CN102898528B - Calreticulin-soluble programmed death receptor 1 fusion protein, and preparation method and purpose thereof - Google Patents

Abstract

The invention relates to a calreticulin-soluble programmed death receptor 1 fusion protein, and a preparation method and a purpose thereof. The invention provides a fusion protein CRTdelta-sPD1 of a mice C-zone-partially-amputated calreticulin and soluble programmed death receptor 1 extracellular domain; the fusion protein is subjected to eukaryotic expression, such that a cell line stably expressing CRTdelta-sPD1 is established; and the CRTdelta-sPD1 is secreted out of the cells by using secretory peptide. The CRTdelta-sPD1 fusion protein provided by the invention has activities of combining cell surface PD-L1 and promoting lymphocyte proliferation and killing. Also, the CRTdelta-sPD1 fusion protein can be activated in vivo, and can induce an immune system to perform specific killing against tumors. Therefore, tumor growth is inhibited, and tumor mice survival time is prolonged. The CRTdelta-sPD1 fusion protein can be adopted as a tumor immunotherapy medicine candidate, and can be used for treating diseases such as tumors.

Description

Fusion rotein of calprotectin-solubility programmed death acceptor 1 and its production and use

Technical field

The present invention relates to DNA recombinant technology and pharmaceutical grade protein field, belong to technical field of pharmaceutical biotechnology, be specifically related to calprotectin-programmed death acceptor 1 fusion rotein, to encode the DNA sequence dna of this fusion rotein, carrier containing this DNA sequence dna or plasmid, host cell, by the method for this fusion rotein of preparation, and this fusion rotein application in the diseases such as tumour.

Background technology

Calprotectin (calreticulin, CRT) is a kind of calcium binding protein of high conservative, belongs to heat-shock protein family, is mainly present in endoplasmic reticulum, has various biological function.The immunogenicity apoptosis (immunogenic apoptosis) of CRT mediation is significant in antineoplastic immune.Studies have found that the CRT of some antineoplaston energy inducing cell is from the fast transposition putting on an arrow collection at cytolemma to film surface in born of the same parents, appear at CRT on apoptotic cell film can by DC cell recognition with engulf.Obeid research group application two-dimensional electrophoresis screen and identifies a series ofly has the inductor that CRT film bunch is collected, as anthracene nucleus medicament (anthracyclines), and oxaliplatin (oxaliplatin), ultraviolet and gamma-radiation.These inductors, while inducing tumor cell generation apoptosis, also make CRT transfer to cytolemma from endocytoplasmic reticulum and distribute in a bunch collection.The tumour cell of this kind of apoptosis has good immunogenicity, and the mouse tumor cell Mice Inoculated applying this kind of apoptosis can induce powerful antineoplastic immune activity.Most antitumor drug energy inducing apoptosis of tumour cell but CRT can not be made film transposition to occur and bunch to collect, the tumour cell of this kind of apoptosis does not also possess immunogenicity of tumor.But by CRT albumen reorganized for this kind of apoptotic cell bag, then can obtain same antineoplastic immune effect, these results show that a film bunch collection for CRT molecule is that apoptotic cell has immunogenic key factor.Research finds, the CRT of the tumor cell membrane surface bunch collection of apoptosis can as " engulf me (eat-me) " signal transmission to DC, impel DC cell activation and engulf tumour cell, DC processes and offers tumour specific antigen in the process of maturation, thus inducing specific CD4+ and CD8+T cell activation and propagation, produce the immunologic cytotoxicity of same tumor active thus.

Programmed death acceptor 1 (programmed cell death 1, PD-1) and part PD-L1(programmed cell death 1 ligand 1) be the co-stimulators of B7-CD28 family, produce negative sense immunoregulation effect, in the immunity of body is stablized, there is important physiological function.PD-1 is mainly expressed in the Lymphocyte Membrane surface of activation, and after PD-L1 and PD-1 combines, the incapability even apoptosis of induction of lymphocyte, prevents immunoreactive overactivity.But in tumour immunity research, find the high expression level of tumor cell surface PDL1, after its PD-1 on tumor tissues endolymph cell is combined, retarding effect T cell is active, reduce the expression and secretion of the latter IL-2 and IFN-γ simultaneously, form the microenvironment of immunosurveillance escape, promote the growth of tumour.The method that blocking-up PD-1/PD-L1 be combined with each other can be used for the immunotherapy of tumour.There is scholar to apply the prokaryotic expression protein of PD-1 extracellular region (sPD-1) or the eukaryon expression plasmid process mice with tumor of sPD-1, found that sPD-1 albumen not only suppresses the growth of mouse interior tumor cell, strengthen the function of tumor-specific CTL cell.After application PD-L1 antibody blocking PD-1/PD-L1 approach, also can promote the secretion of CD8+T cell proliferation and cytokine, disappearing of induced tumor.Apply humanized PD-1 monoclonal antibody to carry out oncotherapy and entered clinical II phase, and obtain good antitumous effect.The prompting of these results blocks the object that PD-1/PD-L1 signal path can reach effective treatment tumour.

