CN102850449A - Patinopecten yessoensis ferritin gene and application thereof - Google Patents
Patinopecten yessoensis ferritin gene and application thereof Download PDFInfo
- Publication number
- CN102850449A CN102850449A CN2012103850155A CN201210385015A CN102850449A CN 102850449 A CN102850449 A CN 102850449A CN 2012103850155 A CN2012103850155 A CN 2012103850155A CN 201210385015 A CN201210385015 A CN 201210385015A CN 102850449 A CN102850449 A CN 102850449A
- Authority
- CN
- China
- Prior art keywords
- ferritin
- patinopecten yessoensis
- gene
- ferritin gene
- patinopecten
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention relates to a patinopecten yessoensis ferritin gene and the application of the gene. The ferritin gene is separated from patinopecten yessoensis and has the protein sequence as shown in SEQ ID NO. 1 and the cDNA sequence as shown in SEQ ID NO. 2. According to the invention, the patinopecten yessoensis ferritin gene is cloned, and iron oxidation and bacteriostatic activity analysis are carried out on the in vitro recombined expression product. The research proves that patinopecten yessoensis ferritin gene not only has the functions of chelated iron, but also has bacteriostatic activity, thus the patinopecten yessoensis ferritin gene can inhibit the growth of important pathogenic bacteria of shellfishes. Thus, the patinopecten yessoensis ferritin gene has good application potential in disease control.
Description
Technical field
The invention belongs to aquatic animal disease-resistant gene triage techniques field, be specifically related to a kind of Patinopecten yessoensis ferritin gene and application thereof.
Background technology
Studies show that ferritin is a kind of important immune protein, plays an important role in iron ion balance and the innate immune system in keeping born of the same parents.Ferritin has participated in all more important physiological process of marine invertebrate, all plays an important role at aspects such as inflammatory reaction, iron ion absorption, deoxidation detoxifcations.Such as, bay scallop is after Vibrio anguillarum is coerced, and the ferritin level is significantly improved in its body; Equally, after Penaeus vannamei infected through white spot virus, ferritin gene is obvious up-regulated expression also.In addition, after metal ion and high temperature stress processing, the ferritin of blood clam also obviously improves, and studies show that more than ferritin has played vital role in the congenital immunity of marine invertebrate.Therefore, the ferritin of screening different plant species, thus the immunity system that detects more accurately the sea farming species has important effect.
Summary of the invention:
The purpose of this invention is to provide a kind of Patinopecten yessoensis ferritin gene and application thereof, for disease control in the shellfish breeding provides technique means, thereby remedy the deficiencies in the prior art.
Patinopecten yessoensis ferritin of the present invention, its aminoacid sequence are SEQ ID NO:1.
The nucleotides sequence of above-mentioned Patinopecten yessoensis ferritin gene is classified SEQ ID NO:2 as.
The invention still further relates to be used to the recombinant vectors of expressing above-mentioned Patinopecten yessoensis ferritin gene.
Patinopecten yessoensis ferritin of the present invention is for the preparation of antiseptic-germicide.
The present invention has cloned the Patinopecten yessoensis ferritin gene, and its in-vitro recombination expression product has been carried out iron oxidation and bacteriostatic activity analysis.Studies show that Patinopecten yessoensis ferritin of the present invention not only has the function of chelated iron, and have bacteriostatic activity, can suppress the growth of the important pathogenic bacteria of shellfish.Therefore, the Patinopecten yessoensis ferritin has good application potential in disease control.
Description of drawings
Fig. 1: the sequential analysis figure of Patinopecten yessoensis ferritin gene of the present invention;
Be iron response element IRE in the rectangular boxes wherein; Real underscore aataaa is tailing signal; Dashed underline is the unstable element of A+U;
Fig. 2: the three-dimensional structure diagram of Patinopecten yessoensis ferritin of the present invention;
Fig. 3: the electrophorogram after Patinopecten yessoensis ferritin of the present invention is recombinant expressed;
Fig. 4: the iron oxidation activity of Patinopecten yessoensis ferritin of the present invention detects figure;
Fig. 5: the anti-microbial activity figure of Patinopecten yessoensis ferritin of the present invention.
Embodiment
The present invention will be further described below by embodiment.
Embodiment 1: the separation of Patinopecten yessoensis ferritin gene and property analysis
The cDNA sequence clone of the Patinopecten yessoensis ferritin gene among the present invention comprises the following steps:
A) the total RNA of Patinopecten yessoensis extracts;
B) Patinopecten yessoensis 5 ' RACE and 3 ' RACE library construction;
C) acquisition of Patinopecten yessoensis ferritin cDNA full length sequence;
D) bioinformatic analysis of goal gene.
Concrete operations are as follows:
A) extraction of the total RNA of Patinopecten yessoensis: from the Patinopecten yessoensis hepatopancreas, extract total RNA according to the trizol extracting method.
B) Patinopecten yessoensis RACE library construction: utilize the SMART RACE cDNA Amplification Kit of Clontech company to make up 5 ' RACE and 3 ' RACE library.
C) acquisition of Patinopecten yessoensis ferritin cDNA full length sequence: the partial sequence information of transcribing ferritin in the group library according to Patinopecten yessoensis, purpose of design gene RACE primer, 3 ' RACE primer: 5 '-ATGTTGAAACCGAGGCTGGAATCAACCG-3 ' and 5 ' RACE primer: 5 '-GCATGTTCACGCTCTTCGTCAGACTTGGT-3 '.Utilize respectively 3 ' RACE primer and 5 ' RACE primer and joint primer NUP(5' – AAGCAGTGGTATCAACGCAGAGT – 3') carry out the amplification of 3 ' terminal and 5 ' end.The PCR product detects with 1.2% agarose gel electrophoresis, reclaim test kit (worker is given birth in Shanghai) with glue and carry out the PCR product purification, be connected with pMD18-T carrier (the precious biotechnology in Dalian company limited) again, (Huang Peitang translates with reference to " the molecular cloning third edition ", Science Press, 2002) method transform bacillus coli DH 5 alpha.After bacterium colony PCR detected, the picking positive colony checked order, and obtains the cDNA full length sequence behind the sequence assembly of two ends, is SEQ ID NO:2, and its Protein sequence is SEQ ID NO:2.
Wherein the condition of 3 ' and 5 ' RLM-RACE is as follows:
50 μ L reaction systems:
Used PCR response procedures increases: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30sec, 72 ℃ of 3min, 5 circulations; 94 ℃ of sex change 30sec, 70 ℃ of annealing 30sec, 72 ℃ are extended 3min, 5 circulations; 94 ℃ of sex change 30sec, 65 ℃ of annealing 30sec, 72 ℃ are extended 3min, 28 circulations; 72 ℃ are extended 10min.
The smooth shellfish ferritin gene of the shrimp that filters out be the analysis showed that gene order total length 920 bp, the open reading frame that comprises 516 bp, 5 ' the non-coding region of 117 bp and the 3 ' non-coding region of 287 bp, at 3 ' non-coding region a tailing signal is arranged, 5 ' non-coding region has an iron response element IRE(Fig. 1).171 amino acid of this genes encoding, molecular weight is 21.92kD, iso-electric point is 5.52.Bioinformatic analysis shows that this sequence has the typical second structure characteristic of ferritin (Fig. 2): four long α spirals, a short α spiral and a long shoot ring; There are iron oxidation activity center (E25, Y32, E59, E60, H63, E105, Q139) and iron ion mineralising center (D58, E59, E62), belong to M sections albumen.
Embodiment 2: Patinopecten yessoensis ferritin gene of the present invention recombinant expressed
The preparation of vitro recombination ferritin and activation analysis among the present invention comprise the following steps:
A) structure of Recombinant Ferritin expression plasmid;
B) expression of Recombinant Ferritin;
C) purifying of Recombinant Ferritin;
D) activation analysis of ferritin.
Concrete operations are as follows:
A) structure of Recombinant Ferritin expression plasmid: according to the cDNA sequence of SEQ ID NO:2, multiple clone site in conjunction with expression vector, the design primer, wherein the sequence of forward primer is that the sequence of 5 '-CCACATATGACTGAAAGTCAACCTCGC-3 ' reverse primer is 5 '-GGGAAGCTTAGTCCAGGGATTTCTTGTCG-3 '.Take Patinopecten yessoensis hepatopancreas cDNA as template, carry out the protein-coding region pcr amplification, 20 μ l reaction systems comprise:
Carry out pcr amplification by follow procedure, 95 ℃ of sex change 5 min; 94 ℃ of 30 s, 62.8 ℃ of 30 s, 72 ℃ of 2 min, totally 35 circulations; 72 ℃ are extended 10 min.Adopt glue to reclaim test kit (worker is given birth in Shanghai) and carry out the PCR product purification, PCR product behind the purifying is connected with pMD18-T carrier (the precious biotechnology in Dalian company limited), (Huang Peitang translates with reference to " the molecular cloning third edition ", Science Press, 2002) method transform bacillus coli DH 5 alpha, selected clone carries out bacterium colony PCR and detects, and then the picking positive colony carries out sequencing.Cultivation contains the clone of purpose recombinant plasmid, extract plasmid, with Nde I and Hind III behind 37 ℃ of complete degestions, method according to " the molecular cloning third edition " is connected in the pET28a expression vector, transform e. coli bl21 (DE3), confirm that through order-checking expression cassette is consistent with the sequence of SEQ ID NO. 2.
B) expression of Recombinant Ferritin: picking contains the positive colony of purpose recombinant plasmid, is inoculated in the LB liquid nutrient medium that contains kantlex, and 37 ℃ of 200 rpm shaking culture spent the night, as kind of a daughter bacteria.Get kind of daughter bacteria and be inoculated in the fresh LB substratum that contains kantlex 37 ℃ of 200rpm shaking culture by the 1:100 volume ratio; Be cultured to OD600 and be about at 0.5 o'clock, 4 ℃ leave standstill 1h after, add isopropylthio-β-D-galactoside (Isopropyl-β-D-thiogalactopyr, IPTG) to final concentration 1 mmol/L, 15 ℃ of abduction delivering 10h.4 ℃ of 5000 centrifugal 10 min of rpm collects thalline.
C) purifying of Recombinant Ferritin: with the resuspended thalline of PBS damping fluid of precooling.Adopt Ultrasonic cell smash with the power of 320 W (7min altogether ultrasonic under ice-water bath; Work 5s stops 10s) broken bacterial cell, 4 ℃ of 12000 centrifugal 30 min of rpm, it is for subsequent use to get supernatant liquor.With target protein in the Ni-NTA of the Novagen company column purification supernatant liquor, concrete operations are as follows: 1ml 50% Ni-NTA HisBind resin suspension is joined in the bacteria lysis supernatant liquor that 4ml prepares, after 200 rpm softly shook mixing on the impeller, 4 ℃ in conjunction with 60 min.Lysate Ni-NTA HisBind resin compound is added in the empty chromatographic column of lower end closed, remove post lower end closed lid, allow under the liquid Free-flow.With 4 ml, 1 * Ni-NTA rinsing damping fluid I(50mM NaH
2P04, pH 8.0,300mM NaCI, 20mM imidazoles) rinsing 2 times; Again with 0.5 ml, 1 * Ni-NTA rinsing damping fluid II(50mM NaH
2P04, pH 8.0,300mM NaCI, 100mM imidazoles) rinsing 4 times.With 0.5 ml, 1 * Ni-NTA elution buffer (50mM NaH
2P04, pH 8.0,300mM NaCI, 250mM imidazoles) wash-out target protein 4 times.Get the target protein solution that elutes and be drawn onto in the dialysis tubing, place 1L 0.15M NaCl, 4 ℃ of dialysis.After 2h changes NaCl solution one time, changes for the third time, dialyzed overnight.Dialyse complete after, with the target protein lyophilize in the dialysis tubing, place-80 ℃ of preservations.
By the High fidelity PCR technology, the gene fragment of amplification coding ferritin mature peptide, and it is cloned in the pET28a expression vector, in e. coli bl21 (DE3), successfully realized the protokaryon in-vitro recombination expression.Adopt the active recovery method of Nickel-NTA gel column, purifying obtains the Recombinant Ferritin (Fig. 3) of solubility
Embodiment 3: the activation analysis of ferritin of the present invention
The activation analysis of ferritin: take by weighing a certain amount of target protein and be dissolved in the aqua sterilisa, the Bradford method is measured protein content.Then be used for active checking.
Iron oxidation activity checking: according to Levi et al.(1988) method, with 0.1 M ferrous ammonium sulphate, 4 mg/ml people topology Transferrins,iron complexes (Sigma, Aldrich), 0.2M the Recombinant Ferritin that sodium-acetate (pH 7.0) and 20 μ g/ml purifying obtain mixes, room temperature reaction adds isopyknic people's topology Transferrins,iron complexes again behind 10 min.In the 20min from start to end, every the light absorption value of 1min record 470nm place solution.After the result showed the adding ferritin, the solution light absorption value obviously improved, and shows that this expression product has the iron oxidation activity, was about to ferrous ion and changed into ferric ion (Fig. 4).
Bacteriostatic activity checking: Vibrio anguillarum is cultured to exponential phase, then is diluted to 10 with the MH substratum
5CFU/ml.Vibrio anguillarum after the 20 μ l dilution is joined respectively 180 μ l contain in the MH liquid nutrient medium that Recombinant Ferritin (70 μ g/ml) and 180 μ l behind the purifying do not contain Recombinant Ferritin behind the purifying, behind the mixing, 28 ° of C leave standstill cultivation 24h.In 0h, 12h, 24h measures 600nm place light absorption value.Experiment repeats 3 times.The result shows in the substratum that adds ferritin that the Vibrio anguillarum growth obviously is suppressed, thereby the contrast group is obviously low on absorbancy, shows that the ferritin that the present invention screens has bacteriostatic activity (Fig. 5).Therefore, the ferritin of the present invention's separation can be used for preparing the antiseptic-germicide of using in the aquaculture.
Claims (4)
1. a Patinopecten yessoensis ferritin is characterized in that, the aminoacid sequence of described ferritin is SEQ ID NO:1.
2. Patinopecten yessoensis ferritin as claimed in claim 1, its gene CDNA sequence is SEQ ID NO:2.
3. recombinant vectors, he is its feature, described recombinant vectors is used for expressing the described Patinopecten yessoensis ferritin of claim 1.
4. the application of the smooth shellfish ferritin of shrimp claimed in claim 1 in the preparation antiseptic-germicide.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012103850155A CN102850449A (en) | 2012-10-11 | 2012-10-11 | Patinopecten yessoensis ferritin gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012103850155A CN102850449A (en) | 2012-10-11 | 2012-10-11 | Patinopecten yessoensis ferritin gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102850449A true CN102850449A (en) | 2013-01-02 |
Family
ID=47397470
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012103850155A Pending CN102850449A (en) | 2012-10-11 | 2012-10-11 | Patinopecten yessoensis ferritin gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102850449A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110894224A (en) * | 2019-12-13 | 2020-03-20 | 大连工业大学 | Oyster ferritin with high thermal stability and preparation method thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1749281A (en) * | 2005-10-11 | 2006-03-22 | 大连轻工业学院 | Process for extracting comb shell polysaccharide |
| CN1800414A (en) * | 2005-09-23 | 2006-07-12 | 中国海洋大学 | Quick detection method for Patinopecten PYMSE005 micro satellite marker |
| CN101731670A (en) * | 2009-12-25 | 2010-06-16 | 河北农业大学 | Scallop powder and spray drying method thereof |
-
2012
- 2012-10-11 CN CN2012103850155A patent/CN102850449A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1800414A (en) * | 2005-09-23 | 2006-07-12 | 中国海洋大学 | Quick detection method for Patinopecten PYMSE005 micro satellite marker |
| CN1749281A (en) * | 2005-10-11 | 2006-03-22 | 大连轻工业学院 | Process for extracting comb shell polysaccharide |
| CN101731670A (en) * | 2009-12-25 | 2010-06-16 | 河北农业大学 | Scallop powder and spray drying method thereof |
Non-Patent Citations (3)
| Title |
|---|
| LI JUAN等: "Three ferritin subunits involved in immune defense from bay scallop Argopecten irradians", 《FISH & SHELLFISH IMMUNOLOGY》 * |
| LIU W.等: "Accession number: GR867600", 《ENA(EUROPEAN NUCLEOTIDE ARCHIVE)》 * |
| ZHANG YUEYUE等: "Identification and characterization of four ferritin subunits involved in immune defense of the Yesso scallop (Patinopecten yessoensis)", 《FISH & SHELLFISH IMMUNOLOGY》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110894224A (en) * | 2019-12-13 | 2020-03-20 | 大连工业大学 | Oyster ferritin with high thermal stability and preparation method thereof |
| CN110894224B (en) * | 2019-12-13 | 2022-06-24 | 大连工业大学 | Oyster ferritin with high thermal stability and preparation method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Peng et al. | Molecular characterization and expression of interleukin-10 and interleukin-22 in golden pompano (Trachinotus ovatus) in response to Streptococcus agalactiae stimulus | |
| CN104745595B (en) | Stichopus japonicus BPI genes, encoding proteins and its cloning process and restructuring stichopus japonicus BPI construction of genetic engineering methods | |
| CN105274134A (en) | Preparation method and application of scylla paramamosain antimicrobial peptide SCY2 | |
| CN101914149A (en) | Preparation and application of anti-lipid polysaccharide factor with bacteriostatic activity | |
| CN104004100A (en) | Pig antimicrobial peptide NK-lysin fusion protein and encoding gene and application thereof | |
| CN103898153A (en) | Multi-copy metallothionein recombinant expression vector and method thereof for high-efficiency expression of metallothionein | |
| CN100485036C (en) | Fennero penaeus chinensis antibacterial protein gene and recombinant expression and use | |
| CN103755795B (en) | Epinephelus coioides antimicrobial petide LEAP-2 gene, carrier, recombinant bacterial strain and albumen and application thereof | |
| Zhang et al. | The ferritin gene in ridgetail white prawn Exopalaemon carinicauda: cloning, expression and function | |
| CN102850449A (en) | Patinopecten yessoensis ferritin gene and application thereof | |
| CN101294154B (en) | Method for preparing large-size fluke cathepsin L1 | |
| CN101979581B (en) | S7 gene and coded recombinant protein of grass carp reovirus strain, and acquisition method and application thereof | |
| CN101565703B (en) | Eriocheir sinensis Crustin-2 gene and application of recombinant protein thereof | |
| CN112226378B (en) | Large yellow croaker cysteine protease inhibitor Cystatin recombinant protein and application thereof | |
| CN101988069A (en) | Eimeria tenella heat shock protein 60 gene as well as cloning, expression and application thereof | |
| CN102061303A (en) | Fusion expression product of antimicrobial peptide genes of two marine animals and preparation method of fusion expression product | |
| CN101245344B (en) | Eriocheir sinensis lipotropism polyoses factor gene and encoding protein and application | |
| CN102051363A (en) | Clam ferroprotein gene as well as coding protein and application of in vitro recombinant expression product of same | |
| CN109385436B (en) | Scylla paramamosain C-type lysozyme gene and application thereof | |
| CN104402987A (en) | Crassostrea gigas interleukin IL17N recombination protein as well as preparation and application thereof | |
| Yang et al. | Molecular structure and functional characterization of the gamma-interferon-inducible lysosomal thiol reductase (GILT) gene in largemouth bass (Microptenus salmoides) | |
| CN102586261A (en) | Portunus trituberculatus PtCrustin-2 gene, and coded protein and application thereof | |
| CN108251440B (en) | Sinonovacula constricta lysozyme gene, coding protein and construction method and application of recombinant sinonovacula constricta lysozyme gene engineering bacteria | |
| CN108048475B (en) | Sinonovacula constricta I type lysozyme-2 gene, encoding protein and construction method of recombinant sinonovacula constricta I type lysozyme-2 gene engineering bacteria | |
| CN103215274A (en) | Epinephelus coioides interferon IFNgamma2 and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130102 |