CN102911938A

CN102911938A - siRNA (si Ribonucleic Acid) sequence for targeted restrain of POLD1 genetic expression

Info

Publication number: CN102911938A
Application number: CN2012102765070A
Authority: CN
Inventors: 许瑞安; 张均平
Original assignee: Huaqiao University
Current assignee: Huaqiao University
Priority date: 2012-08-03
Filing date: 2012-08-03
Publication date: 2013-02-06
Anticipated expiration: 2032-08-03
Also published as: CN102911938B

Abstract

The invention provides an siRNA (si Ribonucleic Acid) sequence for targeted restrain of POLD1 genetic expression. 3' ends of a positive-sense strand and a negative-sense strand of the siRNA sequence both use UU or dTdT as dangling modification, the siRNA sequence is affected on cancer cells to detect changes of the cancer cells on proliferation, movement transferring and cell cycles after a POLD1 gene is restrained by POLD1 siRNA, a time fluorescent quantitation PCR and protein western blot method is used for detecting to discover that POLD1 siRNA1 and POLD1 siRNA4 can obviously regulate POLD1 mRNA and protein level expression, influences of POLD1 siRNA synthesized by designs on biological characteristics such as proliferation and movement transferring of the cancer cells are checked on NC1-H446 cells of non-small cell lung cancer, and the siRNA sequence lays a foundation for clinical application of POLD1 siRNA of tumorous treatment.

Description

A kind of target suppresses the siRNA sequence of POLD1 genetic expression

[technical field]

The present invention relates to molecular biology and biomedicine field, relate in particular to the siRNA sequence that a kind of target suppresses POLD1 genetic expression.

[background technology]

Dna replication dna is one step of key of cell proper splitting, propagation.Archaeal dna polymerase δ (pol δ) is the main replicative enzyme that eukaryotic dna copies, and in mammalian cell, pol δ is comprised of 4 subunits, is respectively p125, p50, p68, p12.The p125 subunit is its catalytic subunit, has 5 '-3 ' polymerase activity and 3 '-5 ' exonuclease activity, this make this enzyme at dna replication dna, repair, keep in genome stability, restructuring and the cell cycle regulating and all play an important role.The malignant proliferation of cancer needs the massive duplication of DNA to satisfy the cell fission activity that it continues.In recent years, gradually studied person's attention of the relation between pol δ and the cell carcinogenesis.Experimental studies have found that both at home and abroad, the expression of p125 and the grade malignancy of liver tumor, tumour cell differentiation degree, vein invasion and attack and Intrahepatic metastasis are closely related.The hepatoma cell line Hep3B of p125 high expression level and the invasive ability of HepG2 obviously are better than the low Huh7 clone of expressing of p125.The expression of p125 and POLD1mRNA (POLD1 is the gene of coding DNA polymerase delta catalytic subunit p125) express and to be proportionate, and reticent POLD1 genetic expression on transcriptional level can obviously reduce the invasive ability of liver cancer cell.The POLD1 gene is the gene that multiple proliferative regulatory gene finally produces effect, and also the variation of possibility self is exactly the major reason of cell carcinogenesis.In liver cancer cell HepG2, the 472nd codon of POLD1 gene sports Histidine by tyrosine; The Hotspot region of breast cancer susceptibility gene BRCA1/2 is just hidden on the POLD1 gene; The sudden change of POLD1 gene makes the incidence of mammary cancer increase by 2 times.In Mice Body, with behind the D400 site mutation of an allelic ExoII of POLD1 gene functional zone, can bring out mouse lymph cancer and epithelial cancer.In addition, in colorectal carcinoma, cervical cancer, also found the high expression level of POLD1 gene.Therefore, illustrate the mechanism of POLD1 genetic expression or the suppressed rear direct blocking-up cancer cell multiplication of p125 functionally active by further research, the useful effect target spot of isolation identification blocking-up cancer cells abnormality proliferation is for new drug development provides the most definite theoretical foundation.