The immunologic escape of tumour is the key factor that tumour is occurred, develops, and the signal path that the immunosuppression molecule that wherein tumor inducing is a large amount of is formed inhibits body immune system to the lethal effect of tumor tissues.In view of sPD-1 have block PD-1/PD-L1, promote body to the immunologic cytotoxicity of tumour and CRT protein-specific is coated on tumor cell surface have promote tumour specific antigen offer effect; Thus the present invention has prepared the part brachymemma of mouse calprotectin C district (Calreticulin, CRT _⊿) with solubility programmed death acceptor 1(programmed cell death 1, PD1) the fusion rotein CRT of extracellular fragment (sPD1) _⊿-sPD1, and in B16 mouse melanoma cell line-F1 secreting, expressing, sPD-1 is combined with the PDL1 of tumor cell surface, blocks PD1/PDL1 signal path, make CRT be coated on tumor cell membrane surface simultaneously, make fusion rotein CRT _⊿-sPD1 obtains the antitumor immune function of two aspects simultaneously, reaches effective antitumor immunoloregulation function.

Summary of the invention

The object of this invention is to provide fusion rotein of a kind of calprotectin-solubility programmed death acceptor 1 and its production and use.CRT prepared by the present invention _⊿-sPD1 fusion rotein has in conjunction with cell surface PD-L1 and promotes lymphopoiesis and the activity of killing and wounding; Can also activate in vivo, inducing immune system carries out specific killing and wounding to tumour, Tumor suppression growth, extend lifetime of tumor mouse, can be used as immunotherapy of tumors drug candidate, be used for the treatment of the diseases such as tumour.

An object of the present invention is to provide a kind of new fusion rotein, and this fusion rotein comprises following element: 1) calprotectin, or has fragment or the variant of calprotectin activity; 2) solubility programmed death acceptor 1, or fragment or the variant with solubility programmed death acceptor 1 activity.

More preferably, calprotectin used in the present invention and solubility programmed death acceptor 1 all derive from mouse.Wherein, better, the encoding sequence of described calprotectin is as shown in SEQ ID NO:1, and the encoding sequence of solubility programmed death acceptor 1 is as shown in SEQ ID NO:2.

A further object of the invention provides a kind of DNA molecular of separation, and it is encoded fusion rotein of the present invention.Better, this DNA molecular comprises the nucleotide sequence shown in SEQ ID NO:3.

A further object of the invention is to provide the plasmid or carrier that comprise above-mentioned DNA molecular and the host cell containing above-mentioned DNA molecular or plasmid or carrier.

A further object of the invention is to provide the method for producing fusion rotein of the present invention, and the method comprises the following steps: 1) provide DNA molecular, and described DNA molecular comprises the nucleotide sequence of the encoding said fusion protein can expressed in biology; 2) in described biology, described nucleic acid is expressed to form described fusion rotein; With 3) fusion rotein described in isolated or purified.

A further object of the invention is to provide a kind of pharmaceutical composition, and this pharmaceutical composition comprises pharmaceutically acceptable carrier or vehicle or thinner, and the above-mentioned fusion rotein of significant quantity or DNA molecular or plasmid or carrier or host cell.

A further object of the invention fusion rotein of the present invention or DNA molecular or plasmid or carrier or host cell is applied to prepare medicine, and described medicine is used for the treatment of tumour or immunomodulatory.

The concrete technical scheme of the present invention is as follows:

Method:

(1) molecule clone technology is utilized to build pcDNA 3.1 (+)/CRT _⊿, pcDNA3.1 (+)/sPD1 and pcDNA3.1 (+)/CRT _⊿-sPD1 eukaryon expression plasmid.

(2) by pcDNA 3.1 (+)/CRT _⊿, pcDNA3.1 (+)/sPD1, pcDNA3.1 (+)/CRT _⊿-sPD1 and pcDNA3.1 (+) (negative control) plasmid transfection B16-F1 cell, after being screened by G418, picking positive colony enlarged culturing, western blot identifies CRT _Δ, sPD1, CRT _⊿-sPD1 at B16-F1 cells, and utilizes ELISA method and flow cytometry (FCM) detection fusion protein excretion to cell conditioned medium, and can be combined by the PDL1 of high expression level on cytolemma.

(3) set up the cell strain supernatant of stably express and lymphocyte mixing Dual culture, mtt assay detection fusion albumen is on the impact of lymphopoiesis ability; By lymphocyte and stable expression cell strain Dual culture after CFSE dyeing, Flow cytometry lymphopoiesis situation and lactic dehydrogenase enzyme process detect and cause rear quick lymphocyte to the lethal effect of B16-F1 cell strain.

(4) experimentation on animals; The cell strain of expressing recombinant protein is inoculated in the right dorsal sc of mouse, observes the growth of tumour, the lifetime of tumor mouse and tumour inhibiting rate; And get spleen lymphocyte and the B16-F1 cell strain Dual culture of each group of mouse, the lymphocytic propagation of Flow cytometry and specific killing lymphocyte number (CD8+ and INF-γ is two positive), lactic dehydrogenase enzyme process detects Lymphocvte Killer effect and ELISA method and detects and secrete INF-γ in lymphocyte culture supernatant and measure; The immunocompetence of the antitumor action of decision fusion albumen thus.

Result:

(1) successfully pcDNA 3.1 (+)/CRT is built _⊿, pcDNA3.1 (+)/sPD1 and pcDNA3.1 (+)/CRT _⊿-sPD1 eukaryon expression plasmid, cut through enzyme and check order qualification entirely true.

(2) the plasmid transfection B16-F1 cell will built, after being screened, establishes stable stably express CRT by G418 _Δ, PD1 and CRT _⊿the B16/CRT of-sPD1 albumen _⊿, B16/sPD1 and B16/CRT _Δ-sPD1 cell strain and compared with control cells strain B16/3.1 (+).

(3) stably express secretion property PD-1, CRT is collected _⊿and CRT _⊿the cells and supernatant of-sPD-1, flow cytomery to PD1 and CRT-sPD1 can with the PDL1 specific binding of EL4 cell surface.

(4) collect above-mentioned cell conditioned medium and stimulate spleen lymphocyte, find fusion rotein CRT _⊿-sPD1 can promote lymphopoiesis significantly.

(5) by aforementioned stable expression cell line and mixed lymphocytes Dual culture, find that compared with control cells strain B16/3.1 (+) obviously suppresses lymphocyte growth, but CRT _⊿-sPD-1 clone strain effectively can promote lymphopoiesis; Lymphocyte after these sensitization is carried out CTL experiment, CRT compared with control group _⊿the lymphocyte of-sPD-1 clone strain sensitization kills and wounds obvious enhancing to B16-F1 cell strain.

(6) in tumor model, CRT _⊿-sPD1 fusion rotein can the growth of effective Tumor suppression, extends the lifetime of tumor mouse.

(7) spleen lymphocyte and the B16-F1 co-culture of cells of each group of mouse is prepared, CRT _⊿-sPD1 organizes mouse lymphocyte multiplication capacity and strengthens, and specific killing lymphocyte number (CD8+ and INF-γ is two positive) increases, and secretion INF-γ increases, and strengthens the kill capability of B16-F1 cell.

Conclusion:

(1) pcNDNA3.1 (+)/CRT is constructed _⊿-sPD1 eukaryon expression plasmid and establish stably express CRT _⊿the cell strain of-sPD1;

(2) CRT secreted _⊿-sPD1 albumen has in conjunction with cell surface PD-L1 in vitro and promotes lymphopoiesis and the activity of killing and wounding;

(3) fusion rotein CRT _⊿-sPD1 can activate in vivo, inducing immune system carries out specific killing and wounding to tumour, the lifetime of Tumor suppression growth, prolongation tumor mouse, prompting CRT _⊿-sPD1 can be used as immunotherapy of tumors drug candidate.

Accompanying drawing explanation

Fig. 1 is the CRT obtained by PCR _Δ, sPD1 object fragment, wherein, A-1:marker; A-2:CRT _⊿pCR primer; B-1:marker; The PCR primer of B-2:sPD1.

Fig. 2 is pcDNA3.1 (+)/CRT _⊿the structure result of-sPD1 plasmid, wherein, A-1: object fragment CRT _⊿pCR primer; A-2: the PCR primer of object fragment sPD1; A-3:marker; B-1:marker; B-2 and B-3:CRT _Δ-sPD1 fusion gene; C-1:marker; C-2:pcDNA3.1 (+)/CRT _⊿-sPD1 plasmid; C-3:pcDNA3.1 (+)/CRT _⊿-sPD1 plasmid HindIII+XhoI double digestion product; C-4:pcDNA3.1 (+)/CRT _⊿-sPD1 plasmid BamH1+XhoI double digestion product; C-5:pcDNA3.1 (+)/CRT _⊿-sPD1 plasmid HindIII+BamH1 double digestion product.

Figure 3 shows that the Western blotting qualification result of expressing fusion protein situation.

Fig. 4 is the qualification result that the fusion rotein of B16-F1 cell expressing is secreted into cell conditioned medium, wherein, and the typical curve that the experiment of A:CRT competitive ELISA is set up; B: the fusion rotein in the cell conditioned medium utilizing CRT Inhibition ELISA to record.

Fig. 5 be fusion rotein combine with tumour cell EL4 surface PDL1 in conjunction with situation, wherein, A: flow cytometer showed fusion rotein is combined with the PDL1 on tumour cell EL4 surface, B: histogram shows the combination rate of fusion rotein and PDL1.

Fig. 6 shows the cell culture supernatant producing fusion rotein and promotes lymphopoietic result, and wherein * and B16/3.1 compares, P<0.05.

Fig. 7 shows high expression level fusion rotein group B16/C-P group tumour cell and promotes lymphopoietic result, wherein * * P<0.01, * P<0.05.

Fig. 8 be the lymphocyte of high expression level fusion rotein cell sensitization to the detected result of the cytotoxicity of B16-F1, wherein 3.1 represent B16/3.1 cell strains, and C represents B16/CRT _⊿cell strain, P represents B16/sPD1 cell strain, and C-P is B16/C-P cell strain, and N represents independent lymphopoiesis; * P<0.01, * P<0.05.

Fig. 9 is that mtt assay detects B16/CRT _Δ, B16/sPD1, B16/C-P, B16/3.1 cell strain growth curve chart.

Figure 10 is the graphic representation (* * P<0.01, * P<0.05) that high expression level fusion rotein group B16/C-P group tumor mouse tumor growth is suppressed.

Figure 11 is comparison prolongation result (* * P<0.01, * P<0.05) of high expression level fusion rotein B16/C-P group tumor mouse lifetime.

Figure 12 high expression level fusion rotein B16/C-P group mouse anti-tumor immune response strengthens (* * P<0.01, * P<0.05), wherein, and A: flow cytometry tumor mouse lymphocyte specific multiplication capacity; B: histogram compares lymphopoiesis ability; C: Flow cytometry CD8 ⁺positive lymphocyte two with INF-γ; D: histogram more two positive lymphocyte number difference.

Figure 13 shows the lymphocytic lethal effect of high expression level fusion rotein B16/C-P group and strengthens (* * P<0.01, * P<0.05).

Figure 14 shows IFN-γ in high expression level fusion rotein B16/C-P group lymphocyte culture supernatant and measures increase (* * P<0.01, * P<0.05).

Embodiment

To be explained in detail the present invention by specific embodiment below.

This invention comprises the steps: successively

One, the structure of eukaryotic expression recombinant plasmid and qualification

PcDNA3.1 (+)/CRT _Δ, pcDNA3.1 (+)/sPD1 and pcDNA3.1 (+)/CRT _⊿the structure of-sPD1 eukaryon expression plasmid

With the cDNA of mouse lymphocyte for template PCR clone obtains mCRT, mPD1 object fragment, wherein introduce at 5 ' end of upstream primer and downstream primer the clone operations that Hind III and Xho I restriction enzyme site be beneficial to subsequently respectively.PCR primer design is as follows:

MCRT upstream primer:

GTCGAAGCTTAACCATGCTCCTTTCGGTGCCGCTC

Downstream primer:

CAAGCTCGAGTTAATGATGATGATGATGATGACCCCCTTCTGGGTGTATCCAGGTAC

MPD1 upstream primer:

CAGTAAGCTTATGTGGGTCCGGCAGGTAC

Downstream primer:

CAAGCTCGAGTTAATGATGATGATGATGATGACCCCCGCTGGGATATCTTGTTGAGG

PCR reaction conditions: 94 DEG C of sex change 5min; With 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C to extend 1min be PCR circulation, and 29 circulations are carried out in reaction; Finally, 72 DEG C extend 5min and terminate amplification 4 DEG C and save backup.PCR primer is through 10g/L agarose gel electrophoresis detected result.The specific band of 930bp and 518bp is about respectively through 10g/L agarose gel electrophoresis its size visible.

The DNA fragmentation of CRT, PD1 that PCR obtains uses restriction endonuclease Hind III+XhoI double digested respectively, reclaim through PCR Purification Kit, with T4 ligase enzyme, CRT, PD1 endonuclease bamhi is connected in the plasmid pcDNA3.1 (+) that Hind III+XhoI is double digested.By CaCl2 legal system for DH5a competent cell, and product conversion will be connected to competent cell by heat shock method, after 0.1g/L ampicilin agar plates 37 DEG C spends the night screening, picking mono-clonal colony inoculation is in containing penbritin LB substratum, and 37 DEG C of shaking culture are spent the night.Extract recombinant plasmid, screen the positive colony of successfully structure, with restriction enzyme digestion and DNA sequencing method identify plasmid pcDNA3.1 (+)/CRT, pcDNA3.1 (+)/PD1 direction of insertion and base sequence correct.

With the cDNA of mouse lymphocyte for template, PCR clone obtains the CRT (CRT in truncated part C district _⊿) (i.e. SEQ ID NO:1), sPD1 extracellular region (sPD1) fragment (i.e. SEQ ID NO:2).Wherein at CRT _⊿5 ' end of upstream primer and downstream primer introduces Hind III and BamH1 restriction enzyme site respectively, and 5 ' end of sPD1 upstream primer and downstream primer introduces the clone operations that BamH1 and XhoI restriction enzyme site is beneficial to subsequently respectively.PCR primer design is as follows:

CRT _⊿upstream primer:

GTCGAAGCTTAACCATGCTCCTTTCGGTGCCGCTC（SEQ ID NO：4）

Downstream primer:

CAAGGGATCCACCTCCACCTTCTGGGTGTATCCAGGTAC（SEQ ID NO：5）

SPD1 upstream primer:

CAAGGGATCCGGTGGAGGTGGAGAGGTCCCCAATGGGCCCTG（SEQ IDNO：6）

Downstream primer:

AAGCTCGAGTTAATGATGATGATGATGATGACCCCCGCTGGGATATCTTGTTGAGG（SEQ ID NO：7）

PCR reaction conditions: 94 DEG C of sex change 5min; With 94 DEG C of sex change 30s, 55 DEG C of annealing 30s, 72 DEG C to extend 1min be PCR circulation, and 29 circulations are carried out in reaction; Finally, 72 DEG C extend 5min and terminate amplification 4 DEG C and save backup.PCR primer is through 10g/L agarose gel electrophoresis detected result.The specific band of 912bp and 454bp is about respectively through 10g/L agarose gel electrophoresis its size visible.

By the CRT that PCR obtains _⊿with the DNA fragmentation of sPD1 use respectively restriction endonuclease Hind III and BamH1, BamH1 and XhoI double digested, through PCR Purification Kit reclaim, with T4 ligase enzyme by CRT _⊿be connected in the plasmid pcDNA3.1 (+) that Hind III and XhoI is double digested with sPD1 endonuclease bamhi.Successfully positive colony is built, with restriction enzyme digestion and DNA sequencing method qualification plasmid pcDNA3.1 (+)/CRT by screening _⊿-sPD1 gained restriction fragment (see figure 2) consistent with expected results.DNA sequencing confirms that goal gene two reading frame (ORF) docks errorless.

Two, recombinant plasmid is in the detection of B16-F1 expression of cellular proteins

By pcDNA3.1 (+)/CRT _⊿, pcDNA3.1 (+)/sPD1 and pcDNA3.1 (+)/CRT _⊿-sPD1 eukaryotic expression plasmids B16-F1 cell, G418 screens, and obtains stably express CRT _⊿, sPD1 and CRT _⊿-sPD1 eukaryotic expression cell (called after B16/CRT respectively _Δ, B16/sPD1 and B16/C-P).Stable expression cell strain B16/CRT is extracted respectively with cell pyrolysis liquid _Δ, B16/sPD1, B16/C-P and negative control B16/3.1 (+) albumen, after SDS-PAGE gel electrophoresis, albumen electricity is gone on pvdf membrane, closes through skimmed milk, specific antibody (wherein sPD1 and CRT in mouse source _⊿-sPD1 applies sPD1 monoclonal antibody, CRT _⊿application CRT monoclonal antibody) albumen on binding film, the sheep anti mouse polyclonal antibody of coupling HRP is hatched rear ECL and to be developed (see figure 3).Using β-actin as internal reference in experiment.

Whether recombinant protein is discharged into extracellular in the mode of secretion in B16-F1, therefore application Inhibition ELISA have detected the CRT albumen in cells and supernatant, Fig. 4 A is depicted as its typical curve, along with the corresponding reduction of its OD value of increase of CRT concentration, and has good linear relationship (R ²=0.9713).Secretory protein in further detection cells and supernatant, found that and in B16/3.1 and B16/sPD1 cell conditioned medium, not measure CRT, at B16/CRT _⊿and CRT albumen (Fig. 4 B) in B16/C-P cell conditioned medium, detected.

Three, vitro detection fusion rotein CRT _Δ-sPD1 is active

1, fusion rotein CRT _⊿the mensuration of-sPD1 binding activities

The mouse tumor cell EL4 of normal cultivation, after DDP induction, the PDL1 high expression level of its cell surface, can reach 80.9% through flow cytomery positive rate.Collect the culture supernatant of aforementioned stable expression cell line and the EL4 cell incubation of high expression level PD-L1, close through lowlenthal serum, after the primary antibodie adding anti-PD1 and fluorescent mark two anti-binding, flow cytometry analysis, albumen compared with B16/3.1 supernatant in B16/sPD1, B16/C-P supernatant can be combined with PD-L1 (Fig. 5 A), illustrates and expresses and sPD1 in the cells and supernatant be secreted into and fusion rotein CRT _⊿-sPD1 has binding activities (Fig. 5 B) with the PDL1 of EL4 cell surface.

2, fusion rotein CRT _⊿-sPD1 promotes lymphopoiesis

Normal cultivation B16/CRT _Δ, B16/sPD1, B16/C-P, B16/3.1 cell strain, wait that growing to about 80% removes cell conditioned medium, PBS washes once, adds serum-free and cultivates without phenol red medium and to collect culture supernatant after 4h to mix resuspended mouse spleen lymphocyte to final concentration afterwards with isopyknic 20% foetal calf serum without phenol red medium be 1 × 10 ⁵individual/ml, is laid in 96 orifice plates, every hole 100 μ l.After 37 DEG C of mixing Dual culture 48h, mtt assay surveys cell proliferation rate.Result (Fig. 6) is presented in lymphocytes culture medium and is added with CRT _Δ, sPD1 protein groups lymphocytic cell division multiplication capacity rises, and adds CRT _⊿the ability of cell proliferation of-sPD1 group significantly improves (p<0.05).

Four, fusion rotein CRT _Δthe biologic activity of-sPD1 is determined

1, promote lymphopoiesis, inhibition tumor cell is active

By the B16/CRT of logarithmic phase _⊿, B16/sPD1, B16/C-P, B16/3.1 cell is with 1 × 10 ⁵individual/ml is inoculated in 24 orifice plates, every hole 500 μ l.After 37 DEG C of cultivation 24h, in hole, add final concentration is 2 × 10 ⁶the mouse spleen lymph 500 μ l that individual/ml CFSE dyes.After cultivating 48h, collect the lymphocyte in culture supernatant, 1500rpm/min, 5min remove supernatant, and after PBS washes three times, 400 μ l PBS are resuspended, flow cytomery lymphopoiesis (Fig. 7 A).Tumor cell line B16/3.1 obviously suppresses lymphopoiesis, and fusion rotein effectively slow down this restraining effect (Fig. 7 B).

2, fusion rotein CRT _⊿outer primed lymphocyte the killing and wounding tumour cell B16-F1 of-sPD1 inductor

By the B16/CRT of logarithmic phase _⊿, B16/sPD1, B16/C-P, B16/3.1 cell is with 1 × 10 ⁵individual/ml is inoculated in 24 orifice plates, every hole 500 μ l.After 37 DEG C of cultivation 24h, in hole, add 2 × 10 ⁶individual/ml mouse spleen lymphocyte suspension 500 μ l, and to add IL-2 to final concentration be 30ng/ml, after induction 72h, collect lymphocyte and be used for following experiment, the lymphocyte after induction is measured to the lethal effect (Fig. 8) of tumour B16-F1, result display fusion rotein CRT with lactic dehydrogenase enzyme process _⊿-sPD1 effectively enhances lymphocytic lethal effect.

Five, fusion rotein CRT _Δ-sPD1 Anticancer effect in vivo

1, Balb/C mouse hypodermic inoculation tumour

In 6 week age female Balb/C mouse, sub-cage rearing after random packet, and carry out mark.Amount to 7 groups as table 1.1.(cell concn is 1 × 10 to inoculate each group of cell suspension with 1ml asepsis injector in the right dorsal sc of mouse ⁶/ ml), every 0.1ml.Within after inoculation every 3 days, observe inoculation local skin, if having black splotch or other irregular black marks, be designated as melanoma and occur, namely B16-F1 is survived and is grown in live body Balb/C Mice Body.

Table 1.1 tumor cell inoculation grouping (n=12)

2, the growth activity of more several clone strain of mtt assay

By the B16/CRT of logarithmic phase _Δ, B16/sPD1, B16/C-P, B16/3.1 cell is with 4 × 10 ⁴/ ml joins in 96 orifice plates, every hole 100 μ l, 37 DEG C of cultivations.Time after 12, cell attachment is 0 hour, add MTT/RPMI-1640 substratum that concentration is 400mg/L (serum-free and dual anti-) every hole 100 μ l, 37 DEG C are continued to cultivate 4h, after removing supernatant, every hole adds 200 μ l DMSO, dissolving crystallized 20min under room temperature, then in the long microplate reader of all-wave, read the light absorption value that wavelength is 570nm, and survey the absorbance of cell cultures 24h, 48h, 72h, 96h hour successively.B16/CRT _Δ, B16/sPD1, B16/C-P, B16/3.1 multiplication rate result display (Fig. 9), detect in 96h cell fission propagation, display B16/CRT _⊿, B16/sPD1, B16/C-P, B16/3.1 cell strain multiplication capacity do not have obvious difference, illustrates that fusion rotein does not affect the growth activity of tumour cell B16-F1.

3, fusion rotein CRT _⊿-sPD1 is on the growth of tumor tissues and the impact of tumor mouse lifetime

SPF level Balb/C mouse is divided into 7 groups at random, comprises: PBS group, B16-F1 group, stably express CRT _Δ, sPD1, CRT _⊿the B16-F1 control group of-sPD1 experimental group and carrier pcDNA3.1 (+), in addition by stably express CRT _⊿with the control group of B16-F1 two groups of cytomixis of sPD1.At these tumour cells of mouse back subcutaneous vaccination, within every three days, observe and record Melanoma Growth situation, surveying volume of tumor mass V=0.526ab ²(a: longest diameter, b: the shortest diameter), calculates the growth and decline situation (Figure 10 A) of tumour, totally 33 days.Mouse is killed after 33 days, get tumor tissues to weigh, with the tumour of B16-F1 group mouse for control group, by each experimental mice inhibition rate of tumor growth of formulae discovery, the average knurl of inhibition rate of tumor growth (%)=control group average knurl weight-experimental group average knurl weight/control group heavy × 100%.The tumor growth of expressed fusion protein group B16/C-P is significantly inhibited (p<0.01) (Figure 10 B) compared with control group B16/3.1.

SPF level Balb/C mouse is divided into 2 groups at random, comprises: B16/C-P group and B16/3.1 group, often organize 16, at the cell strain of the different Secondary Culture of mouse back subcutaneous vaccination, observe every day and record Melanoma Growth situation, and recording the death condition of mouse, altogether 90 days (Figure 11).As can be seen from the figure expressed fusion protein CRT _⊿-sPD1 organizes the significant prolongation in vegetative period of mouse.

4, fusion rotein CRT _⊿-sPD1 is on tumor mouse lymphocyte specific propagation and the impact killed and wounded

By the B16-F1 cell of logarithmic phase with 1 × 10 ⁵individual/L is inoculated in 24 orifice plates, every hole 500 μ l.After 37 DEG C of cultivation 24h, fix 15min by 4% paraformaldehyde, PBS washs 3 times, for following experiment primed lymphocyte.Get the spleen cell CFSE inoculating above-mentioned each group of mouse and dye rear 1 × 10 ⁶/ ml joins in the fixing B16-F1 cell prepared, and to add IL-2 to final concentration be 30ng/ml, 37 DEG C cultivate 48h after, collect lymphocyte flow cytometer, analyze lymphopoiesis (Figure 12 A).Result shows experimental mice lymphocyte had significant proliferation, the wherein lymphopoiesis ability the strongest (p<0.01) of B16/sPD1 group, fusion rotein group B16/C-P group comparatively control group multiplication capacity strengthens (p<0.05) (Figure 12 B).

Prepare mouse spleen lymphocyte with aforesaid method, do not carry out CFSE dyeing, after B16-F1 antigenic stimulation, add protein transport inhibitor monensin 2 μm of ol/L, to stop cytokine secretion to extracellular, collecting cell, carries out cytolemma FITC-CD8 respectively ⁺antibody staining and the interior dyeing of the born of the same parents of PE-INF-gamma antibodies after wearing film, carry out Flow cytometry (Figure 12 C).The wherein CD8 of B16/sPD1 group ⁺positive lymphocyte rate the highest (p<0.01), and the two positive rate of fusion rotein group B16/C-P group is higher than other groups (p<0.05) (Figure 12 D), result shows fusion rotein CRT _⊿-sPD1 can effective activated immune system, stimulates specific lymphocytic propagation.

Same method sensitization but Mouse spleen cells without CFSE dyeing are cultivated after 72h, collect lymphocyte action effect cell, with B16-F1(cell concn for 1 × 10 ⁵/ ml) be target cell, effect target is than 100: 1.Wherein not add effector cell, replace without phenol red medium for Spontaneous release group, with separately without phenol red medium hole for blank group, adding 0.1%NP-40 with independent B16-F1 cell is maximum release group.All establish 3 multiple holes for each group above.5%C02,37 DEG C of constant-temperature incubations survey cell killing activity (Figure 13) after 4 hours, result display B16/C-P group-specific lethal effect ability strengthens (p<0.05).Get lymphocyte culture supernatant simultaneously, survey the INF-γ content (Figure 14) in cell conditioned medium by ELISA method.As shown in the figure, the lymphocytic CTL value of experimental group B16/C-P, secretion the secretory volume of IFN-γ have significant lifting (p<0.05), prompting fusion rotein CRT _⊿-sPD1 effectively strengthens the specific killing of lymphocyte to tumour.

SEQUENCE LISTING

 

<110> applicant

 

Fusion rotein of <120> calprotectin-solubility programmed death acceptor 1 and its production and use

 

<130> 2012

 

<160> 7

 

<170> PatentIn version 3.5

 

<210> 1

<211> 912

<212> DNA

<213> mouse

 

<400> 1

atgctccttt cggtgccgct cctgcttggc ctcctcggcc tggccgccgc agaccctgcc 60

 

atctatttca aagagcagtt cttggacgga gatgcctgga ccaaccgctg ggtcgaatcc 120

 

aaacataagt ccgattttgg caaatttgtc ctcagctctg gcaaatttta cggggacctg 180

 

gagaaggata aagggctgca gacaagccaa gatgcccgat tttacgcact gtccgccaaa 240

 

ttcgaaccct tcagcaataa gggccagaca ctggtggtac agttcacggt gaagcatgag 300

 

cagaatatcg actgtggggg cggctacgtg aagctgtttc cgagtggctt ggaccagaag 360

 

gacatgcatg gagactcaga atataacatc atgtttggtc cggacatctg cggtcctggc 420

 

accaagaagg ttcatgtcat ctttaactac aagggcaaga atgtgctgat caacaaggat 480

 

atccggtgta aggatgatga attcacacac ctatacacac tgattgtgcg gccagacaac 540

 

acctatgagg tgaaaattga caacagccag gtggagtcag gctccttgga ggatgattgg 600

 

gactttctgc cacccaagaa gataaaggac cctgatgctg ccaagccgga agactgggat 660

 

gaacgagcca agatcgatga ccccacagat tccaagcctg aggactggga caagccagag 720

 

cacatccctg accctgatgc taagaagcct gaggactggg atgaagagat ggatggagag 780

 

tgggaaccac cagtgattca aaatcctgaa tacaagggcg agtggaaacc acgtcaaatt 840

 

gacaacccag attacaaggg tacctggata cacccagaag gtggaggtgg atccggtgga 900

 

ggtggagagg tc 912

 

 

 

<210> 2

<211> 390

<212> DNA

<213> mouse

 

<400> 2

cccaatgggc cctggaggtc cctcaccttc tacccagcct ggctcacagt gtcagaggga 60

 

gcaaatgcca ccttcacctg cagcttgtcc aactggtcgg aggatcttat gctgaactgg 120

 

aaccgcctga gtcccagcaa ccagactgaa aaacaggccg ccttctgtaa tggtttgagc 180

 

caacccgtcc aggatgcccg cttccagatc atacagctgc ccaacaggca tgacttccac 240

 

atgaacatcc ttgacacacg gcgcaatgac agtggcatct acctctgtgg ggccatctcc 300

 

ctgcacccca aggcaaaaat cgaggagagc cctggagcag agctcgtggt aacagagaga 360

 

atcctggaga cctcaacaag atatcccagc 390

 

 

<210> 3

<211> 1302

<212> DNA

<213> artificial sequence

 

<400> 3

atgctccttt cggtgccgct cctgcttggc ctcctcggcc tggccgccgc agaccctgcc 60

 

atctatttca aagagcagtt cttggacgga gatgcctgga ccaaccgctg ggtcgaatcc 120

 

aaacataagt ccgattttgg caaatttgtc ctcagctctg gcaaatttta cggggacctg 180

 

gagaaggata aagggctgca gacaagccaa gatgcccgat tttacgcact gtccgccaaa 240

 

ttcgaaccct tcagcaataa gggccagaca ctggtggtac agttcacggt gaagcatgag 300

 

cagaatatcg actgtggggg cggctacgtg aagctgtttc cgagtggctt ggaccagaag 360

 

gacatgcatg gagactcaga atataacatc atgtttggtc cggacatctg cggtcctggc 420

 

accaagaagg ttcatgtcat ctttaactac aagggcaaga atgtgctgat caacaaggat 480

 

atccggtgta aggatgatga attcacacac ctatacacac tgattgtgcg gccagacaac 540

 

acctatgagg tgaaaattga caacagccag gtggagtcag gctccttgga ggatgattgg 600

 

gactttctgc cacccaagaa gataaaggac cctgatgctg ccaagccgga agactgggat 660

 

gaacgagcca agatcgatga ccccacagat tccaagcctg aggactggga caagccagag 720

 

cacatccctg accctgatgc taagaagcct gaggactggg atgaagagat ggatggagag 780

 

tgggaaccac cagtgattca aaatcctgaa tacaagggcg agtggaaacc acgtcaaatt 840

 

gacaacccag attacaaggg tacctggata cacccagaag gtggaggtgg atccggtgga 900

 

ggtggagagg tccccaatgg gccctggagg tccctcacct tctacccagc ctggctcaca 960

 

gtgtcagagg gagcaaatgc caccttcacc tgcagcttgt ccaactggtc ggaggatctt 1020

 

atgctgaact ggaaccgcct gagtcccagc aaccagactg aaaaacaggc cgccttctgt 1080

 

aatggtttga gccaacccgt ccaggatgcc cgcttccaga tcatacagct gcccaacagg 1140

 

catgacttcc acatgaacat ccttgacaca cggcgcaatg acagtggcat ctacctctgt 1200

 

ggggccatct ccctgcaccc caaggcaaaa atcgaggaga gccctggagc agagctcgtg 1260

 

gtaacagaga gaatcctgga gacctcaaca agatatccca gc 1302

 

 

 

 

<210> 4

<211> 35

<212> DNA

<213> artificial sequence

 

<400> 4

gtcgaagctt aaccatgctc ctttcggtgc cgctc 35

 

 

<210> 5

<211> 39

<212> DNA

<213> artificial sequence

 

<400> 5

caagggatcc acctccacct tctgggtgta tccaggtac 39

 

 

<210> 6

<211> 42

<212> DNA

<213> artificial sequence

 

<400> 6

caagggatcc ggtggaggtg gagaggtccc caatgggccc tg 42

 

 

<210> 7

<211> 56

<212> DNA

<213> artificial sequence

 

<400> 7

aagctcgagt taatgatgat gatgatgatg acccccgctg ggatatcttg ttgagg 56

 

 

 

 

 

Claims (9)

1. fusion rotein CRT _⊿-sPD1, is characterized in that, this fusion rotein forms by with lower part:

1) calprotectin, its encoding sequence is as shown in SEQ ID NO:1;

2) solubility programmed death acceptor 1, its encoding sequence is as shown in SEQ ID NO:2.

2. fusion rotein CRT according to claim 1 _⊿-sPD1, is characterized in that, described calprotectin and solubility programmed death acceptor 1 derive from mouse.

3. the DNA molecular be separated, is characterized in that, the fusion rotein CRT of its coding claim 1 or 2 _⊿-sPD1.

4. DNA molecular according to claim 4, is characterized in that, it is the nucleotide sequence shown in SEQ ID NO:3.

5. plasmid or carrier, is characterized in that, described plasmid or carrier comprise the DNA molecular of claim 3 or 4.

6. host cell, is characterized in that, it contains the DNA molecular of claim 3 or 4 or the plasmid of claim 5 or carrier.

7. produce the fusion rotein CRT of claim 1 or 2 _⊿the method of-sPD1, is characterized in that, it comprises the following steps:

1) provide DNA molecular, described DNA molecular comprises the encoding said fusion protein CRT that can express in biology _⊿the nucleotide sequence of-sPD1;

2) in described biology, described DNA molecular is expressed to form described fusion rotein CRT _⊿-sPD1; With

3) fusion rotein CRT described in isolated or purified _⊿-sPD1.

8. pharmaceutical composition, is characterized in that, comprises pharmaceutically acceptable carrier or vehicle or thinner, and the fusion rotein CRT of the claim 1 or 2 of significant quantity _⊿the host cell of the DNA molecular of-sPD1 or claim 3 or 4 or the plasmid of claim 5 or carrier or claim 6.

9. the fusion rotein CRT of claim 1 or 2 _⊿the host cell of the DNA molecular of-sPD1 or claim 3 or 4 or the plasmid of claim 5 or carrier or claim 6 is preparing the purposes in medicine, and described medicine is used for the treatment of tumour or immunomodulatory.