and blank arrange separately.
Control group is due to the primer complex body not using with UT, and therefore the PCR for each different target thing need, according to different primers Tm, arrange Gradient annealing temperature.Whole response procedures is " 72 ℃ extend 45s for 95 ℃ of sex change 30s, 50-55 ℃ of each 30s of Gradient annealing ", 35 circulations.
(3) analysis of mPCR detected result.By 2% agarose gel electrophoresis, analyze mPCR product, by gel imaging system, electrophoresis result is analyzed.When usining 232bp, 377bp and 449bp 3 band, there is the item key detecting as Ab.Do not use the control group of UT primer complex body, when usining 184bp, 329bp and 401bp 3 band, occur the item key detecting as Ab.
(4) comparison of detected result.
Adopt the inventive method to detect 40 parts of Ab clinical separation strain cultures, with the primer that does not add UT, as common mPCR, contrast simultaneously.The inventive method all detects 3 target spots of 40 parts of Ab samples simultaneously, and recall rate is 100%, the first power that bacterium liquid extent of dilution is 10; Common mPCR is 87.5% (35/40) to the recall rate of 40 parts of Ab samples, and bacterium liquid extent of dilution is also 10 first power.
Embodiment bis-mPCR detect the application in a plurality of detected objects
This example mainly illustrates the evaluation unknown sample how mPCR system is come with multiple specific detection primer.From clinical samples of CSF, detect streptococcus pneumoniae (Streptococcus pneumoniae, Sp), Neisseria meningitidis (Neisseria meningitidis, Nm) and these three kinds of bacterial meningitis the main pathogenic fungi of Listeria monocytogenes (Listeria monocytogenes, Lm).The key distinction of the present embodiment and embodiment mono-is that complex samples (is contained to a plurality of nucleotide sequences to be checked, comprise in other words a plurality of species), nucleotide sequence for each species to be checked arranges 3 detection target fragments, relates to 3 pairs of UT+ specific detection primer complex bodys, and its UT sequence is identical; For difference species to be checked, have different UT primer pairs to show difference, but Tm value between each UT is close, mPCR reaction conditions is unified.Like this, detection system detects target fragment at 3 that are longitudinally every kind of species nucleotide sequence to be checked, is laterally the Parallel testing of different species nucleotide sequences to be checked, thereby forms mPCR array detecting pattern.In addition, adopting and do not add UT primer complex body, is only that specific detection primer is as common mPCR control group.Meanwhile, traditional bacterial cultivation as a reference, for weighing specificity and the sensitivity of the inventive method and common mPCR method.
1, sample collection.
According to relevant regulations of rules, from civilian hospital clinical laboratory, obtain 50 parts of qualified clinical samples of CSF.
2, genomic information obtains.
Determine 3 specific detection sections separately in 3 bacteriums to be checked.The grappling gene that Sp detects relates separately to lytA, ply and psaA tri-genes.Nm detects and relates to ctrA, crgA and porA tri-genes; The evaluation of Lm is locked by iap, actA and hly tri-genes.Auele Specific Primer 5 ' the end of every kind of each gene to be checked of bacterium will combine with corresponding UT primer pair respectively, form primer complex body.
3, for three detector segments, select specific PCR primer, and be designed for the UT sequence of mPCR.
Selection is used for this research for the higher primer of said gene section specificity.In this detection, in the detection of Sp, Nm and tri-kinds of bacteriums of Lm, every kind of bacterium all relates to 3 pairs of primers, and the public 1 couple of UT of its 3 pairs of primers, thereby forms a unified mPCR system.In this detection, for Sp, detect designed UT to being respectively: UTSp1-F:5 '-CAGCGGTAGACCACCTATCGTGCG-3 ' and UTSp2-R:5 '-CTGTAGCCGGACTTGAAGCCGGAC-3 '; For Nm, detect designed UT to being respectively: UTNm1-F:5 '-GGTAACCTTGCGCAGCATCGGACC-3 ' and UTNm2-R:5 '-AGCCTTGAGGACCTGTAGCCGGAC-3 '; For Lm, detect designed UT to being respectively: UTLm1-F:5 '-TGCGCAGCATCGACCTGGTAGACC-3 ' and UTLm2-R:5 '-GGACCTGTAGCCTTGAAGCCGGAC-3 '.The sequence primary design of UT primer well after, need analyze by the online BLAST in NCBI website, determine that this sequence and determined nucleic acid, without homology, can be used.In addition, the UT primer of designing according to this kind of method, its Tm value is mostly more than 60.
Because every pair of detection primer in mPCR amplification system all comprises the similar UT primer pair of Tm value, therefore, the mPCR system that 3 pairs of primers that can under identical amplification condition, every kind of bacterium be related to form is come together, detect altogether 3 kinds of bacteriums, form 3 * 3 mPCR array, efficiently complete the amplification of S p, Nm and the different sections of Lm3 kind bacterium.Concrete primer information is as shown in subordinate list 2A.
Being provided with simultaneously and not adding UT primer complex body, is only the common mPCR control group of specific detection primer.Concrete primer sequence information is as shown in subordinate list 2B.
4, mPCR detection system is implemented.
(1) mPCR template preparation.
In 200 μ l clinical samples, add 100 μ l containing TE (Tris-EDTA, the pH8.0) damping fluid of 0.04g/ml N,O-Diacetylmuramidase, mix, be placed in 37 ℃ of water-baths and hatch 1h.Adopt bacterial genomes DNA extraction test kit (precious biological (Dalian) biotechnology company limited) to extract DNA, then use 100 μ l TE (Tris-EDTA, pH8.0) buffer solution elution DNA, be placed in-20 ℃ of preservations.DNA concentration can be measured by Smart Spec plus nucleic acid-protein determinator (BIO-RAD, the U.S.).
(2) mPCR detects.
The mPCR system of every kind of bacterium is 100 μ l, comprising: 1 * PCR damping fluid (10mM Tris-HCl (pH8.3), 50mM KCl, 1.5mM MgCl
2), each 0.3 μ M of corresponding UT primer, UT+ specific detection primer complex body 0.1 μ M, Taq archaeal dna polymerase 2.5U, clinical sample DNA 2.5 μ l.Reaction conditions: mPCR testing process is divided into two stages, first stage is 5 circulations of program amplification that adopt " 95 ℃ of sex change 30s; 50-55 ℃ of each 30s of Gradient annealing, 72 ℃ extend 45s " in reaction, and object is to allow UT+ specially detect the first grappling of primer complex body target sequence to be measured separately; Then, adopt 30 circulations of program amplification of " 72 ℃ extend 45s for 95 ℃ of sex change 30s, 60 ℃ of Gradient annealing 30s ", now owing to being annealed into temperature, raise, the primer that participates in detecting is mainly that Tm is at more than 60 UT primers.Thereby under the condition of unified reaction, realize 3 high-efficiency multiple amplifications that detect target spot.The quality control of mPCR system, as the positive, feminine gender and blank arrange separately.
Control group is due to the primer complex body not using with UT, and therefore the PCR for each different target thing need, according to different primers Tm, arrange Gradient annealing temperature.Whole response procedures is " 72 ℃ extend 45s for 95 ℃ of sex change 30s, 50-55 ℃ of each 30s of Gradient annealing ", 35 circulations.
(3) analysis of mPCR detected result.
By 2% agarose gel electrophoresis, analyze mPCR product, by gel imaging system, electrophoresis result is analyzed.When usining 3 different big or small bands, there is the item key (the PCR product size that detects target thing sees attached list 2A and 2B) as every kind of Detection of pathogenic bacteria.
(4) comparison of detected result.