It is the novel method that a kind of suppressor gene of growing up is in recent years expressed that little RNA disturbs (small interference RNA, RNAi) technology.The high degree of specificity of RNAi effect might suppress specifically the mutation allele that causes a disease, but not affect the normal allele function, so RNAi has broad application prospects in gene therapy.After the RNAi mechanism of action is double-stranded RNA (dsRNA) transfered cell, under the effect of Dicer enzyme, be degraded to 21-23bp, 3 ' end is with the siRNA of 2 outstanding bases, and with intracellular nucleic acid in the combination such as excision enzyme, desmolase, Argonaute albumen, formation has the ribonucleotide albumen composition-RISC (RNA-inducing silencing complex) of a plurality of subunits, the degraded of the endogenic homologous mRNA of efficient laddering mediated cell.In the mammalian cell, import long dsrna and can cause genetic expression extensively to suppress, directly use the same efficient mediate rna i of siRNA of short two strands, and avoid non-specific gene inhibition effect.And short double-stranded siRNA is easily synthetic by chemical process, and is easy and simple to handle, transfection efficiency is high, and is little to toxic side effect cell or tissue, can prepare on a large scale, and clinical application is convenient, has irreplaceable advantage aspect drug development.

But, since the base distribution of siRNA, the impact of the factors such as secondary structure of two ends free energy size and said target mrna, the siRNA of the different target spots of target same gene mRNA, the successful of sealing genetic expression is different.In the experiment of the reticent specific gene of siRNA, for guaranteeing siRNA energy efficient degradation said target mrna, generally need to for synthetic many not homotactic siRNA of target gene design, therefrom filter out ordered sequence.Effectively the design of siRNA sequence screening is one of key point of siRNA mediate rna i experiment.

[summary of the invention]

The technical problem to be solved in the present invention is to provide a kind of target to suppress the siRNA sequence of people POLD1 genetic expression, can efficiently suppress the expression of POLD1 gene, thereby the promotion death of neoplastic cells is shifted in the growth, propagation and the motion that suppress tumour.

The present invention is achieved in that

A kind of target suppresses the siRNA sequence of people POLD1 genetic expression, and described siRNA sequence comprises at least one in following eight sequences:

POLD1siRNA1 sequence, its positive-sense strand are 5 ' CCCACCAUCAGCCAUAGAU3 ', and its antisense strand 5 ' is AUCUAUGGCUGAUGGUGGG3 ';

POLD1siRNA2 sequence, its positive-sense strand are 5 ' GUUGGAGAUUGACCAUUAU3 ', and its antisense strand is 5 ' AUAAUGGUCAAUCUCCAAC3 ';

POLD1siRNA3 sequence, its positive-sense strand are 5 ' CCACCUUCAUCCGUAUCAU3 ', and its antisense strand is 5 ' AUGAUACGGAUGAAGGUGG3 ';

POLD1siRNA4 sequence, its positive-sense strand are 5 ' CCGGUUACAACAUCCAGAA3 ', and its antisense strand is 5 ' UUCUGGAUGUUGUAACCGG3 ';

POLD1siRNA5 sequence, its positive-sense strand are 5 ' CAGACCCUCAAGGUACAAA3 ', and its antisense strand is 5 ' UUUGUACCUUGAGGGUCUG3 ';

POLD1siRNA6 sequence, its positive-sense strand are 5 ' GCCUGACUGAGGAUCAGUUCA3 ', and its antisense strand is 5 ' UGAACUGAUCCUCAGUCAGGC3 ';

POLD1siRNA7 sequence, its positive-sense strand are 5 ' GGUGGAGUCUAAGUACACA3 ', and its antisense strand is 5 ' UGUGUACUUAGACUCCACC3 ';

POLD1siRNA8 sequence, its positive-sense strand are 5 ' GGACCAGGGAGAAUUAAUA3 ', and its antisense strand is 5 ' UAUUAAUUCUCCCUGGUCC3 '.

Further, described siRNA sequence comprises following three sequences:

POLD1siRNA4 sequence, its positive-sense strand are 5 ' CCGGUUACAACAUCCAGAA3 ', and its antisense strand is 5 ' UUCUGGAUGUUGUAACCGG3 '.

Further, described siRNA sequence comprises following two sequences:

The present invention has following advantage:

At first, the POLD1 gene is the good target spot of therapy of tumor, and the RNAi technology of using the siRNA mediation can suppress the expression of target gene more efficient, special than any means in the past, easily.The invention provides the siRNA sequence that can efficiently suppress POLD1 genetic expression, and act on tumour cell, after detecting POLD1 siRNA inhibition POLD1 genetic expression, tumour cell is in the variation of the aspects such as propagation, motion transfer, cell cycle, and the clinical treatment that is applied to malignant tumour for POLD1 siRNA is established important foundation.

