CN102925420A - Alpha amylase and recombinant strain for expressing same - Google Patents
Alpha amylase and recombinant strain for expressing same Download PDFInfo
- Publication number
- CN102925420A CN102925420A CN2012103833982A CN201210383398A CN102925420A CN 102925420 A CN102925420 A CN 102925420A CN 2012103833982 A CN2012103833982 A CN 2012103833982A CN 201210383398 A CN201210383398 A CN 201210383398A CN 102925420 A CN102925420 A CN 102925420A
- Authority
- CN
- China
- Prior art keywords
- amylase
- aspergillus
- aclap15
- enzyme
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to an alpha amylase and a recombinant strain for expressing the same. The amino acid sequence of the alpha amylase is shown as SEQ ID NO:1, and the coding nucleotide sequence is shown as SEQ ID NO:2. The preservation number of Aspergillus niger P15 for expressing the alpha amylase is CGMCC NO.6434. The recombinant strain obtained by the invention can express Aspergillus clavatus alpha amylase AclaP15, and the enzyme activity of the Aspergillus clavatus alpha amylase AclaP15 in the recombinant strain is greatly higher than the enzyme activity thereof in a wild strain and is higher than the enzyme activity of amylase expressed by the host strain Aspergillus niger itself. Meanwhile, the obtained recombinant alpha amylase is obtained by the secretion the food safety strain Aspergillus niger, and the application field of the AclaP15 is enlarged.
Description
Technical field
The invention belongs to diastatic separation expression technology field, be specifically related to a kind of α-amylase that derives from excellent aspergillus (Aspergillus clavatus), and this α-amylase at filamentous fungal host cell (such as the heterogenous expression in the aspergillus niger (Aspergillus niger).
Background technology
α-amylase (E.C.3.2.1.1) can the catalysis oligosaccharides and polysaccharide in the interior hydrolysis of Isosorbide-5-Nitrae-α-glycosidic link, it acts on starch, glycogen and relevant polysaccharide and oligosaccharides in mode at random, discharges the reduction group of α configuration.α-amylase is widely used in multiple industrial use at present, such as curing cake, wine brewing, corn steep liquor and the fields such as alcohol production and vinegar fermentation.
The source of α-amylase is very extensive, can separate from animal, plant and microorganism.Wherein microbe-derived amylase has the advantages that the source is abundant, performance is various and be easy to suitability for industrialized production, can satisfy multiple industrial application demand, and is also extensive in industrial application.In the starchiness treating processes of modern industry, the method for hydrolysis of microbial amylase has thoroughly replaced traditional chemical hydrolysis method.Although have multiple-microorganism can produce α-amylase, comprise filamentous fungus, yeast, bacterium and actinomycetes etc.But, the α-amylase that can satisfy at present the industrial application demand is mainly derived from bacterium and filamentous fungus, bacterial alpha amylase derives from bacillus (Bacillus) usually, and the fungi α-amylase derives from Eurotium (Aspergillus) usually.Wherein namely be called the fungi α-amylase by mycetogenetic α-amylase.
In the document of having reported at present, can be rough by zymologic property or action condition the fungi α-amylase is divided into 3 types: (1) neutral fungi α-amylase: different from bacterial alpha amylase, the source of fungi α-amylase is relatively less, the operative temperature of most of fungi α-amylases and pH are relatively gentleer, such as the suitableeest action pH between 5.0 ~ 5.5, optimum temperature is about 50 ~ 55 ℃, begins inactivation when temperature surpasses 60 ℃ of enzymes.The α-amylase that at present commercialization is produced at most, application also derives from aspergillus oryzae (mutation) the most widely namely belongs to this enzyme.(2) heat-resisting or acid resistance fungi α-amylase: this fermentoid is between pH 2.5 ~ 4.5, and operative temperature still has good thermostability when surpassing 60 ℃.Compare with neutral fungi α-amylase, heat-resisting or acid resistance fungi α-amylase can be simplified liquefaction, saccharifying, reduces in the deep-processing process such as starch such as sugaring grade the microbiological contamination probability and reduces corresponding production cost.This part enzyme is at present industrial to have begun production and application, and has very large development and use potentiality.(3) have the fungi of living amylase activity: this enzyme of α-amylase is except having hydrolysis Zulkovsky starch or other pasted starch abilities, also has the produced amylolysis ability, in the simultaneous saccharification and fermentation (SSF) of raw material alcohol industry, be used with saccharifying enzyme, what can increase substantially starch utilizes speed and efficient and Effective Raise ethanol production.
Reported that multiple α-amylase gene obtains expressing in different hosts, wherein the heterogenous expression of fungi α-amylase gene mainly concentrates on eukaryotic expression system.Compare with prokaryotic expression system (such as escherichia expression system or Bacillusexpression system etc.), eukaryotic expression system has very large advantage when expressing the heterologous protein in eucaryon source, modify such as the translation post-treatment (such as the formation of glycosylation, disulfide linkage), intron identification, signal peptide wipe out with the correct folding and secretion of peptide chain etc.In addition, there is multiple fungal expression system to be classified as GRAS (generally recognized as safe) bacterial strain by U.S. FDA, to the production of some food or pharmaceutical heterologous protein and approval and the approval of using easier acquisition associated mechanisms.
At present, there is in a large number α-amylase from Aspergillus (Aspergillus) be in the news and is used for industrial production, but only have the only a few bibliographical information to derive from excellent aspergillus (A.clavatus) α-amylase.The present invention clones from excellent aspergillus and has obtained a kind of α-amylase, and in aspergillus niger clonal expression, and enzyme activity is much higher than its enzyme in wild-type and lives.In addition, because excellent aspergillus is considered to virulent strain, aspergillus niger then is considered to safe bacterium (GRAS), so the present invention enlarges the range of application (such as field of food) of excellent aspergillus.
Summary of the invention
The purpose of this invention is to provide the diastatic bacterial strain of a kind of α-amylase and express alpha, to remedy the deficiencies in the prior art.
The α-amylase that the present invention filters out, its aminoacid sequence are SEQ ID NO:1, and its a kind of coding mRNA sequence is SEQ ID NO:2.
Aspect second, the present invention relates to enzyme composition, it comprises above-mentioned α-amylase.
Another aspect of the present invention relates to be used to the Aspergillus strain of expressing above-mentioned α-amylase;
The diastatic aspergillus niger of a kind of express alpha (Aspergillus Niger) P15 bacterial strain is kept at China Committee for Culture Collection of Microorganisms common micro-organisms center (CGMCC) that is positioned at No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City on August 15th, 2012, and strain number is CGMCC No.6434.
The resulting restructuring bacterial classification of the present invention can be expressed excellent aspergillus α-amylase AclaP15, its enzyme activity is much higher than its enzyme in wild mushroom lives (AclaP15 lives at the enzyme that wild-type strain can not detect), and is higher than the diastatic enzyme activity of Host Strains aspergillus niger oneself expression.Simultaneously, gained recombinant alpha amylase is by food safety bacterium (GRAS) aspergillus niger secretion gained, has enlarged the Application Areas of AclaP15.
Description of drawings
Fig. 1: the pGm plasmid map that the present invention uses;
Fig. 2: protein SDS-PAGE gel figure, the expression that has shown the AclaP15 of aspergillus niger transformant, and the protein expression situation of wild mushroom and Host Strains aspergillus niger G1, wherein swimming lane 1 is depicted as AclaP15 amylase expression, can see clear protein band at the 85kDa place.Swimming lane 2 is depicted as the protein standard molecular weight marker, is 116.0kD from left to right, 66.2kD, 45kD and 35kD; Swimming lane 3 is depicted as the protein expression situation of aspergillus niger host G1 behind fermentation 5d; Swimming lane 4 is depicted as the protein expression situation of wild mushroom, the protein expression that it can not detect.
Fig. 3: the pH stability of the AclaP15 that the aspergillus niger transformant is expressed;
Fig. 4: the temperature stability of the AclaP15 that the aspergillus niger transformant is expressed.
Embodiment
The present invention has used routine techniques and method commonly used in genetic engineering and biology field, MOLECULAR CLONING:A LABORATORY MANUAL for example, 3nd Ed. (Sambrook, 2001) and the technology of putting down in writing in the book of reference such as CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003).But this does not also mean that the present invention is defined in described any concrete grammar, experimental program and reagent, the scheme that those of ordinary skill in the art can select published technology to implement to put down in writing in the embodiment of the invention.
Unless be construed as limiting in addition in this article, whole technical terms used herein and scientific terminology have the common identical meanings of understanding of common counting personnel in the affiliated field of the present invention.DICTIONARY OFMICROBIOLOGY AND MOLECULAR BIOLOGY, 3nd Ed. (Singleton et al., 2006) and COLLINS DICTIONARY BIOLOGY (Hale et al., 2003) for the technician provides the generality explanation of employed many terms among the present invention, specific as follows:
As used herein, term " starch " refers to any material that the complicated polysaccharide carbohydrate of plant consists of, and comprises having (C
6H
10O
5)
xAmylose starch and amylopectin, wherein X can be any numeral.Particularly, this term refers to any material based on plant, includes but not limited to cereal, grass, stem tuber and root, more specifically, and wheat, oat, corn, rye, rice, Chinese sorghum, chaff, cassava, grain, potato and sweet potato.
As used herein, term " α-amylase " refers to the enzyme of catalysis Isosorbide-5-Nitrae-α-hydrolysis of glycoside bond.These enzymes also are described as be in the enzyme of the circumscribed or inscribe hydrolysis of finishing Isosorbide-5-Nitrae-α-D-glycosidic link in the polysaccharide of the D-Glucose unit of containing Isosorbide-5-Nitrae-α-connection.Another term that is used for these enzymes of description is " glycogenase (glycogenase) ".
As used herein, term " restructuring " when being used to refer to cell, nucleic acid, albumen or carrier is, represent this cell, nucleic acid, albumen or carrier by importing heterologous nucleic acids or albumen or being modified by changing natural acid or albumen, perhaps described cell comes from the cell of modification like this.Therefore, for example, reconstitution cell is expressed the gene of never finding in this cell of natural (non-restructuring) form, perhaps express natural gene, but these gene unconventionality expressions, expresses not enough or do not express fully.
As used herein, term " protein " and " polypeptide " in this article can Alternates.This paper uses traditional single-letter or the trigram code of amino-acid residue.
As used herein, term " signal sequence " expression in conjunction with the aminoacid sequence of protein N-terminal portions, its protein secreting that promotes mature form is to the extracellular.The definition of signal sequence is a kind of functional definition.The extracellular protein of mature form lacks signal sequence, and it is cut in secretion process.
As used herein, term " gene " refers to participate in producing the dna fragmentation of polypeptide, comprises before the coding region and zone afterwards, and the insertion sequence (intron) between each encode fragment (exon).
As used herein, term " nucleic acid " comprises DNA, RNA, strand or two strands, and their chemical modification object.
Unless otherwise mentioned, nucleic acid be by 5 ' write from left to right to 3 ' direction; Amino acid is to write from left to right by amino to the direction of carboxyl.
As used herein, term " nucleic acid " and " polynucleotide " in this article can Alternates.
As used herein, term " carrier " refers to be designed to nucleic acid is imported the polynucleotide sequence of one or more cell types.Carrier comprises cloning vector, expression vector, shuttle vectors, plasmid, phagemid, sequence box and analogue.
As used herein, term " expression vector " expression comprises the DNA construction of dna sequence dna, and described dna sequence dna can be affected the suitable control sequence that this DNA expresses by steerable being connected in suitable host.This type of control sequence can comprise the sequence of the termination that sequence, enhanser and the control of finishing the upper suitable ribosome bind site of operon sequence, coding mRNA that the promotor of transcribing, optional control transcribe is transcribed and translated.
As used herein, term " promotor " expression participate in conjunction with RNA polymerase with promotor gene transcribe regulating and controlling sequence.Promotor can be inducible promoter or constitutive promoter.
As used herein, when describing albumen or their gene of encoding is that the term that is used for this gene generally represents (the diastatic gene of the AclaP15 that for example encodes can be expressed as AclaP15) with italic.The term that is used for albumen generally represents (for example, the amylase by the AclaP15 genes encoding can be expressed as AclaP15) without italic.
As used herein, term " source (derived) " has contained that term " is derived from (originated from) ", " obtaining (obtained) ", " can obtain from (obtainable from) " and " separating from (isolated from) ", and as used herein, its expression is produced by the cell of natural this Nucleotide of existence or the cell that has been inserted into this nucleotide sequence by nucleotide sequence coded polypeptide.
As used herein, term " steerable connection (operably linked) " is to coordination, and wherein original paper allows them to arrange in the function mode of being mutually related.For example.If promotor is controlled transcribing of certain sequence, then this promotor operably is connected in this encoding sequence.
As used herein, term " selected marker (selective marker) " refers to the gene that can express in the host, and it makes it possible to select easily those to contain the host of nucleic acid or the carrier of importing.
The polynucleotide or the polypeptide that have the sequence identity of a certain per-cent with another sequence refer to that when being connected timing, base or the amino-acid residue of described per-cent are identical when comparing this two sequences.Described company is equipped with and homology or identity per-cent can be determined with any suitable software program known in the art, BLAST (Altschul et al.Basic local alignment search tool.Journal of MolecularBiology for example, 1990,215 (3): 403 – 410).Because genetic code is degeneracy, so can with more than one the codon specific amino acids of encoding, the present invention includes the polynucleotide of the specific aminoacid sequence of coding.
As used herein, term " host strain " or " host cell " refer to the suitable host of expression vector or DNA construction, and described expression vector or DNA construction comprise the diastatic polynucleotide of coding for alpha of the present invention.Particularly, host strain filamentous fungal cells preferably.This host cell can be wild-type filamentous fungal host cell or genetically modified host cell.Term " host strain " or " host cell " refer to the nucleus protoplastis that produced by the filamentous fungal strains cell.
As used herein, term " filamentous fungus " refers to that the Eumycotina of all thread forms is biological (referring to INTRODUCTORY MYCOLOGY, 4th Ed. (Alexopoulos, 2007) and AINSWORTHAND BISBY DICTIONARY OF THE FUNGI, 10th Ed. (Kirk et al., 2008)).The feature of these fungies is with the vegetative mycelium by the cell walls of chitin, Mierocrystalline cellulose and other complicated composition of Salvia polysaccharides.Filamentous fungus of the present invention is different from yeast at morphology, physiology and genetics.The the nourishing and growing of filamentous fungus is to finish by the extension of mycelia, and the carbon metabolism is obligate aerobic.In the present invention, the filamentous fungus parental cell can make, but be not limited to, Aspergillus certain (Aspergillus sp.) (excellent aspergillus (A.clavatus) for example, Aspergillus fumigatus (A.fumigatus), Aspergillus awamori (A.awamori), flavus (A.flavus), terreus (A.terreus) and aspergillus oryzae (A.oryzae)), Penicillium certain (Penicillium sp.) (for example Penicllium chrysogenum (Pchrysogenum)), Xin Satuo Pseudomonas certain (Neosartorya sp.) (for example Fei Xixinsatuo bacterium (N.fischeri)), gliocladium germ belongs to certain (Gliocladium sp.) (for example Gliocladium roseum (G.roseum)), Trichoderma certain (Trichoderma sp.) (Trichodermareesei (T.reesei) for example, viride (T.viride), healthy and free from worry wood mould (T.koningii), trichoderma harziarum (T.harzianum)), Humicola certain (Humicola sp.) (for example Humicola insolens (H.insolens) and grey humicola lanuginosa (H.grisea)), the gold mould genus of spore certain (Chrysosporium sp.), Fusarium certain (Fusarium sp.), the mould genus of arteries and veins spore certain (Neurospora sp.), the cell of Hypocrea certain (Hypocrea sp.) and Emericella certain (Emericella sp.).
As used herein, before term " aspergillus " or " Aspergillus certain " referred to or be classified as at present any fungi of Aspergillus.
As used herein, term " cultivation " instigates a group microorganism cells to be grown in the liquid or solid substratum under proper condition.
As used herein, the term " allos " of relevant polynucleotide or protein refers in host cell to be not naturally occurring polynucleotide or protein.This term intention comprises the protein by the gene of natural generation, mutator gene and/or synthetic gene coding.
As used herein, the term " endogenous " of relevant polynucleotide or protein is to naturally occurring polynucleotide or protein in host cell.
As used herein, cells involved used term " conversion ", " stable conversion " and " genetically modified " represents that this cell contains non-natural (for example allos) nucleotide sequence, and described nucleotide sequence is integrated into its genome or as the plasmid episomal that is held many generations.
About inserting in nucleotide sequence in the context in the cell, term " importing " expression " transfection ", " conversion " or " transduction ", comprise that expression is integrated into eucaryon or prokaryotic cell prokaryocyte with nucleotide sequence, wherein this nucleotide sequence can be integrated in the genome (for example karyomit(e), plasmid, plastid or Mitochondrial DNA) of this cell, be transformed into spontaneous replicon or by transient expression (for example mRNA of transfection).
As used herein, term " enzyme activity unit " refers under given conditions every interior enzyme amount that produces the product of specified rate of given time.In some embodiments, term " diastatic activity unit of force " (CU) is defined under given temperature and the pH condition, (under the condition of α-glucosidase) exist, per minute discharges the required enzyme amount of 1 micromole's p-NP (p-nitrophenol) from non-reducing-end blocked p-nitrophenyl maltoheptaoside (BPNPG7) substrate at excessive heat stability alpha-glucosidase.
" CGMCC " refers to Chinese common micro-organisms culture presevation administrative center, Beijing 100101, and China,
" ATCC " refers to American type culture collection, Manassas, and VA 20108, USA,
" NRRL " U.S. north Agricultural Research Institute culture collection center, Peoria, IL 61604, USA,
Recombinant expressed enzyme and host cell:
In some embodiments of the present invention, with the expressing heterologous α-amylase, preferred host cell is filamentous fungal cells to microorganism by genetic modification.
Some preferred fungal host cells comprise Aspergillus nidulans (A.nidulans), Aspergillus awamori, aspergillus oryzae, microorganism Aspergillus aculeatus (A.aculeatus), aspergillus niger, Japan wood mould (A.japonicus), Trichodermareesei, viride, Fusarium oxysporum (F.oxysporum) and Fusarium solani (F.solani).
In some embodiments, filamentous fungal host cell is certain bacterial strain of Aspergillus.Useful aspergillus host strain includes but not limited to Aspergillus nidulans (Yelton et al., Proc.Natl.Acad.Sci.USA, 1984,81:1470-1474; Mullaney et al., Mol.Gen.Genet., 1985,199:37-45; Johnstone et al.EMBO J., 1985,4:1307-1311); Aspergillus niger (Kelly et al., EMBO J., 1985,4:475-479); Aspergillus awamori (NRRL 3112, UVK 143f (USP 5364770), ATCC 22342, ATCC 44733 and ATCC 14331) and aspergillus oryzae (ATCC 11490).In further embodiment, filamentous fungal host cell is Aspergillus niger strain.
When following description is mentioned α-amylase especially such as AclaP15, it will be appreciated by those of ordinary skill in the art that same or analogous method is applicable to can be used for other the polynucleotide of α-amylase of encoding are respectively imported DNA construction and the carrier of host cell.
According to the present invention, the DNA construction that comprises the nucleic acid of coding for alpha amylase (such as AawaP2) is fabricated in order to import host cell.In some embodiments, by expression vector the DNA construction is imported host cell, described expression vector comprises the regulating and controlling sequence that operably is connected in α-amylase (such as AclaP 15) encoding sequence.
Carrier can be when to be imported into fungal host cells be any carrier that is integrated into the host cell gene group and is replicated.Carrier tabulation with reference to Fungal Genetics Stock Center Catalogue of Strains (FGSG,＜www.fgsc.net 〉).
In some embodiments, the nucleic acid of coding for alpha amylase (AclaP15) is connected in suitable promotor by steerable, and this promotor shows transcriptional activity in fungal host cells.This promotor can derive from the gene of the albumen of coding and host cell homology or allos.Preferably, promotor is useful in the aspergillus host.The limiting examples of useful promotor comprises and derives from coding Aspergillus awamori and aspergillus niger glucoamylase (glaA) (Nunberg et al., Mol.Cell Biol., 1984,4:2306-2315; USP 5364770; USP 6590078; Gwynne et al., Nat.Biotechnol., 1987,5:713-719; Boel et al., EMBOJ., 1984,3:1581-1585), the promotor of aspergillus niger α-amylase, aspergillus oryzae TAKA amylase and the neutral α-amylase gene of aspergillus niger.In further embodiment, promotor is the promotor of coding aspergillus niger glucoamylase gene.
In some embodiments, the steerable signal sequence that is connected in of the encoding sequence of α-amylase (AclaP15).The DNA of coded signal sequence is preferably with natural relevant with the gene that is expressed.In further embodiment, the signal sequence that is connected with the α-amylase encoding sequence is by the diastatic genes encoding of coding for alpha (for example, the signal sequence of AclaP15 is by the AclaP15 genes encoding).
In some embodiments, expression vector also comprises terminator sequence.The limiting examples of useful terminator comprises terminator (the Nunberg et al. of encode aspergillus niger, Tabin aspergillus (A.tubingensis) and Aspergillus awamori glucoamylase gene, Mol.Cell Biol., 1984,4:2306-2315 and Boel et al., EMBO J., 1984,3:1581-1585).In further embodiment, terminator sequence is the terminator of coding Tabin aspergillus glucoamylase gene.
In some embodiments, expression vector comprises selected marker.The example of preferred selected marker includes but not limited to give the mark (for example Totomycin, bleomycin, paraxin and phleomycin) of biocide patience.Give the gene of metabolic advantage, such as the Nutritional selectivity mark, also can be used for the present invention, comprise those marks known in the art such as amdS, argB and pry4.In further embodiment, selected marker is Aspergillus nidulans amdS gene, and its acetamidase of encoding can be grown take ethanamide as nitrogenous source the cell that is converted.Aspergillus nidulans amdS gene is applied in Kelly et al. as selected marker, EMBOJ., and 1985,4:475-479 and Penttila et al., Gene is described among 1987, the 61:155-164.
Comprise expression vector with the DNA construction of the diastatic polynucleotide of coding for alpha and can be can be in given fungal host biology self-replacation or be integrated into any carrier in the host DNA.In some embodiments, this expression vector is plasmid.In further embodiment, the promotor in the expression vector is the promotor of coding Glucoamylase Gene from Aspergillus niger, and terminator is the terminator of coding Tabin aspergillus glucoamylase gene, and selected marker is Aspergillus nidulans amdS gene.
The method of inserting expression vector for the polynucleotide with coding for alpha amylase (such as AclaP15) is well known in the art.Generally cut with ligation and finish by carry out enzyme at restriction site easily.In some embodiments, used restriction enzyme site is AflII and NotI.In other embodiments, used restriction enzyme site is XhoI and XbaI.
The conversion of host cell, expression and cultivation:
DNA construction or carrier importing host cell are comprised various technology such as conversion, electroporation, nuclear microinjection, transduction, transfection (for example transfection of the transfection of lipofection mediation and DEAE-Dextrin mediation), precipitate DNA, carry out high speed bombardment and protoplast fusion with the coated little projectile of DNA with the bath of calcium phosphate temperature.General transformation technology is known in the art.For transforming Aspergillus strain, with reference to Yelton et al., Proc.Natl.Acad.Sci.USA, 1984,81:1470-1474 and EP 238023.
Preferably, the transformant of inheritance stability makes up with carrier system, and the nucleic acid of the α-amylase (such as AclaP15) of coding is advanced in the host strain karyomit(e) by stable integration thus, then can be by known technology purifying transformant.
In a kind of limiting examples, stable conversion that comprises the amdS mark is by its speed of growth and form the circle clone of smooth but not edge roughness and distinguish with astable transformant faster on the solid medium of acetamide-containing.In addition, in some cases, further stability test can be by making transformant in Nonsele ctive culture media (substratum that namely the lacks ethanamide) growth of solid, from this substratum results spore, and determine to germinate subsequently and the percentage of these spores of growing at the selective medium of acetamide-containing recently carries out.Optionally, additive method known in the art can be used to select transformant.
In some embodiments, certain preparation of the Aspergillus that be used for to transform comprises the protoplast preparation (referring to Campbell et al., Curr.Genet., 16:53-56) from radicula byssoidea.Mycelium is to obtain from the trophozooid of sprouting.Mycelium is processed with the enzyme of peptic cell wall, produced protoplastis.Then by the homeo-osmosis agent that exists in the suspension medium protoplastis is protected.These stablizers comprise sorbyl alcohol, N.F,USP MANNITOL, Repone K, sal epsom and analogue.Usually the concentration of these stablizers changes between 0.8 ~ 1.2M.
Host strain can be determined by calcium ion concn the absorption of DNA.Generally speaking, the CaCl of 10 ~ 10mM
2Can be used in community's picked-up solution.Except the demand to calcium ion, other compounds that generally are included are buffer system such as TE damping fluid (10mM Tris (pH 7.4) and 1mMEDTA) or 10mM MOPS (pH 6.0) damping fluid and polyoxyethylene glycol (PEG) in picked-up solution.
Usually in conversion, use contain host cell or protoplastis such as Aspergillus certain protoplastis or the suspension of cell, described protoplastis or cell are with about 10
7The density of individual/mL is processed through perviousness.In some embodiments, with these protoplastiss of about 100 μ L volumes or the suitable solution of cell (for example 1.2M sorbyl alcohol and 50mM CaCl
2) mix with the DNA of expectation.In some embodiments, the PEG with high density adds in the picked-up solution.The 25%PEG 4000 that can add 0.1 ~ 1 volume in the protoplastis suspension.Yet, preferably in protoplastis suspension, add about 0.25 volume.Additive such as methyl-sulphoxide, heparin, spermidine, Repone K and analogue also be introduced in the picked-up solution and help to transform.Similarly method can be used for other fungal host cells (with reference to USP 6022725 and 6268328).
General, then mixture is bathed 10 ~ 30min in about 0 ℃ of temperature.In mixture, add extra PEG with the picked-up of further reinforcement to required gene or dna sequence dna.In some embodiments, 25% PEG 4000 that adds 5 to 15 times of volumes of transformation mixture.But more or less volume all may be suitable.25% PEG 4000 is about 10 times of transformation mixture volume preferably.After adding PEG, can with transformation mixture in the bath of room temperature temperature or at ice bath on ice, then add sorbyl alcohol and CaCl
2Solution.Then protoplastis suspension is further joined in a small amount of equal portions growth medium of fusing.That it only allows transformant growth when growth medium comprises growth selection condition (for example ethanamide or microbiotic).
Generally speaking, cell is cultured in the standard medium that contains physiology salt and nutrition agent (referring to Pourquie etal., BIOCHEMISTRY AND GENETICS OF CELLULOSE DEGRADATION, Academic Press, 1988,71-86 and Ilmen et al., Appl.Environ.Microbiol., 1997,63:1298-1306).Common business arrangement substratum (for example Yeast Malt Extract (YM) meat soup, LuriaBertani (LB) meat soup and Sabouraud Dextrose (SD) meat soup) also can be used for the present invention.
Culture condition also is standard (for example with culture in the shaking table incubator, about 30 ℃ of lower temperature are bathed until reach required α-amylase (such as AclaP15) expression level in suitable medium).The culture condition of given filamentous fungus is known in the art and can finds in scientific literature and/or from source such as American type culture collection (ATCC) and the genetic of fungi preservation center (FGSC) of this fungi.
The analysis of expression of enzymes and the mensuration of enzyme activity:
When mentioning α-amylase especially, following description such as AclaP15, it will be appreciated by those of ordinary skill in the art that same or analogous method is applicable to the analysis of AclaP15 expression and the mensuration of enzyme activity.
In order to estimate the expression of α-amylase (such as AclaP15), can analyze at protein level or nucleic acid level.Adaptable analytical procedure comprises Northern trace, Dot blot (DNA or RNA analyze), Southern trace, radioautograph, RT-PCR (ThermoScript II polymerase chain reaction) and contains the in situ hybridization that the probe (based on nucleic acid coding sequence) of suitable mark carries out.In addition, genetic expression can be passed through immunological method, such as the immunohistochemical staining of cell, tissue slice or the immunity test of tissue culture medium (TCM).For example assess by Western trace or ELISA.Such immunity test can be used for estimating qualitatively and quantitatively the expression of α-amylase (such as AclaP15).The details of these class methods is well known by persons skilled in the art, and can commercially obtain for many reagent of implementing these class methods.In some embodiments, the SDS-PAGE that passes through of the expression of α-amylase (such as AclaP15) analyzes.
The vigor of α-amylase (such as AclaP15) can pass through Miller, Anal.Chem., and the DNS method described in 1959, the 31:426-428 is measured.Enzyme activity also can be measured (with reference to GB 8275-2009 and GB/T 24401-2009) by the ability of analytical unit time liquefaction Zulkovsky starch.In some embodiments, the vigor of α-amylase (such as AclaP15) is by using α-amylase vitality test test kit (Megazyme) to measure.
Below in conjunction with specific embodiment α-amylase of the present invention and recombinant bacterial strain are described.
In following disclosure and experimental section, use following shortenings:
AclaP15 (α-amylase with the described aminoacid sequence of SEQ ID NO:1), ℃ (degree centigrade), rpm (rotating speed of per minute), dlH2O (deionized water, Milli-Q filters), kD (kilodalton), g (gram), mg (milligram), μ g (microgram), cm (centimetre), μ m (micron), L (liter), mL (milliliter), μ L (microlitre), M (volumetric molar concentration), mM (millimolar concentration), CU (enzyme unit alive), min (minute), h (hour), d (my god), Tris (Tutofusin tris), SDS (sodium lauryl sulphate), PAGE (polyacrylamide gel electrophoresis), MOPS (morpholine propanesulfonic acid).
Embodiment 1 clone's α-amylase Gene A claP15
According to the specification sheets of manufacturers, use fungal genomic DNA to extract test kit (Omega) and from excellent aspergillus CGMCC 3.5289 overnight culture, extract genomic dna.
According to the sequences Design PCR primer that is numbered XM_001275619 on the NCBI, as follows for the forward primer AclaP15-F sequence of the AclaP15 gene of cloning excellent aspergillus:
5’-GACT
CTCGAGTGGATGCGCGAGTCATTGTACTA
(sequence shown in the underscore is the XhoI restriction enzyme site),
Reverse primer AclaP15-R sequence is:
5’-GTGCTCTAGACC
TCTAGAACACCCAGCTAATAA
(sequence shown in the underscore is the XbaI enzyme cutting site).
This gene is increased out from excellent aspergillus genomic dna with Phusion archaeal dna polymerase (Thermo scientific).
Amplification condition:
The first step: 98 ℃ keep 3min.
Second step: 98 ℃ keep 10s, and then 72 ℃ keep 75s, and this step repeats 30 times.
The 3rd step: 72 ℃ keep 10min.
Use the gel-purified test kit with above-mentioned PCR product purification, with restriction enzyme XhoI and XbaI (Fermentas) sublimed PCR product is carried out enzyme and cut; Simultaneously, with restriction enzyme XhoI and XbaI to plasmid pGm(genetic map such as Fig. 1) carry out enzyme and cut.Use the gel-purified test kit that enzyme is cut product purification, and with T4DNA ligase enzyme (Fermentas) above-mentioned two enzymes are cut the product connection.To connect product and transform into Trans5 α intestinal bacteria (Transgen), select with penbritin.For guaranteeing accurately, to some clones check order (Invitrogen).
According to the specification sheets of manufacturers, use amount preparation test kit (Axygen) plasmid purification from the correct escherichia coli cloning of sequencing result in the plasmid.The gained plasmid is pGm-AclaP15, and the nucleotides sequence that records is classified SEQID NO:2 as, and the amino acid of its translation (albumen) sequence is SEQ ID NO:1.
The protoplast fusion of embodiment 2:PEG mediation transforms aspergillus niger
Draw aspergillus niger G1 spore suspension in the dull and stereotyped center (9cm culture dish) of CMA, treat that bacterium colony covers with whole culture dish, cut the cultivation of 1/4 size based in the 200mL CMA liquid nutrient medium, cultivate 14 ~ 16h at 30 ℃, the condition of 200rpm.
Collect mycelium with aseptic Miracloth filter cloth, and with the solution A cleaning once, the mycelium that will clean under aseptic condition is transferred to 40mL protoplast formation solution, and temperature is bathed 1 ~ 2h under 30 ℃, the condition of 200rpm, detects the protoplast formation progress with microscopic examination.
With the above-mentioned temperature body lotion of aseptic Miracloth filter-cloth filtering body, gained filtrate is protoplastis solution.Protoplastis solution is sub-packed in the aseptic disposable centrifuge tube of two 50mL, and the volume of every pipe is settled to 45mL with solution B, centrifugal 8min is to obtain precipitation and abandoning supernatant under the 4000rpm condition.With 20mL solution B twice of washing and precipitating again.Pellet resuspended in the 10mL solution B, and is counted protoplastis with blood counting chamber.With protoplastis recentrifuge and abandoning supernatant, according to the blood counting chamber count results, add the resuspended precipitation of an amount of solution B, so that the protoplastis number is 1 * 10
7Individual/mL.
On ice, the above-mentioned protoplastis solution of 100 μ L is added in the aseptic 15mL centrifuge tube of precooling, each conversion reaction is managed with 1.Add 10 μ g plasmids.Add 12.5 μ L solution C, place again 20min behind the gentle mixing on ice.
With MMSA top-agar test tube fusing and remain on 55 ℃.From ice, shift out above-mentioned 15mL centrifuge tube, and Xiang Guanzhong adding 1mL solution C and 2mL solution B, each pipe of gentle mixing, the gained mixture is the protoplastis mixture.Add the above-mentioned protoplastis mixture of 1mL in 3 top-agar test tubes each, and topple over immediately with the MMSA flat board on, and with flat board at 30 ℃ of lower 7 ~ 10d that cultivate.
Solution A: 2.5mL 1M K
2HPO
4, 2.5mL 1M KH
2PO
4, 48.156g MgSO
4, add dlH
2O is to final volume 500mL, with the filtering with microporous membrane degerming of 0.22 μ m.
Solution B: 5mL 1M Tris (pH 7.5), 2.77g CaCl
2, the 109.32g sorbyl alcohol adds dlH
2O is to final volume 500mL, with the filtering with microporous membrane degerming of 0.22 μ m.
Solution C: 250g PEG 4000,2.77g CaCl
2, 5mL 1M Tris (pH 7.5) adds dlH
2O is to final volume 500mL, with the filtering with microporous membrane degerming of 0.22 μ m.
Protoplast formation solution: 0.6g lyase (Lysing Enzyme from Trichodermaharzianum, Sigma) is dissolved in the 40mL solution A, with the filtering with microporous membrane degerming of 0.22 μ m.
MMSA is dull and stereotyped: 0.59g ethanamide (Sigma), 3.4g CsCl (Sigma), 0.52g KCl, 1.52g KH
2PO
4, the 218.5g sorbyl alcohol, 1mL trace elements (seeing lower), 20g agar adds dlH
2O adds 25mL40% glucose and 2.5mL 20% MgSO with the filtering with microporous membrane degerming of 0.22 μ m to final volume 972.5mL behind the high pressure steam sterilization
4
MMSA top-agar test tube: 0.59g ethanamide (Sigma), 3.4g CsCl (Sigma), 0.52g KCl, 1.52g KH
2PO
4, the 218.5g sorbyl alcohol, 1ml trace elements (seeing lower), the 10g low melting-point agarose adds dlH
2O behind the high pressure steam sterilization, when substratum does not solidify, adds 25mL 40% glucose and 2.5mL 20% MgSO with the filtering with microporous membrane degerming of 0.22 μ m to final volume 972.5mL
4, be sub-packed in immediately afterwards in the sterile test tube every pipe 10mL.
Trace elements: at 250mL dlH
2Add 1g FeSO among the O
47H
2O, 8.8g ZnSO
47H
2O, 0.4g CuSO
45H
2O, 0.15g MnSO
44H
2O, 0.1g Na
2B
4O
710H
2O, 50mg (NH
4)
6Mo
7O
244H
2O, the dense HCl of 0.2mL uses dlH after the dissolving fully
2O is settled to 1L, with the filtering with microporous membrane degerming of 0.22 μ m.
CMA is dull and stereotyped: 20g glucose, and 20g Fructus Hordei Germinatus extract, the 1g peptone, 15g agar adds dlH
2O is to final volume 1000mL, autoclaving.
The CMA liquid nutrient medium: 20g glucose, 20g Fructus Hordei Germinatus extract, the 1g peptone adds dlH
2O is to final volume 1000mL, autoclaving.
After growing bacterium colony on the flat board, select 25 bacterium colonies, according to the specification sheets of manufacturers, use fungal genomic DNA to extract test kit (Omega) and from its overnight culture, extract genomic dna.Carry out the PCR checking by experimental procedure described in the embodiment 1, gained PCR product is checked order.The spore suspension of gained positive colony is inoculated in the 25mL TSB fermention medium, at 30 ℃, cultivates 3d under the condition of 200rpm, and the gained fermented liquid is with 8 layers of filtered through gauze, and filtrate is centrifugal 10min under 14000 * g condition, collects supernatant liquor.The gained supernatant liquor is enzyme liquid.Be that 8% SDS-PAGE glue carries out electrophoresis with enzyme liquid in concentration, the positive colony that goes out to have obvious band at 55kD carried out the enzyme biopsy survey.According to the specification sheets of manufacturers, measure amylase activity in the enzyme liquid with α-amylase vitality test test kit (Megazyme).Choosing the enzyme activity soprano further studies as P15 amylase recombinant bacterium.With aspergillus niger P15(Aspergillus Niger) be stored in Chinese common micro-organisms culture presevation administrative center (CGMCC) on August 15th, 2012, strain number is CGMCC No.6434.
Embodiment 3: express the fermentation of aspergillus niger of excellent aspergillus α-amylase AclaP15 and the expression of enzyme
The mensuration of the expression of AclaP15 amylase in aspergillus niger and its optimum pH, temperature
The spore suspension of expressing the diastatic aspergillus niger transformant of AclaP15 is inoculated in the 25mL TSB fermention medium, at 30 ℃, cultivates 5d under the condition of 200rpm.The gained fermented liquid is with 8 layers of filtered through gauze, and filtrate is centrifugal 10min under 14000 * g condition, collects supernatant liquor.The gained supernatant liquor is AclaP15 amylase enzyme liquid.Be that 8% SDS-PAGE glue carries out electrophoresis (Fig. 2) with enzyme liquid in concentration.
Electrophoresis result is presented at the 85kD place can see obvious band, and wild mushroom does not have the visible protein band, and Host Strains does not have the visible protein band in this position yet.
According to the specification sheets of manufacturers, measure amylase activity in the enzyme liquid with α-amylase vitality test test kit (Megazyme).Under 5.4,40 ℃ of conditions of pH, the enzyme of AclaP15 (CU/mL) alive is 131.9CU/mL, and the enzyme of Host Strains G1 is lived and is that it is 0CU/mL that 46CU/mL, the enzyme of wild mushroom live.The work of recombinase AclaP15 enzyme is lived apparently higher than the enzyme of Host Strains and enzyme that wild mushroom produces.
Prepare the Sodium phosphate dibasic-citrate buffer solution (pH 2.4, and pH 3.0, and pH 3.6, pH4.2, pH 4.8, pH 5.4, pH 6.0, pH 6.6, pH 7.2, pH 7.8) of a series of pH values.Enzyme liquid is worth damping fluid to be diluted to suitable concentration with above-mentioned different pH, under 40 ℃, according to the specification sheets of manufacturers, measures amylase activity in the enzyme liquid with α-amylase vitality test test kit (Megazyme).Fig. 3 has illustrated the pH stability of the AclaP15 that the aspergillus niger transformant is expressed.
The result shows that the optimal pH of AclaP15 is 5.4.
Enzyme liquid is diluted to suitable concentration with the Sodium phosphate dibasic-citrate buffer solution of the optimum pH that above-mentioned experiment is determined, specification sheets according to manufacturers, under differing temps (30 ℃, 40 ℃, 50 ℃, 60 ℃, 70 ℃, 80 ℃), with amylase activity in the α-amylase vitality test kit measurement enzyme liquid.Fig. 4 has illustrated the temperature stability of the AclaP15 that the aspergillus niger transformant is expressed, and the result shows that the AclaP15 optimal reactive temperature is 50 ℃.
Embodiment 4: the application example of express alpha amylase AclaP15
Adopt sponge dough method technique to make bread.Bread powder is selected the bread basic powder (not adding any additive) of roc Thailand; The Angel TH bread yeast; Add human relations board shortening.By the variation of research bread hardness and the relation between the α-amylase addition, find that α-amylase AclaP15 has certain antiageing effect.Research finds that when the interpolation scope was 0.5-1.5ml/100g flour, α-amylase AclaP15 can increase the specific volume of bread significantly, reduced the hardness of bread shell and crumb, improved the bread quality, improves the baking quality of bread.α-amylase can improve the volume of bread, and the mouthfeel of improvement bread makes the small product size such as bread larger, and particle is more soft, and the quality that improves bread is had great significance.The present invention is applied to the theoretical foundation that provides certain in the bread industry for α-amylase as bread additives.
Claims (6)
1. a α-amylase is characterized in that described α-amylase aminoacid sequence is SEQ ID NO:1.
2. a Nucleotide is characterized in that described Nucleotide is used for encoding α-amylase claimed in claim 1.
3. Nucleotide as claimed in claim 2, its sequence is SEQ ID NO:2.
4. an enzyme composition is characterized in that described enzyme composition includes α-amylase claimed in claim 1.
5. Aspergillus strain is characterized in that, described Aspergillus strain is used for expressing α-amylase claimed in claim 1.
6. Aspergillus strain as claimed in claim 5 is characterized in that described Aspergillus strain is that its deposit number of aspergillus niger P15 is CGMCC No.6434.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210383398.2A CN102925420B (en) | 2012-10-10 | 2012-10-10 | Alpha amylase and recombinant strain for expressing same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210383398.2A CN102925420B (en) | 2012-10-10 | 2012-10-10 | Alpha amylase and recombinant strain for expressing same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102925420A true CN102925420A (en) | 2013-02-13 |
| CN102925420B CN102925420B (en) | 2014-01-08 |
Family
ID=47640351
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210383398.2A Active CN102925420B (en) | 2012-10-10 | 2012-10-10 | Alpha amylase and recombinant strain for expressing same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102925420B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103695388A (en) * | 2013-12-16 | 2014-04-02 | 青岛蔚蓝生物集团有限公司 | Alpha amylase and aspergillus niger strain for expressing same |
| CN104004729A (en) * | 2014-01-23 | 2014-08-27 | 青岛蔚蓝生物集团有限公司 | Aspergillus niger strain producing alpha-amylase, and its application |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106591261A (en) * | 2015-10-14 | 2017-04-26 | 中国科学院天津工业生物技术研究所 | Alpha amylase and mutant strain with high yield of alpha amylase |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1500870A (en) * | 2002-11-19 | 2004-06-02 | 中国科学院微生物研究所 | Alkalinealpha- amylase, coding gene and uses thereof |
-
2012
- 2012-10-10 CN CN201210383398.2A patent/CN102925420B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1500870A (en) * | 2002-11-19 | 2004-06-02 | 中国科学院微生物研究所 | Alkalinealpha- amylase, coding gene and uses thereof |
Non-Patent Citations (2)
| Title |
|---|
| GENBANK: "XM_001275619.1 GI:121716021", 《GENBANK》 * |
| GENBANK: "XP_001275620.1 GI:121716022", 《GENBANK》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103695388A (en) * | 2013-12-16 | 2014-04-02 | 青岛蔚蓝生物集团有限公司 | Alpha amylase and aspergillus niger strain for expressing same |
| CN103695388B (en) * | 2013-12-16 | 2015-12-02 | 青岛蔚蓝生物集团有限公司 | α-amylase and the diastatic Aspergillus niger strain of express alpha |
| CN104004729A (en) * | 2014-01-23 | 2014-08-27 | 青岛蔚蓝生物集团有限公司 | Aspergillus niger strain producing alpha-amylase, and its application |
| CN104004729B (en) * | 2014-01-23 | 2016-06-01 | 青岛蔚蓝生物集团有限公司 | The Aspergillus niger strain of a kind of ��-amylase Producer and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102925420B (en) | 2014-01-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1648996B1 (en) | Enzymes for starch processing | |
| CN101084308B (en) | Heterologous alpha amylase expression in aspergillus | |
| EP2336308B1 (en) | Enzymes for starch processing | |
| EP2408910B1 (en) | Chrysosporium lucknowense protein production system | |
| CN102482665B (en) | Novel protein having beta-glucosidase activity, and use thereof | |
| CN107299123A (en) | The variant of glucoamylase | |
| CN104619836A (en) | Variants having glucoamylase activity | |
| JP2015500041A (en) | Enzyme cocktail prepared from mixed culture | |
| CN103695388B (en) | α-amylase and the diastatic Aspergillus niger strain of express alpha | |
| CN102994475A (en) | Alpha-amylase and recombinant strain for expressing alpha-amylase | |
| CN102925420B (en) | Alpha amylase and recombinant strain for expressing same | |
| CN103695323B (en) | Stable and high-yield strain for alpha-transglucosidase | |
| CN104004729B (en) | The Aspergillus niger strain of a kind of ��-amylase Producer and application thereof | |
| CN103695383B (en) | Aspergillus niger strain for efficiently expressing alpha-transglucosidase | |
| JP2021514679A (en) | Recombinant oxalate decarboxylase expressed by filamentous fungal host cells | |
| CN104152422A (en) | Alpha transglucosidase and bacterial strain for expression of alpha transglucosidase | |
| CN102827816B (en) | Alpha-amylase and application thereof | |
| CN106591261A (en) | Alpha amylase and mutant strain with high yield of alpha amylase | |
| CN104099306A (en) | Alpha transglucosidase and recombinant expression bacterial strain thereof | |
| CN103740599B (en) | Strain for producing alpha-transglucosidase and application thereof | |
| CN103820482A (en) | Silent vector for silent fusarium endogenous genes, and application thereof | |
| RU2736441C1 (en) | Yeast strain komagataella kurtzmanii, producing beta-glucanase from bacillus pumilus and beta-glucanase from paenibacillus jamilae | |
| RU2747782C1 (en) | Recombinant yeast strain ogataea haglerorum producing beta-mannanase bacillus subtilis | |
| RU2764793C1 (en) | Yeast transformant ogataea haglerorum producing beta-mannanase, containing synthetic mans gene in chromosome | |
| RU2736440C1 (en) | Yeast komagataella kurtzmanii - recombinant producer of beta-gluconase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: TIANJIN INSTITUTE OF INDUSTRIAL BIOTECHNOLOGY, CHI Free format text: FORMER OWNER: TIANJIN INSTITUTE OF INDUSTRIAL BIOTECHNOLOGY Effective date: 20140409 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20140409 Address after: 300308, No. 32, seven West Road, Tianjin Airport Economic Zone, Dongli, Tianjin Patentee after: Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences Address before: 300308, No. 32, seven West Road, Tianjin Airport Economic Zone, Dongli, Tianjin Patentee before: Tianjin Institute of Industrial Biotechnology |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20191220 Address after: 253300 talent apartment, Wucheng Development Zone, Dezhou City, Shandong Province Patentee after: Shandong Zhongke Biological Innovation Industrial Park Management Co., Ltd Address before: 300308, No. 32, seven West Road, Tianjin Airport Economic Zone, Dongli, Tianjin Patentee before: Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences |