CN102888460A

CN102888460A - Multi-landing PCR kit and detection method of streptococcus pneumonia

Info

Publication number: CN102888460A
Application number: CN2012103870267A
Authority: CN
Inventors: 邵世和; 侯艳娇; 罗欲承; 邵晨; 管贤伟; 丁杰; 唐国建
Original assignee: Jiangsu University
Current assignee: Jiangsu University
Priority date: 2012-10-12
Filing date: 2012-10-12
Publication date: 2013-01-23
Anticipated expiration: 2032-10-12
Also published as: CN102888460B

Abstract

The invention relates to a multi-landing PCR kit and a detection method of streptococcus pneumonia. The kit comprises 10*PCR buffer solution, MgC12, dNTP, TaqDNA polymerase, BSA, streptococcus pneumonia positive control DNA and three pair of streptococcus pneumonia primers with a sequence shown by SEQ ID NO.1-6. According to the invention, three pairs of specific primers of the streptococcus pneumonia are designed; the multi-landing PCR kit and the detection method for detecting the streptococcus pneumonia are established; and PCR products are detected by using sepharose gel electrophoresis. The multi-landing PCR kit and the detection method are fast, convenient, specific and flexible and used for rapid diagnosis for infection of the streptococcus pneumonia and epidemiological investigation.

Description

The multiple touchdown PCR detection kit of streptococcus pneumoniae and detection method

Technical field

The present invention relates to the molecular diagnostic techniques field of streptococcus pneumoniae infection, be specifically related to multiple touchdown PCR detection method in Low Respiratory Tract Samples streptococcus pneumoniae ( Streptococcus pneumoniae) application in the detection.

Background technology

Streptococcus pneumoniae has another name called streptococcus pneumoniae, is the main pathogens of community acquired pneumonia (CAP), and fostering requirement is higher.The high risk population that the streptococcus pneumoniae pulmonary infection easily occurs has: behind immune deficiency person, the respiratory virus infection, infant, elderly and infirm.Streptococcus pneumoniae is the Etiological that CAP occurs chronic obstructive pulmonary disease (COPD) patient, and streptococcus pneumoniae also can cause the diseases such as meningitis, otitis media and pyemia in addition.

Corless, C.E etc. (Corless, C.E., et al., Simultaneous detection of Neisseria meningitidis, Haemophilus influenzae, and Streptococcus pneumoniae in suspected cases of meningitis and septicemia using real-time PCR.J Clin Microbiol, 2001. 39(4): p. 1553-8.) set up with PlyGene is the PCR in real time of target detection streptococcus pneumoniae, supports PlyGene is intrinsic by streptococcus pneumoniae.Murdoch, D.R reported with PlyGene be PCR that target is set up part alpha hemolytic streptococcus mistake can be accredited as streptococcus pneumoniae (Murdoch, D.R., Molecular genetic methods in the diagnosis of lower respiratory tract infections.APMIS, 2004. 112(11-12): p. 713-27.) while is detected the specificity that can improve detection method for a plurality of genes of streptococcus pneumoniae.Korbie, D.J. etc. (Korbie, D.J. and J.S. Mattick, Touchdown PCR for increased specificity and sensitivity in PCR amplification.Nat. Protocols, 2008. 3(9): p. 1452-1456.) find specificity and the sensitivity that touchdown PCR can improve PCR.Current there is no simultaneously for streptococcus pneumoniae RecA, Ply, 16S rRNAGene is to detect the multiplex PCR report of streptococcus pneumoniae.But the streptococcus pneumoniae in the multiple touchdown PCR direct-detection Low Respiratory Tract Samples that the present invention sets up, time-consuming few, tool high degree of specificity and susceptibility are conducive to quick diagnosis and the epidemiology survey of streptococcus pneumoniae infection.

Summary of the invention

The technical problem to be solved in the present invention provides in a kind of fast specific detection Low Respiratory Tract Samples Streptococcus pneumoniaeMultiple PCR detection kit and detection method.

In order to solve the problems of the technologies described above, the present invention realizes by following technology incidence of criminal offenses:

A kind of LungThe multiple touchdown PCR detection kit of scorching suis comprises: 10 * PCR damping fluid, and MgCl2, dNTP, TaqArchaeal dna polymerase, BSA, streptococcus pneumoniae positive control dna, 3 pairs of streptococcus pneumoniae primers;

Described 3 pairs of streptococcus pneumoniae primer pair sequences are as follows:

The 1st pair:

SP_recA-F：5’- CAAGCGGAACTTCTTCATTCAC -3’（SEQ ID NO.1）

SP_recA-R：5’- CAGACTCAGGAGAGCAAGGT -3’（SEQ ID NO.2）；

The 2nd pair:

SP_ply-F：5’- GCCTCTATCCTGGAGCACTT -3’（SEQ ID NO.3）

SP_ply-R：5’- AGCAGCCTCTACTTCATCACT -3’（SEQ ID NO.4）；

The 3rd pair:

SP_16S rRNA-F ：5’- CTGTGGCTTAACCATAGTAG -3’（SEQ ID NO.5）

SP_16S rRNA-F: 5’- CTAGCACTCATCGTTTACA -3’（SEQ ID NO.6）。

The invention also discloses the detection method of using the mentioned reagent box:

(1) extracts sample DNA to be checked

(2) in the multiple touchdown PCR method augmentation detection sample DNA to be checked RecA, Ply, 16S rRNAGene, concrete steps are as follows:

Reaction system: 25 μ l

H ₂O 9.05 μl

Damping fluid (10 * PCR) 2.5 μ l

BSA(10 mg/ml) 0.25 μl

SP_recA-F（10 μmol/L） 3 μl

SP_recA-R（10 μmol/L） 3μl

SP_ply-F（10 μmol/L） 0.25 μl

SP_ply-R（10 μmol/L） 0.25 μl

SP_16S rRNA-F（10 μmol/L） 0.5μl

SP_16S rRNA-R（10 μmol/L） 0.5 μl

MgCl ₂(25 mM) 3μl

dNTP(10 mM) 0.5 μl

TaqArchaeal dna polymerase (5 U/ μ l) 0.2 μ l

DNA template 2 μ l

3 pairs of streptococcus pneumoniae primers are:

SP_recA-F：5’- CAAGCGGAACTTCTTCATTCAC -3’（SEQ ID NO.1）

SP_recA-R：5’- CAGACTCAGGAGAGCAAGGT -3’’（SEQ ID NO.2）

SP_ply-F：5’- GCCTCTATCCTGGAGCACTT -3’（SEQ ID NO.3）

SP_ply-R：5’- AGCAGCCTCTACTTCATCACT-3’（SEQ ID NO.4）

SP_16S rRNA-F：5’- CTGTGGCTTAACCATAGTAG -3’（SEQ ID NO.5）

SP_16S rRNA-R：5’- CTAGCACTCATCGTTTACA -3’（SEQ ID NO.6）

(3) PCR reaction cycle parameter is as follows:

94 ℃ of 5 min; 94 ℃ of 30s, 65 ℃ of (every circulation reduces by 0.5 ℃) 30 s, 72 ℃ of 1 min, 20 circulations; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1 min, 20 circulations; 72 ℃ of 7 min;

(4) electrophoresis detection is identified:

Multiple touchdown PCR reaction product is carried out agarose electrophoresis detects, as contain in the electrophorogram in 217 bp, 581 bp, the 735

bp bands

2 or 3 then representative detect streptococcus pneumoniae.

Beneficial effect: the multiple touchdown PCR that the present invention sets up can overcome the problems such as length consuming time, the sensitivity of cellar culture is low, has the features such as quick, easy, special, that sensitivity is high.Can go out the same day test results report, can detect simultaneously 3 genes of streptococcus pneumoniae, the detection lower limit of pneumococcal dna was reached 5 pg.This multiple touchdown PCR can be used for quick diagnosis and the epidemiology survey of streptococcus pneumoniae infection.

Description of drawings

Fig. 1 is the detected result of embodiment 1; Swimming lane 1-13 template corresponds to successively: colon bacillus ( Escherichia coli), streptococcus aureus ( Staphylococcus aureus), Pseudomonas aeruginosa ( Pseudomonas aeruginosa), Klebsiella Pneumoniae ( Klebsiella pneumoniae), Acinetobacter bauamnnii ( Acinetobacter baumannii), block its Moraxella ( Moraxella (Branhamella) catarrhalis), enterococcus faecalis ( Enterococcus faecalis), M. smegmatics ( Mycobacterium smegmatis), hemophilus influenzae ( Streptococcus pneumoniae), mycobacterium tuberculosis ( Mycobacterium tuberculosis), b type hemophilus influenzae, Mycobacterium bovis ( Mycobacterium bovis), mycobacterium bovis BCG ( Mycobacterium bovis BCG); Swimming lane M is: DL2000 DNA molecular mass standard; Swimming lane 14-15 template is followed successively by: the positive control streptococcus pneumoniae ( Streptococcus pneumoniae) and negative control.

Fig. 2 is embodiment 2 detected results; Swimming lane M is DL2000 DNA molecular mass standard; Swimming lane 1-8 template is clinical sputum specimen genomic dna, and the band of 3 corresponding sizes appears in

swimming lane

4,5 in 215 bp, 620 bp, 821 bp places, be judged to and detect streptococcus pneumoniae;

Swimming lane

9,10 positive contrast and negative controls.

Embodiment

Embodiment 1:

Choose respectively and contain GreatlyThe intestines Escherichia ( Escherichia coli), streptococcus aureus ( Staphylococcus aureus), Pseudomonas aeruginosa ( Pseudomonas aeruginosa), Klebsiella Pneumoniae ( Klebsiella pneumoniae), Acinetobacter bauamnnii ( Acinetobacter baumannii), block its Moraxella ( Moraxella (Branhamella) catarrhalis), enterococcus faecalis ( Enterococcus faecalis), M. smegmatics ( Mycobacterium smegmatis), hemophilus influenzae ( Streptococcus pneumoniae), mycobacterium tuberculosis ( Mycobacterium tuberculosis), b type hemophilus influenzae, Mycobacterium bovis ( Mycobacterium bovis), mycobacterium bovis BCG ( Mycobacterium bovis BCG) sputum specimen, the specificity of the multiplex PCR system that the present invention is set up is verified.

The sputum specimen pre-treatment: sputum specimen is used physiological saline washing 2 times, adds 1% pancreatin (same day is now with the current) of equivalent in 37 ℃ of digestion 90 min.

Extract the DNA of bacteria in the sputum specimen: get sputum specimen 1.5 ml that digested and extract the DNA of bacteria in the sputum specimen with Takara minibest bacterial genomes extraction test kit (Takara, Dalian is precious gives birth to).The DNA that extracts is directly used in pcr amplification or places-20 ℃ to save backup.

The total system 25 μ l of pcr amplification, in 200 μ l PCR tubules, add successively 9.05 μ l distilled waters, 2.5 μ l damping fluid (10 * PCR), BSA (10 mg/ml) 0.25 μ l, primer SP_recA-F(10 μ mol/L) 3 μ l, SP_recA-R(10 μ mol/L) 3 μ l, SP_ply-F(10 μ mol/L) 0.25 μ l, SP_ply-R:(10 μ mol/L) 0.25 μ l, SP _ 16S rRNA-F(10 μ mol/L) 0.5 μ l, SP _ 16S rRNA-R(10 μ mol/L) 0.5 μ l, 3 μ l MgCl ₂(25 mM), 0.5 μ l dNTP (10 mM), 0.2 μ l TaqArchaeal dna polymerase (5U/ μ l), the sputum specimen genomic dna that 2 μ l extract.Template corresponds to successively: colon bacillus ( Escherichia coli), streptococcus aureus ( Staphylococcus aureus), Pseudomonas aeruginosa ( Pseudomonas aeruginosa), Klebsiella Pneumoniae ( Klebsiella pneumoniae), Acinetobacter bauamnnii ( Acinetobacter baumannii), block its Moraxella ( Moraxella (Branhamella) catarrhalis), enterococcus faecalis ( Enterococcus faecalis), M. smegmatics ( Mycobacterium smegmatis), hemophilus influenzae ( Streptococcus pneumoniae), mycobacterium tuberculosis ( Mycobacterium tuberculosis), b type hemophilus influenzae, Mycobacterium bovis ( Mycobacterium bovis), mycobacterium bovis BCG ( Mycobacterium bovis BCG); Establish simultaneously streptococcus pneumoniae positive template contrast and negative control (distilled water is as template).Finger flicks mixing, of short durationly puts into the PCR instrument after centrifugal.

3 pairs of streptococcus pneumoniae primers are: amplification fragment length 217 bp of SP_16S rRNA-F and SP_16S rRNA-R; Amplification fragment length 581 bp of SP_ply-F and SP_ply-R; SP_recA-F and SP_recA-R amplification fragment length 735 bp.

PCR reaction cycle parameter is set: 94 ℃ of 5min; 94 ℃ of 30 s, 65 ℃ of (every circulation reduces by 0.5 ℃) 30 s, 72 ℃ of 1 min, 20 circulations; 94 ℃ of 30 s, 55 ℃ of 30 s, 72 ℃ of 1 min, 20 circulations; 72 ℃ of 7 min.

Amplified production carries out 2% agarose gel electrophoresis, applied sample amount is to add behind 5 μ l and the 6 * sample-loading buffer mixing in the glue hole, in 1 * TAE solution, under 100V voltage, electrophoresis 30 min, behind the ethidium bromide soaking and dyeing 10-20 min of electrophoresis by 1 μ g/ μ l, analyzing and testing result in the gel imaging analysis system.Swimming lane 1-13 template corresponds to successively: colon bacillus ( Escherichia coli), streptococcus aureus ( Staphylococcus aureus), Pseudomonas aeruginosa ( Pseudomonas aeruginosa), Klebsiella Pneumoniae ( Klebsiella pneumoniae), Acinetobacter bauamnnii ( Acinetobacter baumannii), block its Moraxella ( Moraxella (Branhamella) catarrhalis), enterococcus faecalis ( Enterococcus faecalis), M. smegmatics ( Mycobacterium smegmatis), hemophilus influenzae ( Streptococcus pneumoniae), mycobacterium tuberculosis ( Mycobacterium tuberculosis), b type hemophilus influenzae, Mycobacterium bovis ( Mycobacterium bovis), mycobacterium bovis BCG ( Mycobacterium bovis BCG); All occur without band, the band of corresponding size appears in swimming lane 14 positive controls in 217 bp, 581 bp, 735 bp places, and swimming lane 15 negative controls are without band.The multiple touchdown PCR system that the proved invention is set up has the specificity (see figure 1).

Embodiment 2:

The total system 25 μ l of pcr amplification, in 200 μ l PCR tubules, add successively 9.05 μ l distilled waters, 2.5 μ l damping fluid (10 * PCR), BSA (10 mg/ml) 0.25 μ l, primer SP_recA-F(10 μ mol/L) 3 μ l, SP_recA-R(10 μ mol/L) 3 μ l, SP_ply-F(10 μ mol/L) 0.25 μ l, SP_ply-R:(10 μ mol/L) 0.25 μ l, SP _ 16S rRNA-F(10 μ mol/L) 0.5 μ l, SP _ 16S rRNA-R(10 μ mol/L) 0.5 μ l, 3 μ l MgCl ₂(25 mM), 0.5 μ l dNTP (10 mM), 0.2 μ l TaqArchaeal dna polymerase (5U/ μ l), the sputum specimen genomic dna that 2 μ l extract.Establish simultaneously Streptococcus pneumoniaePositive template contrast and negative control (distilled water is as template).Finger flicks mixing, of short durationly puts into the PCR instrument after centrifugal.

Amplified production carries out 2% agarose gel electrophoresis, applied sample amount is to add behind 5 μ l and the 6 * sample-loading buffer mixing in the glue hole, in 1 * TAE solution, under 100V voltage, electrophoresis 30 min, behind the ethidium bromide soaking and dyeing 10-20 min of electrophoresis by 1 μ g/ μ l, analyzing and testing result in the gel imaging analysis system.Without band, the band of corresponding size appears in positive control in 217 bp, 581 bp, 735 bp places such as negative control, detect sample occur in 217 bp, 581 bp, the 735

bp bands

2 or 3 then representative detect the streptococcus pneumoniae (see figure 2); Non-specific band appears in the band or the negative control that do not occur corresponding size such as positive control in 217 bp, 581 bp, 735 bp places, then is judged to the failure of an experiment, needs again to detect.

SEQUENCE LISTING

＜110〉Jiangsu University

＜120〉the multiple touchdown PCR detection kit of streptococcus pneumoniae and detection method

<130>

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 22

<212> DNA

＜213〉artificial sequence

<400> 1

caagcggaac ttcttcattc ac 22

<210> 2

<211> 20

<212> DNA

＜213〉artificial sequence

<400> 2

cagactcagg agagcaaggt 20

<210> 3

<211> 20

<212> DNA

＜213〉artificial sequence

<400> 3

gcctctatcc tggagcactt 20

<210> 4

<211> 21

<212> DNA

＜213〉artificial sequence

<400> 4

agcagcctct acttcatcac t 21

<210> 5

<211> 20

<212> DNA

＜213〉artificial sequence

<400> 5

ctgtggctta accatagtag 20

<210> 6

<211> 19

<212> DNA

＜213〉artificial sequence

<400> 6

ctagcactca tcgtttaca 19

Claims

1. the multiple touchdown PCR detection kit of streptococcus pneumoniae comprises: 10 * PCR damping fluid, MgCl ₂, dNTP, Taq archaeal dna polymerase, BSA, streptococcus pneumoniae positive control dna, 3 pairs of streptococcus pneumoniae primers; Described 3 pairs of pneumonia streptococcus primers are:

SP_recA-F：5’- CAAGCGGAACTTCTTCATTCAC -3’

SP_recA-R：5’-CAGACTCAGGAGAGCAAGGT -3’

SP_ply-F：5’- GCCTCTATCCTGGAGCACTT -3’

SP_ply-R：5’- AGCAGCCTCTACTTCATCACT-3’

SP_16S rRNA-F：5’- CTGTGGCTTAACCATAGTAG -3’

SP_16S rRNA-R：5’- CTAGCACTCATCGTTTACA -3’。

2. multiple touchdown PCR detection method of streptococcus pneumoniae is characterized in that the method may further comprise the steps:

(1) extracts sample DNA to be checked

(2) in the Multiplex PCR augmentation detection sample DNA to be checked RecA, ply, 16S rRNAGene, concrete steps are as follows:

Reaction system: 25 μ l comprise H ₂O 9.05 μ l, damping fluid (10 * PCR) 2.5 μ l, BSA (10 mg/ml) 0.25 μ l, SP_recA-F(10 μ mol/L) 3 μ l, SP_recA-R(10 μ mol/L) 3 μ l, SP_ply-F(10 μ mol/L) 0.25 μ l, SP_ply-R:(10 μ mol/L) 0.25 μ l, SP _ 16S rRNA-F(10 μ mol/L) 0.5 μ l, SP _ 16S rRNA-R(10 μ mol/L) 0.5 μ l, MgCl ₂(25 mM) 3 μ l, dNTP (10 mM) 0.5 μ l, Taq archaeal dna polymerase (5 U/ μ l) 0.2 μ l, DNA template 2 μ l

3 pairs of pneumonia streptococcus primers are:

SP_recA-F：5’- CAAGCGGAACTTCTTCATTCAC -3’

SP_recA-R：5’-CAGACTCAGGAGAGCAAGGT -3’

SP_ply-F：5’- GCCTCTATCCTGGAGCACTT -3’

SP_ply-R：5’- AGCAGCCTCTACTTCATCACT-3’

SP_16S rRNA-F：5’- CTGTGGCTTAACCATAGTAG -3’

SP_16S rRNA-R：5’- CTAGCACTCATCGTTTACA -3’

(3) PCR reaction cycle parameter is as follows:

94 ℃ of 5min; 94 ℃ of 30s, 65 ℃ of (every circulation reduces by 0.5 ℃) 30 s, 72 ℃ of 1 min, 20 circulations; 94 ℃ of 30s, 55 ℃ of 30s, 72 ℃ of 1 min, 20 circulations; 72 ℃ of 7 min

(4) electrophoresis detection is identified:

Multiple touchdown PCR reaction product is carried out agarose electrophoresis detects, as contain in the electrophorogram in 217 bp, 581 bp, the 735 bp bands 2 or 3 then representative detect streptococcus pneumoniae.