Secondly, the invention provides the siRNA sequence that can efficiently suppress POLD1 genetic expression, for important foundation is established in the further research of POLD1 gene function, thereby the promotion death of neoplastic cells is shifted in the growth, propagation and the motion that suppress tumour.By in the research cancer cells to the inhibition of the carcinous expression of POLD1 gene and the carcinous performance of p125 functionally active, seek the target spot of cancer cell multiplication blocking-up, for the most effective new anticancer or inhibition of cell proliferation disease medicament of development is provided fundamental basis.

[description of drawings]

The present invention is further illustrated in conjunction with the embodiments with reference to the accompanying drawings.

Fig. 1 is that mtt assay detects as a result figure of POLD1siRNA anticancer propagation;

Fig. 2 is that fluorescence real-time quantitative PCR detects as a result figure of restraining effect that POLD1siRNA expresses POLD1mRNA;

Fig. 3 A is protein electrophorese figure;

Fig. 3 B is relative expression's spirogram of P125 protein.

Fig. 4 is as a result figure of microscope observing cell metamorphosis;

Fig. 5 is HE dyeing observation of cell nuclear morphology result of variations figure;

Fig. 6 is as a result figure of colony formation;

Fig. 7 is that Transwell detects as a result figure of cell movement transfer ability;

Fig. 8 is the two as a result figure of Flow cytometry apoptosis that dye of AnnexinV-PI;

Fig. 9 is that PI singly dyes, and the flow cytometry cell cycle is figure as a result.

[embodiment]

The present invention relates to the siRNA sequence that a kind of target suppresses people POLD1 genetic expression, described siRNA sequence comprises at least one in following eight sequences:

More excellent, described siRNA sequence comprises following three sequences:

More excellent, described siRNA sequence comprises following two sequences:

3 ' end of each positive-sense strand in the described siRNA sequence and antisense strand all with UU or dTdT for the modification of dangling.The acquisition pattern of siRNA sequence of the present invention is as follows:

Obtain people POLD1mRNA sequence (LOCUS NM_002691.2) according to bioinformatics method at genebank, adopt RNA structure analysis software that the secondary structure of POLD1mRNA sequence is predicted, sum up the siRNA principle of design that in the past proposed, the secondary structure of its GC content of analysis-by-synthesis, two ends free energy size, mRNA action site, siRNA be to the requirement of base preferences etc., design siRNA series.According to the evaluation of this software to the siRNA series designed, the BLAST software that further adopts NCBI GenBank (u.s. national library of medicine and NIH write) to provide, the target sequence of selecting is carried out the homology analysis, get rid of the possibility that siRNA non-specifically suppresses other gene fragments, preliminary screening goes out 8 siRNA sequences, and entrusts Shanghai JiMa pharmacy Technology Co., Ltd on behalf of synthetic above-mentioned 8 siRNA sequences.

The base sequence of described 8 siRNA sequences, action site, GC content and evaluation grade are as shown in table 1.

Table 1

Below in conjunction with each embodiment, the present invention will be further described.

Embodiment 1:MTT method is measured POLD1siRNA sequence anticancer propagation

With the human small cell lung carcinoma NCI-H446 cell of logarithmic phase, be inoculated in 96 orifice plates by the density in 5 * 103/hole, cultivate 18h in 37 ℃, the saturated humidity incubator of 5%CO2, cell converges approximately 40%, carries out the POLD1siRNA transfection.Exhaust the supernatant nutrient solution, every hole adds 100 μ L serum-free Opti-MEM nutrient solutions.Dilute respectively mixing POLD1siRNA and liposome lipofectamineTM2000 (Invitrogen) with serum-free Opti-MEM nutrient solution, behind the static 5min of room temperature, with POLD1siRNA and liposome solutions equal-volume mixing, room temperature is again behind the static 20min, dropwise add in 96 orifice plates, every hole final volume 150 μ L, the POLD1siRNA final concentration is respectively 50nmol/L, liposome lipofectamineTM2000 final volume is 0.25 μ L/ hole, after cultivating 8h, be replaced by the DMEM nutrient solution that contains 10% calf serum.Other establishes blank group and simple lipid body group.After cultivating 72h again, every hole adds 10 μ L MTT solution, and (physiological saline is mixed with 1mg/mL; Sigma), after continuing to hatch 4h, sop up supernatant liquor, every hole adds 150 μ L DMSO solvents, and vibration 15min measures absorbancy OD value under the full-automatic enzyme-linked immunologic detector 550nm wavelength, and computer records and save data automatically.Calculate POLD1siRNA to the inhibiting rate of NCI-H446 Growth of Cells by following formula.Each sample is established 6 multiple holes, and experiment repeats 3 times, calculating mean value and standard deviation.Inhibiting rate=(control group OD value-administration group OD value)/control group OD value * 100%.

