CN102861327A - Cell inactivated vaccine, egg yoke antibody and injection and freeze-dried powder containing same - Google Patents
Cell inactivated vaccine, egg yoke antibody and injection and freeze-dried powder containing same Download PDFInfo
- Publication number
- CN102861327A CN102861327A CN2012103649202A CN201210364920A CN102861327A CN 102861327 A CN102861327 A CN 102861327A CN 2012103649202 A CN2012103649202 A CN 2012103649202A CN 201210364920 A CN201210364920 A CN 201210364920A CN 102861327 A CN102861327 A CN 102861327A
- Authority
- CN
- China
- Prior art keywords
- cell
- yolk
- antibody
- yolk antibody
- inactivated vaccine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses cell inactivated vaccine which simultaneously contains porcine circovirus epitopes and goose circovirus epitopes. The cell inactivated vaccine is prepared by the method including screening high-pathogenicity strains from porcine circoviruses; selecting a plurality of virus epitopes; connecting the epitopes with one another; then inserting the connected epitopes into genomes of goose circoviruses to proliferate; and adding Freund adjuvants to formaldehyde for inactivation so as to obtain the cell inactivated vaccine. The invention simultaneously discloses an egg yolk antibody prepared from the cell inactivated vaccine, injection and freeze-dried powder containing the egg yolk antibody. Genes of the porcine circovirus are inserted into the genomes of the goose circoviruses, the immunogenicity of the goose circoviruses is strengthened, immune systems of goose bodies are excited, so that the titer of generated antibodies is higher than that of egg yolk antibodies generated by porcine circovirus vaccine used singularly, a clinical application effect is good, and generated circovirus antibodies have an auxiliary treatment effect for porcine circovirus diseases.
Description
Technical field
The present invention relates to injection and the lyophilized powder of a kind of cell inactivated vaccine, yolk antibody and yolk antibody, belong to disease immunity field.
Background technology
Porcine circovirus 2 type (PVC2) is the main pathogen of postweaning multisystemic wasting syndrome and nephropathy dermatitis syndrome, should disease also can cause immunosuppressant simultaneously, easily cause secondary or the accompanying infection of other diseases, have the characteristics such as high rate, high popular, highly pathogenic, high death, caused huge economic loss to pig industry.The mechanism of causing a disease of PVC2 it be unclear that, and it is considered to cause the main cause of relevant swine diseases to the immune destruction of pig.Because immunity degradation, pig is attacked by other cause of diseases easily stress be with pathogen infection the time, and its clinical symptoms is mainly progressive emaciation, anemia and jaundice.Means of prevention has antiviral agents, Chinese medicine etc. now, but poor effect.
Chicken yolk antibody IgY is a kind of Mitochondrion IgG of chicken, and chicken IgY is equivalent to mammal IgG in function, but different on the structure, has the space conformation of typical immunoglobulin.Chicken yolk antibody has lot of superiority: (1) owing to the gap of birds and mammal phylogenetics, birds are more suitable for producing the specific antibody of resisting mammal antigen.Yolk antibody can not excite complement system, and the antibody with resisting mammal antigen does not react, and with the Fc receptors bind of mammal and antibacterial, this is not significant in immunologic diagnosis.(2) yolk antibody has a bioactive immunoglobulin as a kind of, store, produce, process, ingest and digestion process in guarantee that its stability is very crucial.Multitest shows, chicken IgY has preferably stability, and is acidproof, alkaline-resisting, heat-resisting.Yolk antibody is more easily preserved, deposited 5 years under 4 ℃ of conditions or room temperature condition under deposit 6 months antagonist activity and have no significant effect.(3) the yolk antibody amount is large, and cost is low, is convenient to large-scale production.Antibody from yolk concentration can long term maintenance be equivalent to even surpass on the level of serum antibody concentration.1 laying hen is (on average to lay eggs weekly 5 ~ 6 pieces, the about 15mL calculating of average every piece of egg yolk) the antibody amount of the production of laying eggs is equivalent to the amount of 90 ~ 100mL serum or 180 ~ 200mL antibodies in blood, for example 1 rabbit can be extracted approximately 200mg of IgG in 1 month, and 1 month 1 laying hen can be extracted more than the IgY2000mg from egg.In addition, in actual production, the blood sampling of animal not only to animal itself be greatly stress, and time-consuming, take a lot of work, large-scale production is unpractical, and it is many easily to utilize laying hen to produce antibody.Generally, yolk antibody does not have toxic and side effects to animal, not only avoided the shortcoming that hyper-immune serum is expensive, yield poorly with high immunity yolk antibody treatment Animal diseases, and the side effect that can avoid hyper-immune serum in therapeutic process, to cause, be a kind of up-and-coming novel immunoglobulin preparation.The preparation of yolk antibody and production technology are ripe at present, the production that can guarantee both quality and quantity, and yolk antibody is more and more in the application of diseases of bird and livestock diagnosis, treatment and prevention.But the at present treatment of resisting porcine circovirus 2 type vaccines is more single, and the yolk antibody preparation method is loaded down with trivial details, and the loss of antibody is higher.
Summary of the invention
The purpose of this invention is to provide a kind of cell inactivated vaccine.
In order to realize above purpose, the technical solution adopted in the present invention provides a kind of cell inactivated vaccine, is prepared by following methods:
1) gets pathological material of disease and make homogenate, with the centrifugal 15-20min of 10000-12000rpm, get supernatant behind the multigelation, filter, inoculation sensitive single-layer PK-15 cell;
2) with the continuous passage of PK-15 cell, the cell freeze thawing, extract the DNA of PCV2 virus, for PCV2 virus O RF1 gene, two pairs of specific PCR primer pair genes of interest amplifications that formed by the nucleotide sequence of the nucleotide sequence with SEQ ID NO:1 and SEQ ID NO:2 in the sequence table and SEQ ID NO:3 and SEQ ID NO:4;
3) extension amplification outcome enters the PMD-18T carrier and checks order, and identifies;
4) a plurality of virus epitopes with antigen immune activity of screening, through specific primer PCR, product electrophoresis, order-checking, clone, purification, detect each epi-position protein immunization active, select 5 epitope points;
5) 5 epitope points are connected, be inserted in the goose porcine circovirus standard strain gene, then virus goes down to posterity the strain of adaptive immune originality at sensitivity cell PK-15 monolayer;
6) enlarge propagation, measure virus titer with the IPMA method;
7) show stabilized cell pathological changes occurrence law when virus goes down to posterity in the PK-15 cell, the malicious valency of planting poison is stabilized in 10
3.9TCID
50/ 1.0ml, collecting cell, formalin-inactivated Jia Fushi adjuvant makes the cell inactivated vaccine.
The cell multigelation is 3 times in the described step 1).
Filter in the described step 1) and adopt 0.22 μ m filter membrane.
Described step 2) in 6 generations of PK-15 cell continuous passage in, step 5) virus went down to posterity for 45 generations at cell PK-15 monolayer.
The present invention also aims to provide a kind of yolk antibody of cell inactivated vaccine preparation.
Technical program of the present invention also lies in providing a kind of yolk antibody of cell inactivated vaccine preparation, prepared by following methods:
1) uses the bacteria inactivation vaccine, healthy laying hen group carried out fundamental immunity, booster immunization and three immunity of reinforced immunological in every interval 7-10 days, begin to detect antibody titer behind the booster immunization, tire and reach 1:64 when above when the pig circular ring virus antibody titer reaches 1:64, goose circovirus antibody, collect high-immunity egg;
2) cleaning, sterilization high-immunity egg dry, and asepsis is got yolk, obtains yolk stock solution;
3) add isopyknic sterilized water in yolk stock solution, stirring and evenly mixing to color is turned white, and obtains yolk solution;
4) yolk solution is put into 60-65 ℃ of water-bath homogeneous heating 30min, then added the acidified aqueous solution of 4-6 ℃ of pH4.9-5.2 temperature, addition is 6 times of yolk liquor capacity, mixing staticly settles, and gets supernatant, the centrifugal 20min of 15000rpm gets supernatant;
5) add in the supernatant sadly, sad addition is the 0.8-1.0% of liquor capacity, and mixing leaves standstill, and discards the impurity floating thing, and the centrifugal 10min of 20000rpm gets supernatant, leaves standstill;
6) with the filter membrane of 0.45 μ m to step 5) gained supernatant liquid filtering, obtain yolk antibody solution, again through the membrane filtration of MCW 300KD, the solution that contains yolk antibody that obtains making with extra care.
The amount of basic immunity bacteria inactivation vaccine is 1.5ml in the described step 1), 1 times of booster immunization and reinforced immunological inoculation dosage.
Acidified aqueous solution is the acidifying water of hydrochloric acid preparation in the described step 4), and pre-cool time is 1-2h.
The present invention also aims to provide the injection that contains yolk antibody.
Technical program of the present invention also lies in providing the injection that contains yolk antibody, this yolk antibody injection comprises 1 part of yolk antibody solution, formaldehyde 0.002-0.003 part and thimerosal 0.0001-0.0002 part.
The present invention also aims to provide the lyophilized powder that contains yolk antibody.
Technical program of the present invention also lies in providing the lyophilized powder that contains yolk antibody, this yolk antibody lyophilized powder comprises 1 part of yolk antibody solution, formaldehyde 0.002-0.003 part, thimerosal 0.0001-0.0002 part, glucose 0.03-0.04 part, sorbitol 0.01-0.02 part, glycine 0.02-0.03 part and mannitol 0.030.04 part.
The present invention has adopted up-to-date cold and hot acidification yolk liquid technology, sterilization and acidification are carried out synchronously, reduced production stage, also relatively reduce the loss of antibody, this product is the biological preparation that a kind of poultry can be used simultaneously, compare and produce corresponding serum product, Cost reduction and labor intensity.The vaccine that this product adopts gene integration technology, clone etc. to select advanced technology to make increases its immunogenicity and Antybody therapy scope, the porcine circovirus gene of pig is inserted in the goose porcine circovirus genome, enhancing is to the immunogenicity of goose porcine circovirus with to the immune stimulation of goose body, make it produce yolk antibody that antibody produces than the single use pig circular ring virus vaccine height of tiring, clinical application effect is good, and the annulus antibody that produces simultaneously goose has adjuvant treatment effect to pig annulus disease.
The specific embodiment
The pig farm of serious pig circular ring virus 2 occurs in pathological material of disease collection of the present invention from Shandong District.
Embodiment 1
The cell inactivated vaccine that the present embodiment provides is prepared by following methods:
1) get pathological material of disease and make homogenate, behind the multigelation 3 times, the centrifugal 15-20min of 10000-12000rpm gets supernatant, through 0.22 μ m membrane filtration, and inoculation sensitive single-layer PK-15 cell;
2) with the continuous passage of PK-15 cell, the cell freeze thawing, extract the DNA of PCV2 virus, for PCV2 virus O RF1 gene, two pairs of specific PCR primer pair genes of interest amplifications that formed by the nucleotide sequence of the nucleotide sequence with SEQ ID NO:1 and SEQ ID NO:2 in the sequence table and SEQ ID NO:3 and SEQ ID NO:4, wherein
Primer 1PCV2.1:5'-TTCGGTACCAGCTATGACGTATCCAAG-3'(SEQ ID NO:1),
PCV2.2：5'-GCCAAGCTTTCACTTCGTAATGGTTTT-3'（SEQ ID NO：2）；
Primer 2 PCV2.1:5'-TTGGCCTAAGCTATGACGTATCCAA-3'(SEQ ID NO:3),
PCV2.2：5'-CCAAGCTTTCACTTCGTTGAAGTTT-3'（SEQ ID NO：4）；
3) extension amplification outcome enters the PMD-18T carrier and checks order, and identifies;
4) a plurality of virus epitopes with antigen immune activity of screening, through specific primer PCR, product electrophoresis, order-checking, clone, purification, detect each epi-position protein immunization active, select 5 epitope points;
5) with splicing 5 epitope points are connected, be inserted in the goose porcine circovirus standard strain gene, then virus went down to posterity for 45 generations the strain of adaptive immune originality at sensitivity cell PK-15 monolayer;
6) enlarge propagation, measure virus titer with the IPMA method;
7) show stabilized cell pathological changes occurrence law when virus goes down to posterity in the PK-15 cell, the malicious valency of planting poison is stabilized in 10
3.9TCID
50/ 1.0ml, collecting cell, formalin-inactivated Jia Fushi adjuvant mixing makes the cell inactivated vaccine.
Embodiment 2
The yolk antibody that the present embodiment provides is prepared by following methods:
1) uses the bacteria inactivation vaccine, fundamental immunity, booster immunization and three immunity of reinforced immunological are carried out to healthy laying hen group in every interval 7 days, basic immunity vaccine 1.5ml, 1 times of booster immunization and reinforced immunological inoculation dosage, begin to detect antibody titer behind the booster immunization, tire and reach 1:64 when above when the pig circular ring virus antibody titer reaches 1:64, goose circovirus antibody, collect high-immunity egg;
2) flowing water cleaning, 84 disinfectant solution sterilization high-immunity egg dry, and asepsis is got yolk, obtains yolk stock solution;
3) add isopyknic sterilized water in yolk stock solution, stirring and evenly mixing to color is turned white, and obtains yolk solution;
4) yolk solution is put into 60 ℃ of water-bath homogeneous heating 30min, then added the aqueous hydrochloric acid solution of 4 ℃ of pH4.9 temperature, addition is 6 times of yolk liquor capacity, and mixing staticly settles, and gets supernatant, and the centrifugal 20min of 15000rpm gets supernatant;
5) add in the supernatant sadly, sad addition is 0.8% of liquor capacity, and mixing leaves standstill, and discards the impurity floating thing, and the centrifugal 10min of 20000rpm gets supernatant, leaves standstill;
6) with the filter membrane of 0.45 μ m to step 5) gained supernatant liquid filtering, obtain yolk antibody solution, again through the membrane filtration of MCW 300KD, the solution that contains yolk antibody that obtains making with extra care.
Embodiment 3
The yolk antibody that the present embodiment provides is prepared by following methods:
1) uses the bacteria inactivation vaccine, fundamental immunity, booster immunization and three immunity of reinforced immunological are carried out to healthy laying hen group in every interval 10 days, basic immunity vaccine 1.5ml, 1 times of booster immunization and reinforced immunological inoculation dosage, begin to detect antibody titer behind the booster immunization, tire and reach 1:64 when above when the pig circular ring virus antibody titer reaches 1:64, goose circovirus antibody, collect high-immunity egg;
2) flowing water cleaning, bromo geramine sterilization high-immunity egg dry, and asepsis is got yolk, obtains yolk stock solution;
3) add isopyknic sterilized water in yolk stock solution, stirring and evenly mixing to color is turned white, and obtains yolk solution;
4) yolk solution is put into 65 ℃ of water-bath homogeneous heating 30min, then added the aqueous hydrochloric acid solution of 6 ℃ of pH5.2 temperature, addition is 6 times of yolk liquor capacity, and mixing staticly settles, and gets supernatant, and the centrifugal 20min of 15000rpm gets supernatant;
5) add in the supernatant sadly, sad addition is 1.0% of liquor capacity, and mixing leaves standstill, and discards the impurity floating thing, and the centrifugal 10min of 20000rpm gets supernatant, leaves standstill;
6) with the filter membrane of 0.45 μ m to step 5) gained supernatant liquid filtering, obtain yolk antibody solution, again through the membrane filtration of MCW 300KD, the solution that contains yolk antibody that obtains making with extra care.
Embodiment 4
The yolk antibody that the present embodiment provides is prepared by following methods:
1) uses the bacteria inactivation vaccine, fundamental immunity, booster immunization and three immunity of reinforced immunological are carried out to healthy laying hen group in every interval 8 days, basic immunity vaccine 1.5ml, 1 times of booster immunization and reinforced immunological inoculation dosage, begin to detect antibody titer behind the booster immunization, tire and reach 1:64 when above when the pig circular ring virus antibody titer reaches 1:64, goose circovirus antibody, collect high-immunity egg;
2) flowing water cleaning, bromo geramine sterilization high-immunity egg dry, and asepsis is got yolk, obtains yolk stock solution;
3) add isopyknic sterilized water in yolk stock solution, stirring and evenly mixing to color is turned white, and obtains yolk solution;
4) yolk solution is put into 63 ℃ of water-bath homogeneous heating 30min, then added the aqueous hydrochloric acid solution of 5 ℃ of pH5.0 temperature, addition is 6 times of yolk liquor capacity, and mixing staticly settles, and gets supernatant, and the centrifugal 20min of 15000rpm gets supernatant;
5) add in the supernatant sadly, sad addition is 0.9% of liquor capacity, and mixing leaves standstill, and discards the impurity floating thing, and the centrifugal 10min of 20000rpm gets supernatant, leaves standstill;
6) with the filter membrane of 0.45 μ m to step 5) gained supernatant liquid filtering, obtain yolk antibody solution, again through the membrane filtration of MCW 300KD, the solution that contains yolk antibody that obtains making with extra care.
Embodiment 5
The injection that contains embodiment 2 yolk antibodies that the present embodiment provides comprises 1 part of embodiment 2 yolk antibody solution, 0.002 part in formaldehyde, 0.0001 part of thimerosal.
The preparation method of yolk antibody injection may further comprise the steps: 1 part of the yolk antibody solution that embodiment 2 is refining, through the degerming membrane filtration, get filtrate, and add 0.002 part of formaldehyde and 0.0001 part of thimerosal, obtain the yolk antibody injection.
Antibody titer changes when detecting at normal temperatures the placement of the present embodiment yolk antibody injection, determine the shelf-life of this product with this, done following test: this product is kept in 37 ℃ of incubators, preserved 24 months, respectively 1 week, 2 weeks, January, February, April, August, December, after 16 months, 20 months, 24 months, with agar diffusion (AGP) method, the variation of tiring of the yolk antibody of measuring each point in time sampling product the results are shown in Table 1.
Table 1 room temperature is placed the variation that the injection different time sections is tired
Quality standard:
[character] this product is faint yellow, is fine and close agglomerate.
[steriling test] carries out asepsis growth by " Chinese veterinary pharmacopoeia ".
[mycoplasma check] undertaken by " Chinese veterinary pharmacopoeia ", grows without mycoplasma.
[exogenous virus check] undertaken by " Chinese veterinary pharmacopoeia ", and be up to specification.
[safety verification] with 5 of 12 age in days SPF chickens, each intramuscular injection plumage part observed for 2 weeks, should all be good for and live, and the injection site does not have pathological changes.
[shelf-life] can deposit 2 years according to room temperature bioactivity experimental result.
[efficacy test] is diluted to 1 part/mL by the specification of producing.
1) protection detects: with 30 of nursery pig, be divided into 3 groups, 10 every group, be respectively test group, matched group and blank group.To 10 pig muscle injection 0.1mL/kg yolk antibody injection of test group, matched group and the isolated rearing of blank group.Behind the 24h, get test group and the intramuscular injection of matched group nursery pig inoculation diluting cells virus liquid, record 96h death condition, the protective rate of test group is more than 96%, and counteracting toxic substances matched group mortality rate is more than 82%, and blank group pig is not any change.
2) healing power is measured: with 30 of nursery pig, 10 as negative control group, the cytopathy venom after 20 inoculation dilutions, infect 12h after, wherein 10 as treatment group, every intramuscular injection this product 0.1mL/kg, every day 1 time, continuous 3 days, in addition 10 as positive controls, isolated rearing.72h after the treatment, death condition respectively organized in record, and counteracting toxic substances positive controls mortality rate is more than 83%, and the treatment group survival rate is more than 90%, and 10 of healthy negative control group are not any change.
Embodiment 6
The injection that contains embodiment 3 yolk antibodies that the present embodiment provides comprises 1 part of embodiment 3 yolk antibody solution, 0.003 part in formaldehyde, 0.0002 part of thimerosal.
The preparation method of yolk antibody injection may further comprise the steps: 1 part of the yolk antibody solution that embodiment 3 is refining, through the degerming membrane filtration, get filtrate, and add 0.003 part of formaldehyde and 0.0002 part of thimerosal, obtain the yolk antibody injection.
Antibody titer changes when detecting at normal temperatures the placement of the present embodiment yolk antibody injection, determine the shelf-life of this product with this, done following test: this product is kept in 37 ℃ of incubators, preserved 24 months, respectively 1 week, 2 weeks, January, February, April, August, December, after 16 months, 20 months, 24 months, with agar diffusion (AGP) method, the variation of tiring of the yolk antibody of measuring each point in time sampling product the results are shown in Table 2.
Table 2 room temperature is placed the variation that the injection different time sections is tired
Quality standard:
[character] this product is faint yellow, is fine and close agglomerate.
[steriling test] carries out asepsis growth by " Chinese veterinary pharmacopoeia ".
[mycoplasma check] undertaken by " Chinese veterinary pharmacopoeia ", the mycoplasma growth.
[exogenous virus check] undertaken by " Chinese veterinary pharmacopoeia ", should be up to specification.
[safety verification] with 5 of 12 age in days SPF chickens, each intramuscular injection plumage part observed for 2 weeks, should all be good for and live, and the injection site does not have pathological changes.
[shelf-life] can deposit 2 years according to room temperature bioactivity experimental result.
[efficacy test] is diluted to 1 part/mL by the specification of producing.
1) protection detects: with 30 of nursery pig, be divided into 3 groups, 10 every group, be respectively test group, matched group and blank group.To 10 pig muscle injection 0.1mL/kg yolk antibody injection of test group, matched group and the isolated rearing of blank group.Behind the 24h, get test group and the intramuscular injection of matched group nursery pig inoculation diluting cells virus liquid, record 96h death condition, the protective rate of test group is more than 95%, and counteracting toxic substances matched group mortality rate is more than 86%, and blank group pig is not any change.
2) healing power is measured: with 30 of nursery pig, 10 as negative control group, the cytopathy venom after 20 inoculation dilutions, infect 12h after, wherein 10 as treatment group, every intramuscular injection this product 0.1mL/kg, every day 1 time, continuous 3 days, in addition 10 as positive controls, isolated rearing.72h after the treatment, death condition respectively organized in record, and counteracting toxic substances positive controls mortality rate is more than 80%, and the treatment group survival rate is more than 90%, and 10 of healthy negative control group are not any change.
Embodiment 7
The injection that contains embodiment 4 yolk antibodies that the present embodiment provides comprises 1 part of embodiment 4 yolk antibody solution, 0.003 part in formaldehyde, 0.0001 part of thimerosal.
The preparation method of yolk antibody injection may further comprise the steps: 1 part of the yolk antibody solution that embodiment 4 is refining, through the degerming membrane filtration, get filtrate, and add 0.003 part of formaldehyde and 0.0001 part of thimerosal, obtain the yolk antibody injection.
Antibody titer changes when detecting at normal temperatures the placement of the present embodiment yolk antibody injection, determine the shelf-life of this product with this, done following test: this product is kept in 37 ℃ of incubators, preserved 24 months, respectively 1 week, 2 weeks, January, February, April, August, December, after 16 months, 20 months, 24 months, with agar diffusion (AGP) method, the variation of tiring of the yolk antibody of measuring each point in time sampling product the results are shown in Table 3.
Table 3 room temperature is placed the variation that the injection different time sections is tired
Quality standard:
[character] this product is faint yellow, is fine and close agglomerate.
[steriling test] carries out asepsis growth by " Chinese veterinary pharmacopoeia ".
[mycoplasma check] undertaken by " Chinese veterinary pharmacopoeia ", the mycoplasma growth.
[exogenous virus check] undertaken by " Chinese veterinary pharmacopoeia ", should be up to specification.
[safety verification] with 5 of 12 age in days SPF chickens, each intramuscular injection plumage part observed for 2 weeks, should all be good for and live, and the injection site does not have pathological changes.
[shelf-life] can deposit 2 years according to room temperature bioactivity experimental result.
[efficacy test] is diluted to 1 part/mL by the specification of producing.
1) protection detects: with 30 of nursery pig, be divided into 3 groups, 10 every group, be respectively test group, matched group and blank group.To 10 pig muscle injection 0.1mL/kg yolk antibody injection of test group, matched group and the isolated rearing of blank group.Behind the 24h, get test group and the intramuscular injection of matched group nursery pig inoculation diluting cells virus liquid, record 96h death condition, the protective rate of test group is more than 95%, and counteracting toxic substances matched group mortality rate is more than 85%, and blank group pig is not any change.
2) healing power is measured: with 30 of nursery pig, 10 as negative control group, the cytopathy venom after 20 inoculation dilutions, infect 12h after, wherein 10 as treatment group, every intramuscular injection this product 0.1mL/kg, every day 1 time, continuous 3 days, in addition 10 as positive controls, isolated rearing.72h after the treatment, death condition respectively organized in record, and counteracting toxic substances positive controls mortality rate is more than 85%, and the treatment group survival rate is more than 95%, and 10 of healthy negative control group are not any change.
Embodiment 8
The present embodiment provides contains embodiment 2 yolk antibody lyophilized powders, comprises 1 part of embodiment 2 yolk antibody solution, 0.002 part in formaldehyde, 0.0001 part of thimerosal, 0.04 part of glucose, 0.01 part of sorbitol, 0.03 part of glycine, 0.03 part in mannitol.
The preparation method of yolk antibody lyophilized powder, may further comprise the steps: 1 part of the yolk antibody solution that embodiment 2 is refining, through the degerming membrane filtration, get filtrate, add 0.002 part of formaldehyde, 0.0001 part thimerosal, 0.04 part of glucose, 0.01 part of sorbitol, 0.03 part of glycine, 0.03 part in mannitol prepares the yolk antibody lyophilized powder through the lyophilizing program.The lyophilizing program is that 40 ℃ of ﹣ begin distillation, is raised to 35 ℃ of ﹣ behind the 2h and keeps 14h.
Embodiment 9
The present embodiment provides contains embodiment 3 yolk antibody lyophilized powders, comprises 1 part of embodiment 3 yolk antibody solution, 0.003 part in formaldehyde, 0.0002 part of thimerosal, 0.04 part of glucose, 0.01 part of sorbitol, 0.03 part of glycine, 0.03 part in mannitol.
The preparation method of yolk antibody lyophilized powder, may further comprise the steps: 1 part of the yolk antibody solution that embodiment 3 is refining, through the degerming membrane filtration, get filtrate, add 0.003 part of formaldehyde, 0.0002 part thimerosal, 0.04 part of glucose, 0.01 part of sorbitol, 0.03 part of glycine, 0.03 part in mannitol prepares the yolk antibody lyophilized powder through the lyophilizing program.The lyophilizing program is that 40 ℃ of ﹣ begin distillation, is raised to 35 ℃ of ﹣ behind the 2h and keeps 14h.
Embodiment 10
The present embodiment provides contains embodiment 4 yolk antibody lyophilized powders, comprises 1 part of embodiment 4 yolk antibody solution, 0.003 part in formaldehyde, 0.0001 part of thimerosal, 0.04 part of glucose, 0.01 part of sorbitol, 0.03 part of glycine, 0.03 part in mannitol.
The preparation method of yolk antibody lyophilized powder, may further comprise the steps: 1 part of the yolk antibody solution that embodiment 4 is refining, through the degerming membrane filtration, get filtrate, add 0.003 part of formaldehyde, 0.0001 part thimerosal, 0.04 part of glucose, 0.01 part of sorbitol, 0.03 part of glycine, 0.03 part in mannitol prepares the yolk antibody lyophilized powder through the lyophilizing program.The lyophilizing program is that 40 ℃ of ﹣ begin distillation, is raised to 35 ℃ of ﹣ behind the 2h and keeps 14h.
The commercially available prod Performance Ratio of yolk antibody injection of the present invention and emergence sales company is:
With 60 of nursery pig, make this group of products for first group 30, second group 30 as the commercially available prod group, isolated rearing, cytopathy venom after the subcutaneous vaccination dilution, when showing clinical symptoms, begin treatment, first group every intramuscular injection this product 0.1mL/kg, every day 1 time, continuous 3 days, second group of intramuscular injection commercially available prod 0.1mL/kg, every day 1 time, continuous 3 days.72h after the treatment, each group morbidity of record and treatment situation are as shown in table 4.
Table 4 each group morbidity and treatment situation
Sequence table
SEQUENCE LISTING
＜110〉Zhengzhou Houyi Pharmaceutical Co., Ltd.
＜120〉injection and the lyophilized powder of a kind of cell inactivated vaccine, yolk antibody and yolk antibody
<130>
<160>4
<210>1
<211>27
<212>DNA
＜213〉artificial sequence
<400>1
ttcggtaccagctatgacgtatccaag 27
<210>2
<211>27
<212>DNA
＜213〉artificial sequence
<400>2
gccaagctttcacttcgtaatggtttt 27
<210>3
<211>25
<212>DNA
＜213〉artificial sequence
<400>3
ttggcctaagctatgacgtatccaa 25
<210>4
<211>25
<212>DNA
＜213〉artificial sequence
<400>4
ccaagctttcacttcgttgaagttt 25
Claims (9)
1. a cell inactivated vaccine is characterized in that, is prepared by following methods:
1) get pathological material of disease and make homogenate, centrifugal behind the multigelation, the centrifugal 15-20min of 10000-12000rpm gets supernatant, filters inoculation sensitive single-layer PK-15 cell;
2) with the continuous passage of PK-15 cell, the cell freeze thawing, extract the DNA of PCV2 virus, for PCV2 virus O RF1 gene, two pairs of specific PCR primer pair genes of interest amplifications that formed by the nucleotide sequence of the nucleotide sequence with SEQ ID NO:1 and SEQ ID NO:2 in the sequence table and SEQ ID NO:3 and SEQ ID NO:4;
3) extension amplification outcome enters the PMD-18T carrier and checks order, and identifies;
4) a plurality of virus epitopes with antigen immune activity of screening, through specific primer PCR, product electrophoresis, order-checking, clone, purification, detect each epi-position protein immunization active, select 5 epitope points;
5) 5 epitope points are connected, be inserted in the goose porcine circovirus standard strain gene, then virus goes down to posterity the strain of adaptive immune originality at sensitivity cell PK-15 monolayer;
6) enlarge propagation, measure virus titer with the IPMA method;
7) show stabilized cell pathological changes occurrence law when virus goes down to posterity in the PK-15 cell, the malicious valency of planting poison is stabilized in 10
3.9TCID
50/ 1.0ml, collecting cell, formalin-inactivated Jia Fushi adjuvant makes the cell inactivated vaccine.
2. a kind of cell inactivated vaccine according to claim 1 is characterized in that, the cell multigelation is 3 times in the described step 1).
3. a kind of cell inactivated vaccine according to claim 1 is characterized in that, filters in the described step 1) and adopts 0.22 μ m filter membrane.
4. a kind of cell inactivated vaccine according to claim 1 is characterized in that described step 2) in 6 generations of PK-15 cell continuous passage, step 5) virus went down to posterity for 45 generations at cell PK-15 monolayer.
5. the yolk antibody of a cell inactivated vaccine preparation as claimed in claim 1 is characterized in that, is prepared by following methods:
1) uses the bacteria inactivation vaccine, healthy laying hen group carried out fundamental immunity, booster immunization and three immunity of reinforced immunological in every interval 7-10 days, begin to detect antibody titer behind the booster immunization, tire and reach 1:64 when above when the pig circular ring virus antibody titer reaches 1:64, goose circovirus antibody, collect high-immunity egg;
2) cleaning, sterilization high-immunity egg dry, and asepsis is got yolk, obtains yolk stock solution;
3) add isopyknic sterilized water in yolk stock solution, stirring and evenly mixing to color is turned white, and obtains yolk solution;
4) yolk solution is put into 60-65 ℃ of water-bath homogeneous heating 30min, then added the acidified aqueous solution of 4-6 ℃ of pH4.9-5.2 temperature, addition is 6 times of yolk liquor capacity, mixing staticly settles, and gets supernatant, the centrifugal 20min of 15000rpm gets supernatant;
5) add in the supernatant sadly, sad addition is the 0.8-1.0% of liquor capacity, and mixing leaves standstill, and discards the impurity floating thing, and the centrifugal 10min of 20000rpm gets supernatant, leaves standstill;
6) with the filter membrane of 0.45 μ m to step 5) gained supernatant liquid filtering, obtain yolk antibody solution, again through the membrane filtration of model MCW300KD, the solution that contains yolk antibody that obtains making with extra care.
6. a kind of yolk antibody according to claim 5 is characterized in that, the amount of basic immunity bacteria inactivation vaccine is 1.5ml in the described step 1), 1 times of reinforced immunological and reinforced immunological inoculation dosage.
7. a kind of yolk antibody according to claim 5 is characterized in that, acidified aqueous solution is the acidifying water of hydrochloric acid preparation in the described step 4), and pre-cool time is 1-2h.
8. an injection that contains yolk antibody as claimed in claim 5 is characterized in that, comprises 1 part of yolk antibody solution, formaldehyde 0.002-0.003 part and thimerosal 0.0001-0.0002 part.
9. lyophilized powder that contains yolk antibody as claimed in claim 5, it is characterized in that, comprise 1 part of yolk antibody solution, formaldehyde 0.002-0.003 part, thimerosal 0.0001-0.0002 part, glucose 0.03-0.04 part, sorbitol 0.01-0.02 part, glycine 0.02-0.03 part and mannitol 0.02-0.03 part.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210364920.2A CN102861327B (en) | 2012-09-27 | 2012-09-27 | Cell inactivated vaccine, egg yoke antibody and injection and freeze-dried powder containing same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210364920.2A CN102861327B (en) | 2012-09-27 | 2012-09-27 | Cell inactivated vaccine, egg yoke antibody and injection and freeze-dried powder containing same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102861327A true CN102861327A (en) | 2013-01-09 |
| CN102861327B CN102861327B (en) | 2015-01-21 |
Family
ID=47440637
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210364920.2A Expired - Fee Related CN102861327B (en) | 2012-09-27 | 2012-09-27 | Cell inactivated vaccine, egg yoke antibody and injection and freeze-dried powder containing same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102861327B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104161181A (en) * | 2013-07-18 | 2014-11-26 | 河南联合英伟饲料有限公司 | Feed additive for preventing pig bacterial diseases, preparation method and application thereof |
| CN104161182A (en) * | 2013-07-18 | 2014-11-26 | 河南联合英伟饲料有限公司 | Anti-goose viral disease feed additive, preparation method and application thereof |
| CN104161180A (en) * | 2013-07-18 | 2014-11-26 | 河南联合英伟饲料有限公司 | Feed additive for resisting viral diseases of pigs, preparation method and application |
| CN104208674A (en) * | 2013-09-30 | 2014-12-17 | 郑州后羿制药有限公司 | Mixed freeze-dried powder for preventing pig viral diseases and preparation method thereof |
| CN104208679A (en) * | 2013-09-30 | 2014-12-17 | 郑州后羿制药有限公司 | Composition for preventing porcine circovirus disease, mixed freeze-dried powder, and preparation method of the composition |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1361824A (en) * | 1999-06-10 | 2002-07-31 | 梅瑞尔公司 | Porcine circovirus recombinant poxvirus vaccine |
| CN1749397A (en) * | 2004-08-18 | 2006-03-22 | 金宁一 | Bi-recombinant active carrier vaccine of co-expression pig gyrate virus and foot and mouth disease virus |
| CN101942528A (en) * | 2010-10-20 | 2011-01-12 | 福建省农业科学院畜牧兽医研究所 | Primer and probe for detecting goose circovirus |
| CN102065890A (en) * | 2008-04-16 | 2011-05-18 | 弗吉尼亚科技知识产权公司 | Chimeric porcine circovirus PCV2Gen-1Rep and uses thereof |
| CN102716476A (en) * | 2012-05-31 | 2012-10-10 | 郑州后羿制药有限公司 | Cell inactivated vaccine, egg yolk antibody injection, and preparation method of cell inactivated vaccine |
-
2012
- 2012-09-27 CN CN201210364920.2A patent/CN102861327B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1361824A (en) * | 1999-06-10 | 2002-07-31 | 梅瑞尔公司 | Porcine circovirus recombinant poxvirus vaccine |
| CN1749397A (en) * | 2004-08-18 | 2006-03-22 | 金宁一 | Bi-recombinant active carrier vaccine of co-expression pig gyrate virus and foot and mouth disease virus |
| CN102065890A (en) * | 2008-04-16 | 2011-05-18 | 弗吉尼亚科技知识产权公司 | Chimeric porcine circovirus PCV2Gen-1Rep and uses thereof |
| CN101942528A (en) * | 2010-10-20 | 2011-01-12 | 福建省农业科学院畜牧兽医研究所 | Primer and probe for detecting goose circovirus |
| CN102716476A (en) * | 2012-05-31 | 2012-10-10 | 郑州后羿制药有限公司 | Cell inactivated vaccine, egg yolk antibody injection, and preparation method of cell inactivated vaccine |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104161181A (en) * | 2013-07-18 | 2014-11-26 | 河南联合英伟饲料有限公司 | Feed additive for preventing pig bacterial diseases, preparation method and application thereof |
| CN104161182A (en) * | 2013-07-18 | 2014-11-26 | 河南联合英伟饲料有限公司 | Anti-goose viral disease feed additive, preparation method and application thereof |
| CN104161180A (en) * | 2013-07-18 | 2014-11-26 | 河南联合英伟饲料有限公司 | Feed additive for resisting viral diseases of pigs, preparation method and application |
| CN104161181B (en) * | 2013-07-18 | 2016-06-08 | 河南联合英伟饲料有限公司 | The feed additive of a kind of anti-pig bacterial disease, preparation method and application |
| CN104208674A (en) * | 2013-09-30 | 2014-12-17 | 郑州后羿制药有限公司 | Mixed freeze-dried powder for preventing pig viral diseases and preparation method thereof |
| CN104208679A (en) * | 2013-09-30 | 2014-12-17 | 郑州后羿制药有限公司 | Composition for preventing porcine circovirus disease, mixed freeze-dried powder, and preparation method of the composition |
| CN104208674B (en) * | 2013-09-30 | 2016-08-17 | 郑州后羿制药有限公司 | A kind of freeze-dried mixed powder of anti-porcine viral diseases and preparation method thereof |
| CN104208679B (en) * | 2013-09-30 | 2016-08-17 | 郑州后羿制药有限公司 | Compositions, freeze-dried mixed powder and the preparation method that a kind of resisting porcine circovirus is sick |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102861327B (en) | 2015-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102716476B (en) | Cell inactivated vaccine, egg yolk antibody injection, and preparation method of cell inactivated vaccine | |
| CN105412921B (en) | A kind of I group of 4 type aviadenovirus vaccine | |
| CN103585626B (en) | Preparation method for newcastle disease and infectious bursal disease bigeminal composite inactivated vaccine | |
| CN102861327B (en) | Cell inactivated vaccine, egg yoke antibody and injection and freeze-dried powder containing same | |
| CN102716483A (en) | Duck plague yolk antibody freeze-dried powder and preparation method thereof | |
| CN102994534B (en) | Duck plague virus gE gene transfer vector pUC-Delta gE-EGFP and recombinant strain DPV-Delta gE-EGFP | |
| CN106119212B (en) | Fowl adenovirus strain, inactivated vaccine and preparation method | |
| CN102716484A (en) | Duck virus hepatitis yolk antibody freeze-dried powder and preparation method thereof | |
| CN102716485A (en) | Dual hyper-immune egg yolk antibody injection for duck virus hepatitis and duck plague and preparation method thereof | |
| CN106282130A (en) | A kind of I group 4 type aviadenovirus, inactivated vaccine and preparation method thereof | |
| CN103495166A (en) | Preparation method of complex live vaccine for porcine reproductive and respiratory syndrome | |
| CN105949307B (en) | It is a kind of for preventing and treating a kind Yolk antibody for duck source gosling plague | |
| CN110218706A (en) | Express the building and application of the recombinant herpesvirus of turkeys of H7N9 subtype highly pathogenic avian influenza virus HA albumen | |
| CN102743751A (en) | Preparation method of newcastle diseases, infectious bursal disease bigeminy high immunity-yolk-antibody lyophilized powder | |
| CN102805864A (en) | Newcastle disease and H9N2 subtype avian influenza bivalent inactivated vaccine and preparation method thereof | |
| CN108465107B (en) | Duck type 2 adenovirus and Muscovy duck parvovirus disease combined inactivated vaccine | |
| CN105802920B (en) | A11 plants of infectious bursal disease virus and its application | |
| CN112500458B (en) | Novel variant subunit vaccine of chicken infectious bursal disease virus, preparation method and application thereof | |
| CN103495167A (en) | Method for preparing chicken infection bursal disease composite live vaccine | |
| CN109097340A (en) | A kind of aviadenovirus, a kind of quadruple vaccine and preparation method thereof | |
| CN104888213A (en) | Preparation method of classical swine fever spleen-lymph-sourced compound living vaccine | |
| CN104130981A (en) | Application of avian infectious bronchitis virus vaccine strain in preparation of inactivated vaccine | |
| CN109207436A (en) | One plant of 4 type aviadenovirus strain of I group and its application | |
| CN108939063B (en) | Muscovy duck triple inactivated vaccine | |
| CN106563125B (en) | Duck hepatitis A virus III type compound live vaccine and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent of invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Xu Jin Inventor after: Guo Junqing Inventor after: Hasitonglaga Inventor before: Wu Hongyun Inventor before: Guo Junqing Inventor before: Xu Jin |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: WU HONGYUN GUO JUNQING XU JIN TO: XU JIN GUO JUNQING HASITONGLAGA |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20160302 Address after: 450061 Xingang Avenue, Xinzheng port, Henan, Zhengzhou Patentee after: Henan Hou Yi bioengineering Limited by Share Ltd Address before: 451162 Xingang, Henan, Zhengzhou, Hong Kong airport on the eastern side of the road on the eastern side of Zhengzhou Patentee before: Zhengzhou Houyi Pharmaceutical Co., Ltd. |
|
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150121 Termination date: 20170927 |