The efficiency ratio of the inventive method and bacterial cultivation and the efficiency ratio of common mPCR method and bacterial cultivation see attached list 3-5.Detected result shows, take bacterial cultivation as " gold standard ", sensitivity and specificity that mPCR method of the present invention and common mPCR method detect 50 parts of clinical samples are compared as follows: (1) detects for lytA, the ply of Sp and psaA tri-genes that (three gene PCRs are all positive simultaneously, lower same), the sensitivity of mPCR method of the present invention is 100% (36/36, p < 0.05), specificity is respectively: 85.7% (12/14, p < 0.05); The sensitivity of common mPCR method is 86.1% (31/36, p < 0.05), and specificity is 71.4% (10/14, p < 0.05); (2) crtA, crgA and porA tri-genes for Nm detect simultaneously, the sensitivity of mPCR method of the present invention is 96.7% (29/30, p < 0.05), specificity is respectively: 90% (18/20, p < 0.05); The sensitivity of common mPCR method is 83.3% (25/30, p < 0.05), and specificity is 80% (16/20, p < 0.05); (3) iap, actA and hly tri-genes for Lm detect simultaneously, the sensitivity of mPCR method of the present invention is 100% (18/18, p < 0.05), specificity is respectively: 90.6% (29/32, p < 0.05); The sensitivity of common mPCR method is 77.8% (14/18, p < 0.05), and specificity is 81.3% (26/32, p < 0.05).
Attached caption
Core of the present invention be mPCR array technique system as shown in Figure 1.
The triple mPCR of single determined nucleic acid of take in figure are example.In the time of by three sections of target sequences, increase to identify a kind of nucleic acid.In figure, DNA target sequence 1,2,3 represents respectively 3 sections of specific regions that detect this nucleotide sequence institute grappling, primer pair the 1,2, the 3rd, for the specific detection primer of these 3 sections, UT1 is the universal tag for this object nucleic acid, every kind of determined nucleic acid distributes respectively a kind of UT, and " F " and " R " represents respectively upstream primer and downstream primer.(1) the mPCR first stage (corresponding increase cycle number according to the actual requirements), three pairs of specific detection primers of fragment to be measured of the same race react participating in the composite primer being combined into UT1 respectively.In this stage, what bear primer function is only the Auele Specific Primer section in composite primer, and the successful annealing in this stage, will establish very important basis for the specific amplification of whole mPCR system; (2) by the first stage, increase, newly-generated 5 ' end carries each of the product of UT1-F and UT1-R label; (3) carry out subordinate phase amplification, the same first stage of method; (4) by subordinate phase, increase, newly-generated again two products, 5 ' end carries UT1-R label-3 ' end and carries UT1-F complementary sequence label and 5 ' end and carry each, the DNA single chain that UT1-F label-3 ' end carries UT1-R complementary sequence label, and interchain is complementary relationship.This double-stranded will continuation as masterplate, for follow-up efficient amplification plays a key effect; (5) since the phase III, the primer in amplification system by main by single UT1-F/R to bearing, they are unified mutually by three sections of different target sequences amplifications, become the simple PCR reaction of single primer.Obviously, the application of UT makes mPCR system simple, efficient; (6) under the right effect of UT1-F/R, the amplified production of three sections of target sequences generates in a large number, with conventional mPCR difference is, at every section of target sequence amplified production two ends, has all carried UT or UT complementary sequence; (7) length of UT is known, therefore, by agarose gel electrophoresis, can judge detected result.
Subordinate list 1:
Subordinate list 1A Acinetobacter bauamnnii mPCR detection system UT+ specific detection primer complex body sequence
* in primer sequence, underscore is partly UT sequence.
Subordinate list 1B Acinetobacter bauamnnii mPCR detection system specific detection primer sequence
Subordinate list 2:
The clinical samples mPCR system of the present invention primer sequence of subordinate list 2A directed toward bacteria property meningitis the main pathogenic fungi
* in primer complex body sequence, underscore is partly UT sequence, relates to the 3 cover UT primers for 3 kinds of bacteriums in upper table.