As shown in Figure 1,8 groups of POLD1siRNA all have restraining effect to the propagation of NCI-H446 cell, particularly POLD1siRNA1, POLD1siRNA2 and POLD1siRNA4 have obvious restraining effect to the propagation of NCI-H446 cell, and proliferation inhibition rate is respectively 50.69 ± 0.72%, 35.35 ± 0.68% and 64.03 ± 0.85%.

Embodiment 2: fluorescence real-time quantitative PCR detects the restraining effect that POLD1siRNA expresses POLD1mRNA

With the NCI-H446 cell of logarithmic phase, be inoculated in 12 orifice plates by 8 * 104/hole density, cultivation 18h transfection POLD1siRNA method is the same.After hatching 48h, extract total RNA (beginning thus to operate on ice) with Trizol Reagent (Invitrogen), concrete operations are undertaken by its specification sheets.With BioMate (Thermo, USA) measure RNA purity and concentration, carry out at once reverse transcription: add 5 * RT damping fluid, 10 μ L, dNTP (2.5mmol/L) 4 μ L, Rnasin (40U/ μ L) 1 μ L, RTase (200u/ μ L) 1 μ L, Oligo18 (50 μ mol/L) 0.1 μ L, RNA 2 μ g replenish ddH2O to 50 μ L, hatch 60min for 42 ℃ behind the abundant mixing.With Realtime PCR (ABI, USA) the POLD1mRNA expression level is carried out quantitatively, confidential reference items are GAPDH.Operation is undertaken by " 2 * SYBR Green qPCR kit " scheme of Zoman, i.e. template 2 μ L, and upstream and downstream primer (10 μ M) 1 μ L, 2 * Mix, 10 μ L, additional ddH2O is to 20 μ L.Amplification condition is: 95 ℃ of 4min → (94 ℃ of 45s, 55 ℃ of 45s, 72 ℃ of 45s) 40cycle → meltcurve.

As shown in Figure 2, POLD1siRNA1, POLD1siRNA4 are respectively 70% and 80% to the inhibiting rate of POLD1mRNA, the inhibiting rate of the negative contrast of NC is 0 among Fig. 2, illustrate that POLD1siRNA can suppress the expression of POLD1 gene on transcriptional level, but the particularly expression of POLD1siRNA1, POLD1siRNA4 establishment POLD1 gene on transcriptional level.

Embodiment 3: protein immunoblotting method detects POLD1siRNA to the restraining effect of p125 protein expression

With 2mL be in logarithmic phase the NCI-H446 cell (1 * 105/mL) be inoculated in 6 orifice plates, cultivate 18 after, transfection POLD1siRNA, collecting cell behind the 72h.Add 100 μ L cell pyrolysis liquids (0.15M NaCl, 50mM Tris-HCl, pH 8.0,0.5% Sodium desoxycholates, 0.02% sodiumazide, 1%NP-14,2.0 μ g/mL aprotinin, 100mM PMSF) cracking 30min on ice.The centrifugal 30min of 12000 * g gets the supernatant quantitative protein concentration of MicroBCA test kit.After adding 5 * sds gel sample-loading buffer, boil 10min.The albumen (60 μ g) of equivalent is joined electrophoresis in the 10%SDS polyacrylamide gel, protein transduction after the separation moves to nitrocellulose filter, and 5% skim-milk room temperature sealing 2h adds the goat-anti people p125 antibody (C-20 that 1:1000 dilutes, Santa Cruz), 4 ℃ of overnight incubation.TBST washing three times, each 5min.The anti-goat IgG of donkey (Santa Cruz) that adds the HRP mark of 1:500 dilution, incubated at room 2h, TBST washing three times, each 5min.The colour developing of ECL nitrite ion, the gel electrophoresis analysis system takes pictures, with molecular weight and the clean optical density value of Quantity one software analysis object tape.With β-actin as internal reference.

Shown in Fig. 3 A and Fig. 3 B, 1,2,3,4 among described Fig. 3 A and Fig. 3 B represents following experimental data: 1: contrast; 2: negative control; 3:POLD1siRNA1; 4:POLD1siRNA4.POLD1siRNA1, POLD1siRNA4 are respectively 42.60% ± 1.56% and 49.42% ± 3.31% to the inhibiting rate of the protein product p125 expression of POLD1 genes encoding, illustrate POLD1siRNA1, POLD1siRNA4 on protein level establishment the expression of POLD1 gene, and then explanation POLD1siRNA can suppress the expression of POLD1 gene on protein level.

Embodiment 4: microscopically is observed POLD1siRNA to the impact of NCI-H446 cellular form

With 2mL be in logarithmic phase the NCI-H446 cell (1 * 105/mL) be inoculated in 6 orifice plates, cultivate 18 after, transfection POLD1siRNA cultivates behind the 72h under inverted microscope the observation of cell metamorphosis and takes pictures.

As shown in Figure 4, A, B, C, the D among described Fig. 4 represents following experimental data: A: contrast; B: negative control; C:POLD1siRNA1; D:POLD1siRNA4.Compare with control group, negative control group cellular form and quantity significantly do not change, and POLD1siRNA1 and POLD1siRNA4 treatment group cell quantity are few, distribute sparse, and cell becomes greatly, and the part cell rounding floats.These presentation of results, POLD1siRNA1 and POLD1siRNA4 can obviously change the NCI-H446 cellular form, suppress NCI-H446 cell proliferation, and namely POLD1siRNA can change the NCI-H446 cellular form, suppresses NCI-H446 cell proliferation.

Embodiment 5:HE staining examine POLD1siRNA is on the impact of NCI-H446 karyomorphism

With the NCI-H446 cell of logarithmic phase, be inoculated in 24 orifice plates that are equipped with in advance creep plate by 1 * 104/hole density, cultivate 18h after, transfection POLD1siRNA takes out cell climbing sheet after cultivating 72h again, carries out HE dyeing.PBS washes 3 times, and volume ratio is the methyl alcohol of 3:1: glacial acetic acid stationary liquid room temperature is 30min fixedly, and PBS washes 3 times; 0.5%TritonX-100 permeable membrane 10min, PBS wash 3 times; Brazilwood extract dyeing 15min, warm water oil blackeite 5min; Yihong dyeing 2min, the glycerine mounting.Microscopically is observed, and tenuigenin takes on a red color, and nucleus is purple.

As shown in Figure 5, A, B, C, the D among described Fig. 6 represents following experimental data: A: contrast; B: negative control; C:POLD1siRNA1; D:POLD1siRNA4.Control group and negative control group, the most cells monokaryon, nuclear is the ellipse of rule.It is large that POLD1siRNA1 and POLD1siRNA4 treatment group cell obviously become, and little multinuclear occurred, and the syncyte activity is low, and part is examined the death that comes off.Further specifying POLD1siRNA can induce the NCI-H446 cell dead through mitotic division disaster mode.

When infringement occurs DNA, thereby can't dividing the phenomenon that causes tetraploid or polyploid completely, cell is called the cell mitogen disaster.It is not very complete describing for the Morphological Characteristics of cell mitogen disaster, but mainly is cytomegalic formation, in a plurality of small nuts are arranged, chromatin condensation.When infringement occurs in DNA, if cell can not be blocked the carrying out of its cell cycle effectively, can cause chromosomal unusual separation, thereby the cell of these improper divisions can continue in next round mitotic division to cause the formation of cell polyploid to become the basis of canceration.And the cell mitogen disaster can make the necrocytosis of this improper division as a kind of Death Mechanism.POLD1siRNA induces the NCI-H446 cell dead through mitotic division disaster mode, may be because archaeal dna polymerase Pol δ activity is suppressed, and causes dna replication dna pressure, causes due to the dna damage.

Embodiment 6: colony formation detects POLD1siRNA to the impact of NCI-H446 Cell clonality

Behind the transfection POLD1siRNA 24h, collect the NCI-H446 cell with trysinization, the preparation cell suspension, adjusting cell density is that 150/mL is inoculated in 6 orifice plates, every hole 2mL.Hatch after 15 days and receive plate, fix with 10% methanol solution, the violet staining 30min of row 0.1%, tap water flushing 10min, microscopically is observed and is taken pictures.

As shown in Figure 6, A, B, C, the D among described Fig. 6 represents following experimental data: A: control group; B: negative control; C:50nmol/L POLD1siRNA1; D:50nmol/L POLD1siRNA4.POLD1siRNA has obviously suppressed quantity and clone's size of NCI-H446 cell clonal formation.

Embodiment 7:Transwell detects POLD1siRNA to the impact of NCI-H446 cell movement transfer ability

In the lower chamber of 8 aperture Transwell cells (Coming company), add in advance the DMEM substratum that 600 μ L contain 10% calf serum, 37 ℃ of balance 1h; Collect the NCI-H446 cell of POLD1siRNA effect 48h, wash 3 times with PBS, be resuspended in the DMEM substratum of serum-free, get density and be chamber on the cell suspension 100 μ L adding Transwell cell of 2.5 * l05/mL.Cultivate 22h under 37 ℃, 5%CO2 condition and take out the transwell cell, with 0.1% violet staining 20min, use the unnecessary dyestuff of tap water flush away after the PBS flushing, clean the cell that does not penetrate millipore filtration with swab stick.The cell count of counting filter membrane lower surface is counted 5 cell numbers in the visual field at random under 200 power microscopes, and each sample repeats 3 times, represents the motion transfer ability of tumour cell with the number of motion transitional cell.

As shown in Figure 7, A, B, C, the D among described Fig. 7 represents following experimental data: A: contrast; B: negative control; C:50nmol/LPOLD1siRNA1; D:50nmol/L POLD1siRNA4.Behind the POLD1siRNA transfection 72h, the cell quantity that POLD1siRNA1, POLD1siRNA4 treatment group move transfer has descended respectively 64.68 ± 8.26% and 85.85 ± 10.32% with respect to the untransfected group.These presentation of results POLD1siRNA can significantly suppress the motion transfer ability of NCI-H446 tumour cell.

The two experiment detection POLD 1siRNA that dye of embodiment 8:Annexin V-FITC/PI are on the apoptotic impact of NCI-H446

Behind the transfection POLD1siRNA 72h, collect the NCI-H446 cell and carry out Annexin V-FITC/PI dyeing, Annexin V-FITC/PI (German Merck company) test kit specification sheets is seen in concrete operations.The adjustment cell concn is 1.0 * 106/mL, gets 500 μ L cell suspensions and is used for flow cytometer (BDFACSCalibur) detection, 20000 cells of each sample detection, experiment triplicate.The Annexin V-/PI-is viable cell, the Annexin V +/the PI-cell is viable apoptotic cell, the Annexin V +/PI+ is apoptosis cell in late period, the Annexin V-/PI+ is non-viable non-apoptotic cell.

As shown in Figure 8, A, B, C, the D among described Fig. 8 represents following experimental data: A: contrast; B: negative control; C:50nmol/L POLD1siRNA1; D:50nmol/L POLD1siRNA4.The ratio of POLD1siRNA1 and POLD1siRNA4 treatment group dead cell (early apoptosis+late period apoptosis+non-viable non-apoptotic cell) is respectively 17.19% and 42.47%.NCI-H446 is after POLD1siRNA processes, and the cell membrane integrity obviously is damaged, and early apoptosis of cells, late period, the ratio of apoptosis obviously increased.

Embodiment 9:PI dyeing, flow cytometry POLD1siRNA is on the impact of NCI-H446 cell cycle

Behind the transfection POLD1siRNA 72h, collect the NCI-H446 cell.PBS with precooling washes cell 2 times, abandons supernatant behind the centrifugal 5min of 1000 * g, and cell is resuspended in 300 μ L, 1 * PBS, slowly adds the dehydrated alcohol of 700 μ L precoolings behind the mixing, and 4 ℃ fixedly more than the 18h.After washing once with the PBS of precooling, cell is resuspended among the PBS that 500 μ L contain 40 μ g/mL RNase A 37 ℃ of water-baths digestion RNA 30min.Add PI and make its concentration reach 10 μ g/mL, the upflowing cell instrument is measured behind the room temperature lucifuge dyeing 30min, detects 20000 cells at every turn.Excitation wavelength 488nm, the statistics cell of wavelength of transmitted light more than 620nm utilizes CELLQuest software analysis apoptotic cell (hypodiploid cell) and is in the cell proportion of each cell cycle (G1, S, G2), the apoptosis rate data with

Expression, the cell cycle ratio data is the representative result of repeated experiments more than 3 times.

As shown in Figure 9, A, B, C, the D among described Fig. 9 represents following experimental data: A: contrast; B: negative control; C:50nmol/L POLD1siRNA1; D:50nmol/L POLD1siRNA4.Negative control treatment group G1, S and G2/M phase cell proportion and control group be obviously difference not, and POLD1siRNA1 and POLD1siRNA4 treatment group, G1 phase cell proportion obviously reduces, and S phase cell proportion rises to respectively 36.09% and 37.98%.These presentation of results, POLD1siRNA have delayed the process of NCI-H446 cell S phase.

In sum, POLD1siRNA of the present invention, after special POLD1siRNA1, the POLD1siRNA4 transfection tumor cell, can block by the expression of POLD1 gene in the efficient inhibition cell propagation of tumour cell, suppress its motion and shift, block cell cycle arrest in the G2/M phase, inducing cell mitotic division disaster and death, important experiment basis has been established in the gene therapy that is applied to malignant tumour for POLD1siRNA.In addition, the POLD1siRNA sequence can efficient reticent cell in the expression of POLD1 gene, for the further research of POLD1 gene function lays the foundation.

The positive-sense strand sequence of related POLD1siRNA1 is shown in SEQ ID NO:1 among the present invention, the antisense strand sequence of POLD1siRNA1 is shown in SEQ ID NO:2, the positive-sense strand sequence of POLD1siRNA2 is shown in SEQ ID NO:3, the antisense strand sequence of POLD1siRNA2 is shown in SEQ ID NO:4, the positive-sense strand sequence of POLD1siRNA3 is shown in SEQ ID NO:5, the antisense strand sequence of POLD1siRNA3 is shown in SEQ ID NO:6, the positive-sense strand sequence of POLD1siRNA4 is shown in SEQ ID NO:7, the antisense strand sequence of POLD1siRNA4 is shown in SEQ ID NO:8, the positive-sense strand sequence of POLD1siRNA5 is shown in SEQ ID NO:9, the antisense strand sequence of POLD1siRNA5 is shown in SEQ ID NO:10, the positive-sense strand sequence of POLD1siRNA6 is shown in SEQ ID NO:11, the antisense strand sequence of POLD1siRNA6 is shown in SEQ ID NO:12, the positive-sense strand sequence of POLD1siRNA7 is shown in SEQ ID NO:13, the antisense strand sequence of POLD1siRNA7 is shown in SEQ ID NO:14, the positive-sense strand sequence of POLD1siRNA8 is shown in SEQ ID NO:15, the antisense strand sequence of POLD1siRNA8 is shown in SEQ ID NO:16, and particular case is referring to sequence table.

Although more than described the specific embodiment of the present invention; but being familiar with those skilled in the art is to be understood that; our described specific embodiment is illustrative; rather than for the restriction to scope of the present invention; those of ordinary skill in the art are in modification and the variation of the equivalence of doing according to spirit of the present invention, all should be encompassed in the scope that claim of the present invention protects.

Claims

1. a target suppresses the siRNA sequence of people POLD1 genetic expression, and it is characterized in that: described siRNA sequence comprises at least one in following eight sequences:

2. a kind of target according to claim 1 suppresses the siRNA sequence of people POLD1 genetic expression, and it is characterized in that: described siRNA sequence comprises following three sequences:

3. a kind of target according to claim 2 suppresses the siRNA sequence of people POLD1 genetic expression, and it is characterized in that: described siRNA sequence comprises following two sequences:

According to claim 1 and 2 or 3 described a kind of targets suppress the siRNA sequence of people POLD1 genetic expressions, it is characterized in that: 3 ' end of each positive-sense strand in the described siRNA sequence and antisense strand all with UU or dTdT for the modification of dangling.