The common mPCR system of the clinical samples primer sequence of subordinate list 2B directed toward bacteria property meningitis the main pathogenic fungi
Subordinate list 3:
The efficiency ratio that subordinate list 3A the inventive method and bacterial cultivation detect Sp in clinical CSF sample
The efficiency ratio that the common mPCR method of subordinate list 3B and bacterial cultivation detect Sp in clinical CSF sample
Subordinate list 4:
The efficiency ratio that subordinate list 4A the inventive method and bacterial cultivation detect Nm in clinical CSF sample
The efficiency ratio that the common mPCR method of subordinate list 4B and bacterial cultivation detect Nm in clinical CSF sample
Subordinate list 5:
The efficiency ratio that subordinate list 5A the inventive method and bacterial cultivation detect Lm in clinical CSF sample
The efficiency ratio that the common mPCR method of subordinate list 5B and bacterial cultivation detect Lm in clinical CSF sample
Claims (5)
1. a primer pair, contains universal tag sequence (UT sequence), and detects primer pair, and UT sequence is added in every 5 ' end that detects primer; Wherein, described UT sequence is by 24 based compositions, and meets the following conditions: 1. different, the Tm value of the UT sequence of upstream and downstream primer differ and be no more than ± 1 ℃, and be greater than detection 5-10 ℃ of left and right of primer Tm value; 2. the DNA fragmentation that UT sequence is Random Design, and between the nucleotide sequence of biology to be detected without homology;
Wherein, described UT sequence by the random tetramer of organizing four based compositions more, and this tetramer should meet: it is mutually different between (1) tetramer, at least will having two bases; (2) can not be complimentary to one another between the tetramer; (3) tetramer should self not match; (4) tetramer can not be comprised of two repetition base pairs;
Wherein UT sequence is comprised of 6 groups of random tetramers;
Wherein UT sequence is comprised of following 6 groups of random tetramers: CAGC, GGTA, GACC, ACCT, ATCG, TGCG or CTGT, AGCC, GGAC, TTGA, AGCC, GGAC; UT sequence is specifically:
F：CAGCGGTAGACCACCTATCGTGCG；
R:CTGTAGCCGGACTTGAAGCCGGAC; And/or
F：GGTAACCTTGCGCAGCATCGGACC；
R:AGCCTTGAGGACCTGTAGCCGGAC; And/or
F：TGCGCAGCATCGACCTGGTAGACC；
R：GGACCTGTAGCCTTGAAGCCGGAC；
Above-mentioned mentioned primer pair, it is:
F：CAGCGGTAGACCACCTATCGTGCGCCTGAATCTTCTGGTAAAAC；
R:CTGTAGCCGGACTTGAAGCCGGACGTTTCTGGGCTGCCAAACATTAC; And/or
F：CAGCGGTAGACCACCTATCGTGCGCATTATCACGGTAATTAGTG；
R:CTGTAGCCGGACTTGAAGCCGGACAGAGCACTGTGCACTTAAG; And/or
F：CAGCGGTAGACCACCTATCGTGCGTAATGCTTTGATCGGCTT；
R:CTGTAGCCGGACTTGAAGCCGGACTGGATTGCACTTCATCTTGG; And/or
F：CAGCGGTAGACCACCTATCGTGCGCAACCGTACAGAATGAAGCGG；
R:CTGTAGCCGGACTTGAAGCCGGACTTATTCGTGCAATACTCGTGCG; And/or
F：CAGCGGTAGACCACCTATCGTGCGATTTCTGTAACAGCTACCAACGA；
R:CTGTAGCCGGACTTGAAGCCGGACGAATTCCCTGTCTTTTCAAAGTC; And/or
F：CAGCGGTAGACCACCTATCGTGCGGCCCTAATAAATTGGAGGATCTAATGA；
R:CTGTAGCCGGACTTGAAGCCGGACGACCAGAAGTTGTATCTTTTTTTCCG; And/or
F：GGTAACCTTGCGCAGCATCGGACCGCTGCGGTAGGTGGTTCAA；
R:AGCCTTGAGGACCTGTAGCCGGACTTGTCGCGGATTTGCAACTA and/or
F：GGTAACCTTGCGCAGCATCGGACCGCTGGCGCCGCTGGCAACAAAATTC；
R:AGCCTTGAGGACCTGTAGCCGGACCTTCTGCAGATTGCGGCGTGCCGT; And/or
F：GGTAACCTTGCGCAGCATCGGACCCGGCTCGTTTATCGGCTT；
R:AGCCTTGAGGACCTGTAGCCGGACGGTATTTCGTTTCAGCCAAGC; And/or
F：TGCGCAGCATCGACCTGGTAGACCGAGTACCAAACTGCTAACACAGGTACTC；
R:GGACCTGTAGCCTTGAAGCCGGACAGCTGGTTTGCAGCTTC; And/or
F：TGCGCAGCATCGACCTGGTAGACCGCTGATTTAAGAGATAGAGGAACA；
R:GGACCTGTAGCCTTGAAGCCGGACTTTATGTGGTTATTTGCTGTC; And/or
F：TGCGCAGCATCGACCTGGTAGACCTCCGCCTGCAAGTCCTAAG；
R：GGACCTGTAGCCTTGAAGCCGGACGGCGGCACATTTGTCACTG。
2. test kit, wherein contains the primer pair of claim 1.
3. the primer pair of claim 1 any one or the application of the test kit of claim 2 in the detection of nucleic acids of non-diagnostic purpose.
4. the application of claim 3, wherein said detection is recA, 16S-23S ITS, the OXA-51 sample gene that detects Acinetobacter bauamnnii (Acinetobacter baumannii).
5. the application of claim 3, wherein said detection is lytA, ply and the psaA gene that detects streptococcus pneumoniae (Streptococcus pneumoniae); Iap, acTA and the hly gene of ctrA, the crgA of Neisseria meningitidis (Neisseria meningitidis) and porA gene and Listeria monocytogenes (Listeria monocytogenes).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210289505.5A CN102936593B (en) | 2012-08-15 | 2012-08-15 | Nucleic acid detection method applying multiplex PCR array technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210289505.5A CN102936593B (en) | 2012-08-15 | 2012-08-15 | Nucleic acid detection method applying multiplex PCR array technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102936593A CN102936593A (en) | 2013-02-20 |
| CN102936593B true CN102936593B (en) | 2014-11-26 |
Family
ID=47695515
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210289505.5A Active CN102936593B (en) | 2012-08-15 | 2012-08-15 | Nucleic acid detection method applying multiplex PCR array technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102936593B (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103642901B (en) * | 2013-11-04 | 2016-06-22 | 江苏和创生物科技有限公司 | The specific detection of Neisseria meningitidis Z group primed probe combination and test kit |
| CN108559784B (en) * | 2018-07-06 | 2021-08-20 | 陕西省动物研究所 | Triple PCR detection primer, probe, kit and detection method for simultaneously detecting three pathogenic bacteria |
| CN109628620B (en) * | 2019-01-22 | 2023-05-05 | 南方医科大学南方医院 | Primers, method and kit for detecting OXA-23 family and OXA-51 family genotypes by full-sequence fluorescent PCR |
| CN110004241A (en) * | 2019-04-22 | 2019-07-12 | 成都医学院 | A kind of PCR kit detecting Acinetobacter bauamnnii |
| CN110551833A (en) * | 2019-09-12 | 2019-12-10 | 卓源健康科技有限公司 | Method for detecting streptococcus pneumoniae pathogenic bacteria from clinical blood |
| CN111424100A (en) * | 2020-02-25 | 2020-07-17 | 宁波明舟生物科技有限公司 | Detection method of legionella pneumoniae, neisseria meningitidis and mycoplasma pneumoniae |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1496413A (en) * | 2003-05-09 | 2004-05-12 | 清华大学 | Method for multiple PCR condition optimization and its component |
| CN1834258A (en) * | 2005-11-25 | 2006-09-20 | 四川大学华西医院 | Primer design method of multiple PCR for discriminating vaccine of tubercle branch bacillus |
| CN102534042A (en) * | 2012-03-14 | 2012-07-04 | 上海翼和应用生物技术有限公司 | Multiple competitive polymerase chain reaction (PCR) quantitative gene expression profile analysis method |
| CN102586456A (en) * | 2012-03-14 | 2012-07-18 | 上海翼和应用生物技术有限公司 | Method for detecting copy number variations through multiple competitive polymerase chain reaction (PCR) |
-
2012
- 2012-08-15 CN CN201210289505.5A patent/CN102936593B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1496413A (en) * | 2003-05-09 | 2004-05-12 | 清华大学 | Method for multiple PCR condition optimization and its component |
| CN1834258A (en) * | 2005-11-25 | 2006-09-20 | 四川大学华西医院 | Primer design method of multiple PCR for discriminating vaccine of tubercle branch bacillus |
| CN102534042A (en) * | 2012-03-14 | 2012-07-04 | 上海翼和应用生物技术有限公司 | Multiple competitive polymerase chain reaction (PCR) quantitative gene expression profile analysis method |
| CN102586456A (en) * | 2012-03-14 | 2012-07-18 | 上海翼和应用生物技术有限公司 | Method for detecting copy number variations through multiple competitive polymerase chain reaction (PCR) |
Non-Patent Citations (2)
| Title |
|---|
| Mei-Chun Chiang等.Polymerase chain reaction assay for the detection of Acinetobacter baumannii in endotracheal aspirates from patients in the intensive care unit.《Journal of Microbiology, Immunology and Infection》.2011,第44卷(第2期),106-110. * |
| Polymerase chain reaction assay for the detection of Acinetobacter baumannii in endotracheal aspirates from patients in the intensive care unit;Mei-Chun Chiang等;《Journal of Microbiology, Immunology and Infection》;20110430;第44卷(第2期);107 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102936593A (en) | 2013-02-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102936593B (en) | Nucleic acid detection method applying multiplex PCR array technology | |
| CN105821138B (en) | A kind of method that double loop-stem structure DNA profiling detection nucleic acid are built based on coupled reaction | |
| CN108754000B (en) | Fluorescent quantitative PCR detection method for drug-resistant gene mcr-4/5/8 | |
| CN107075581A (en) | Digital measurement is carried out by targeting sequencing | |
| CN104937112B (en) | Quantitative method is carried out to the expression quantity of WT1 mRNA | |
| Li et al. | Development of a rapid and efficient RPA-CRISPR/Cas12a assay for Mycoplasma pneumoniae detection | |
| CN104946744A (en) | Method for amplifying nucleotide segment by multicross substitution and application thereof | |
| Mollasalehi et al. | An improved non-crosslinking gold nanoprobe-NASBA based on 16S rRNA for rapid discriminative bio-sensing of major salmonellosis pathogens | |
| CN113186313A (en) | Salmonella detection primer group, method and kit based on RPA-LbCas12a-TTECDS system | |
| CN111440886A (en) | Primer group, kit and detection method for rapidly detecting carbapenemase gene | |
| El-Husseini et al. | Generation and selection of specific aptamers targeting Brucella species through an enhanced cell-SELEX methodology | |
| Hao et al. | Naked-eye on-site detection platform for Pasteurella multocida based on the CRISPR-Cas12a system coupled with recombinase polymerase amplification | |
| CN105368943B (en) | A kind of kit and method for identification of mycobacterium strain | |
| CN102676664A (en) | Fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and detection method | |
| CN105992827A (en) | Universal controls for sequencing assays | |
| CN112760390A (en) | Fluorescent quantitative PCR primer composition for detecting tigecycline drug resistance gene tet (X) and variants thereof and application thereof | |
| Ivanov et al. | Comparison of biosensing methods based on different isothermal amplification strategies: A case study with Erwinia amylovora | |
| Wang et al. | Development of a naked eye CRISPR-Cas12a and-Cas13a multiplex point-of-care detection of genetically modified swine | |
| Buddhachat et al. | Bar-cas12a, a novel and rapid method for plant species authentication in case of Phyllanthus amarus Schumach. & Thonn | |
| EP2935617A1 (en) | Probability-directed isolation of nucleotide sequences (pins) | |
| CN105349526A (en) | Method used for nucleic acid isothermal amplification using multiple inner primers, and applications thereof | |
| CN109735645A (en) | A kind of real-time fluorescence PCR primer, probe and kit detecting spherical sporothrix | |
| CN113136443B (en) | Nucleic acid detection method for rapidly identifying bacillus cereus and bacillus thuringiensis | |
| KR20140128555A (en) | Primers for amplifying Microcystis sp Gene, and detection method of Microcystis sp using the same | |
| Wang et al. | Establishment of a rapid diagnosis method for Candida glabrata based on the ITS2 gene using recombinase polymerase amplification combined with lateral flow strips |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |