CN101988069A - Eimeria tenella heat shock protein 60 gene as well as cloning, expression and application thereof - Google Patents
Eimeria tenella heat shock protein 60 gene as well as cloning, expression and application thereof Download PDFInfo
- Publication number
- CN101988069A CN101988069A CN200910055725XA CN200910055725A CN101988069A CN 101988069 A CN101988069 A CN 101988069A CN 200910055725X A CN200910055725X A CN 200910055725XA CN 200910055725 A CN200910055725 A CN 200910055725A CN 101988069 A CN101988069 A CN 101988069A
- Authority
- CN
- China
- Prior art keywords
- gene
- primer
- eimeria tenella
- protein
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention discloses a new Eimeria tenella heat shock protein 60 (Et HSP60) gene. The cloning number is ZB2-D07, the total length is 1802 bp, and the Et HSP60 gene contains a 1455 bp complete open reading frame (ORF) and can code 484 amino acids (Genbank accession number: FJ911605). The gene is connected with a prokaryotic expression vector pET28a(+) to construct a prokaryotic expression recombinant plasmid pET28a(+)-Et HSP60 and is expressed in an escherichia coli system. SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis) is carried out by purifying the recombinant protein pET28a(+)-Et HSP60, and then the recombinant protein pET28a(+)-Et HSP60 is transferred to a PVDF (Polyvinylidene Fluoride) membrane. The antiserum of immuned chicken orally taking E. tenella oocyst is taken as a primary antibody, and goat-anti-chicken IgG (immunoglobulin G) is taken as a secondary antibody to carry out Western-blot analysis. The analysis result shows that the recombinant protein pET28a(+)-Et HSP60 has certain antigenicity and can be used for preparing a medicine for resisting chicken coccidiosis and a vaccine resisting chicken coccidiosis.
Description
Technical field
The present invention relates to biotechnology, be specifically related to a kind of new Eimeria tenella (E.tenella) heat shock protein (Heat shock proteins, HSPs) clone, expression and the application of 60 (Et HSP60) gene.
Background technology
Coccidiosis of chicken is to parasitize the caused a kind of serious global parasitosis that endangers of enteron aisle by Eimeria, causes enormous economic loss to poultry husbandry.The main method of present control coccidiosis comprises chemicals control and vaccine immunity prevention, but because there are problems such as safety, price and anti-medicine worm strain appearance in these methods, press for the new means of prevention of searching and control coccidiosis.And the coccidiosis recombinant vaccine of development highly effective and safe and the key of novel drugs are to seek the somatic antigen gene.The inventor is a research object so that chicken is endangered the most serious Eimeria tenella (E.tenella), carried out the research such as separation, evaluation of E.tenella sporogony etap difference expression gene, for exploring the invasion and the mechanism of growing of chicken coccidia, develop efficient, safe anticoccidial vaccine and novel drugs and lay the foundation.
Heat shock protein (Heat shock proteins, HSPs) be meant that all prokaryotic organism and eukaryote are when growing or being subjected to different physics and chemistry and pathological factor and stimulating, new synthetic or a histone matter family that expression amount increases belongs to nonsecreting type protein in the body.Heat shock protein is the most conservative class protein of 26S Proteasome Structure and Function during species kind system takes place, and also is a most important proteinoid in the molecular chaperones (Molecular chaperone) simultaneously.The main biological function of heat shock protein is folding (Folding), displacement (Translocation), renaturation (Renaturation) and the degraded (Degradation) that helps related protein, avoids the infringement of inside and outside undesirable element with the protection biological cell.Heat shock protein can produce a series of corresponding physiological responses, slows down cells injury, and its function mainly comprises: prevent that 1) protein from producing precipitation when being subjected to physics or chemical stimulation; 2) assist protein between organoid, to transport as molecular chaperones; 3) assist new polypeptide chain folding, and stop and make a mistake when folding; 4) assist the DNA plerosis structure when the base mispairing as the DNA lytic enzyme; 5) regulate other proteinic synthetic and functions, participate in growth, growth and the differentiation of cell; 6) as a kind of important antigen by immune system recognition, participate in antigenic processing and submission.Heat shock protein has following characteristics: 1) predominant expression under the heat-shocked state, and other protein expressions are suppressed; 2) in all cells, all express; 3) its aminoacid sequence is conservative at the evolution camber; 4) HSPs mainly is present in the tenuigenin at ordinary times, stress the time HSPs enter nucleus and kernel rapidly, stress decubation enter tenuigenin again rapidly, when once more stress the time HSPs return nucleus again; 5) HSPs can improve anti-stress ability, and the HSP70 growing amount becomes positive correlation with the cell heat hardiness; 6) have the heat-shocked element in its gene promoter upstream, can be started by specific heat shock factor and express.HSPs is quite high at intracellular content, accounts for 5% of total protein of cell, and its function also relates to cyto-architectural keeping and renewal etc.
The inventor discovers that the albumen of the new heat shock protein 60 of clone's Eimeria tenella (Et HSP60) genes encoding has the conserved domain (ClpB_D2-small) of a ClpB of HSPs family, and the amino acid of this genes encoding has ATP-binding site (ATP binding site), so it may play vital role in the hydrolytic process of ATP enzyme, the function of molecular chaperones is arranged.With the nucleotide sequence result that records and Eimeria tenella gene order-checking website (
Http:// www.sanger.ac.uk./projects/E_tenella/OmniBLAST) carry out homology search comparison, find that the genomic HSP gene of this gene and Eimeria tenella has high homology.In GenBank, carry out Blast search, find the Eimeria tenella gene order that matches well with it to show that this gene is the new gene of Eimeria tenella, by its molecular weight size called after Et HSP60 gene.Utilize quantitative fluorescent PCR to verify the expression of this gene in E.tenella different developmental phases polypide, found that Et HSP60 gene the sporocyst stage to transcribe copy number the highest, point out that this albumen may to invade host cell relevant with Eimeria tenella.
As its important biological function of a kind of molecular chaperones paid more and more attention, put on and play an important role by special specific target in the protection immunne response at other species for HSP60.In addition, HSP60 also collaborative HSP10 in fungi, plastosome, chloroplast(id) participates in proteic folding and it is transported in other the organoid.The HSP60 that discovers different plant species has high conservative.Because HSP60 is a kind of immunodominance antigen in many pathogenic agent infectious processes, the therefore following research might be illustrated HSP60 in the developing effect of autoimmunization, and based on the developing effect of the immunotherapy of HSP60.
Summary of the invention
Technical problem to be solved by this invention is to study a kind of new heat shock protein 60 (Et HSP60) gene and the application thereof of amplification Eimeria tenella.
The invention provides a kind of Eimeria tenella heat shock protein 60 (EtHSP60) gene, this gene has following sequence:
TCAGATGTGCATTTAAGGCGATTTGAATAAGCTTGTGGGGGCCACGACTTTGG
AAGAGTATAAACTCCACATTGAAAAGGACGCGGCCTTTTGCCGCCGCTTCCAG
AACATCGTCGTGGAGGCGCCCAGCAAGGAGAAGGCCCTTTCAATCCTGCAAAG
AGTGCGTCCGCACTACGAGCAGTTCCACCAGCTGGAAATCCCGGAAGAAGTGC
TGGAGGCGGTGACGAAC
ATGTCGGACCAGTACGTGAAGCAGCGGGCCTTTCCC
GACAAGGCGCTGGACCTCCTCGACGAGTCTTGTTCTTGGAAACGCGTTTCCCAC
AACAAAAAAATAAATGTCCCCAACAAGCAGATCGCGCAGCTCAAGAAGAACA
AGCTCCCCGAGGAAGAAGAGGAGCTGAAGAAACTGCAGGAGGAGTTGGCTGC
TCTCGAGGCGCTCACTGCGGGGGGGCGGCGGCTGGTGCTGGAGACCAACGACG
TGGCCCACATCTTGAGCCAGTGGACTGGAATCCCGATGGGCAAAATGACGGAA
GACGAAGTCTCGCGGGTGTTGAGGCTCGCCGACATTTTGTCTCTGAGGGTTGTT
GGACAAGACCGAGCAGTGAAGGCCGTGGCCGACGCGCTGGCTATTCAGCGCGC
GGGGCTGAGTCCGAAGAACAAGCCGCTGGGCACTTTCCTGTTCCTGGGGTCTTC
GGGGGTGGGCAAGACGGAGCTGGCGAAGGCGGTGGCCGAGGAAATGTTTGAC
TCTGAAAAGAACTTAATCAGACTGGACATGGTGGAATATCAAGAAGCCCACAG
CATTTCGCGGCTGATCGGCCCGCCGCCGGGCTACATGGGCAACGACGAGGGCG
GGCAGCTCACGGAGGCCGTGCGCCAAAAGCCCCACAGCGTGGTGTTGTTCGAC
GAAGTCGAAAACGCGCACAAGAACTTGTGGTCTTTGCTGCTGCCGATGCTGGA
CGAGGGCCACCTGTCGGACTCGAAGGGAAACCGGGTGGACTTTACGAATTGTT
TGATAATTTTGACTTCCAATATTGGCCAGCAGTACATTTTGGACAGTTACAAGG
AAGTGCGGGCGCTGACGGCTGGCAACGAGAAGGACAAGGCCAGCAGCAACGG
CAGCAGCAGCAGCAACGGCGAAGAGCCCGGCAAGTCCTCCTTCAAAGGCACG
GGCAAATCCCCCAAAGACATTCTCCGGAGAATGCGCCAGAAGGTTCTTAAGGA
GGTCTTCGGCTACTTCAAGCCGCAGGTCATCGGCAGGATGAGCGAGATCATCA
TATTTGAGCCTCTGGGGGAAACCGCCATGAAGGGGGTTTTGAACTTGAAGCTTT
CGGCGCTGCGGAACAGTTTAGCAGCAAAAGGAATTGACTTCAAAGTCGCCGAC
TCCGCCCTGGGCTACATCTTGGAAAGGGCCTGGTCCCACAAGTTCGGAGGCCG
CAGAATGGCCAAGTACCTGGAGAAGTACATAAAGCCCCGAGTGGCGCCGCTTT
TGATTTCCGGCAAACTCAAGGCGGGAGACAGAGCCGTCTTGGCGCGCTCCAAC
ACAAACCCCAATCAGCTCAACTTGATTGTGTGCGAGCTGAACGAAGAAGGCGT
TTGCAAGCCGGGAACGAAGTACGGCACGAAGCTGGTCACGCAGGAAGTGAAG
CCGCAGGACGGAAACGAGGATGAAGAGGACGCAATGGAC
TAGCAAAAGAATT
AAAAGCATTTAAAACATTTAAATGATGCTTTTTATCCCTGGAAAGCGGAGAGA
CAAAGTGAGGAAATGAGGACGGAGCTCCCGTTTTTGGCTACCGTGAGGCAACT
GA
Described
ATGBe initiator codon;
TAGBe terminator codon.
The present invention is the driving group with Eimeria tenella spore egg capsule, and sporozoite is an experimental group, utilizes suppression subtractive hybridization technique to make up the subtractive cDNA library of sporozoite.1056 clones from the subtractive cDNA library that builds, have been selected, made cDNA microarray (chip), total RNA of Eimeria tenella spore egg capsule and sporozoite is prepared probe, use cy3 and cy5 mark respectively, obtained the est sequence of Eimeria tenella heat shock protein 60 (EtHSP60) gene by chip hybridization, screening.Utilize RACE (the terminal rapid amplifying of cDNA) technology to be cloned into a kind of new heat shock protein 60 (Et HSP60) gene of coding Eimeria tenella first, contain a complete open reading frame (ORF), detect through real-time quantitative PCR, this gene is at sporozoite stage high expression level.Made up protokaryon recombinant expression plasmid (pET28a (+)-Et HSP60) simultaneously, in intestinal bacteria, expressed, purifying recombinant expression protein, and the recombinant protein of expressing carried out antigenic evaluation.
Another object of the present invention has provided the clone and the expression of a kind of Eimeria tenella heat shock protein 60 (Et HSP60) gene.This method comprises the following steps:
(1) reagent and material
Trizol, GeneRace
TMKit is available from Invitrogen company; TaKaRa Agarose Gel DNA PurificationKit, restriction enzyme are available from the precious biotechnology in Dalian company limited; PGEM-T-easy vector is available from Promega company; DEPC, X-Gal, Tag Plus I archaeal dna polymerase are given birth to worker's biotechnology company limited available from Shanghai; Bacto-yeast extract, AgarA, bacto-tryptone are OXOID company product.Acrylamide, N, N '-methylene radical methylene diacrylamide, TEMED, ammonium persulphate are available from Sigama company; HRP-goat anti-rabbit igg 3 is available from Shanghai English base bio tech ltd; HRP-goat-anti chicken IgG is available from SouthernBiotech company; Protein dyes Marker in advance available from Fermentas company; High-affinity Ni-NTA Resin is available from GenScriptCorporation company product, and DNA Marker and standard protein molecular weight are available from TIANGEN Biotech (Beijing) Co., Ltd..
The yellow plumage chicken of Luo Man high-quality is planted chicken house in converging available from Shanghai, transports laboratory rearing back after going out shell, and cage tool, feed, drinking-water etc. are all through strict sterilization.Eimeria tenella (E.tenella): Eimeria tenella spore egg capsule, numbering: CAAS 21111601, and being preserved by China Agriculture Academe Shanghai Veterinary Institute provides.
PET28a (+) expression vector, intestinal bacteria TOP10, e. coli bl21 (DE3) are preserved by China Agriculture Academe Shanghai Veterinary Institute and are provided, and these bacterial classifications all are open, the conventional uses.
(2) method
1. terminal rapid amplifying (RACE) primer of cDNA is synthetic:
Utilize suppression subtractive hybridization technique (SSH) and cDNA microarray technology screening Eimeria tenella (E.tenella) spore development stage (not spore egg capsule, spore egg capsule, sporozoite) polypide difference expression gene, obtained sporozoite stage polypide cance high-expression gene clone ZB2-D07.According to its EST (expressed sequence tag) sequence, designed 3 ' and 5 ' RACE primer (primer is synthetic by the biological company limited in match Parkson, Shanghai).
3’Primer 5’-TCAGACTGGACATGGTGGAATATCAA-3’
3’Nested?Primer 5’-AGCGTGGTGBTTGTTCGACGAAGT-3’
5’Primer 5’-CTTCACTGCTCGGTCTTGTCCAACA-3’
5’Nested?Primer 5’-CGCGAGACTTCGTCTTCCGTCATT-3’；
2. the amplification of terminal rapid amplifying (RACE) product of cDNA:
Concrete steps are pressed GeneRacer
TMThe test kit operational manual carries out.The RACE product cloning that obtains increasing is selected positive colony in the pGEM-T-easy carrier, (the handsome Bioisystech Co., Ltd in Shanghai) checks order.Search 3 ' and the lap of 5 ' RACE product sequence and former est sequence according to sequencing result, with three sections sequence assemblies.
3. contain complete open reading frame (ORF) Cloning of Entire Gene:
CDNA sequences Design upstream and downstream primer according to splicing contains the pulsating pcr amplification of ORF cDNA.
Upstream primer: 5 '-CAGATGTGCATTTAAGGCGATTTGA-3 '
Downstream primer: 5 '-CAGTTGCCTCACGGTAGCCA-3 '
MRNA reverse transcription synthetic cDNA first chain is a template when increasing with RACE, carries out pcr amplification.94 ℃ of 3min of reaction conditions; 94 ℃ of 30s, 50 ℃ of 30s, 72 ℃ of 2min, 30 circulations, 72 ℃ of 10min.The purified back of the PCR product that amplification obtains is connected with the pGEM-T-easy carrier, the recombinant plasmid (called after pGEM-T-Et HSP60) that makes up transforms the TOP10 competent cell, carry out blue hickie screening, after selecting hickie bacterium colony incubated overnight, carry out PCR and identify, identifies that correct single bacterium colony serves extra large Ying Jun Bioisystech Co., Ltd and check order.
4. bioinformatic analysis:
Utilize online software ORF finder (
Http:// www.ncbi.nlm.nih.gov/gorf/gorf.html) full length cDNA sequence of the new gene that analyze to obtain, find out encoder block.Utilize the ProtParam instrument (
Http:// cn.expasy.org/tools/protparam.html) the proteinic theoretical molecular of calculation code, iso-electric point, amino acid composition etc.Utilize the Antigenic program that provides among the information biology center WebLab of Peking University (
Http:// weblab.cbi.pku.edu.cn/program.inputForm.do? program=antigenic) analyze its antigen site.Utilize Singal P3.0 on-line analysis software (
Http:// www.cbs.dtu.dk/services/SingnalP/) analysis of encoding albumen has no signal peptide.ProtScale on-line analysis software (
Http:// www.expasy.org/cgi-bin/protscale.pl) the proteic hydrophobicity of analysis of encoding.Utilize the TMHMM server (
Http:// www.cbs.dtu.dk/services/TMHMM-2.0/) analysis of encoding albumen has or not and stride membrane structure.BLASTp software (
Http:// www.ncbi.nlm.nih.gov/BLAST/) and FASTA software (
Http:// www.ebi.ac.uk/fasta33) be used for the search of homologous protein, utilize CDD
(http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml) the functional domain database of software inquiry NCBI conserved regions, inquiry has or not conservative functional domain.Utilize motif_scan (
Http:// myhits.isb-sib.ch/cgi-bin/motif_scan), the analytic function structural domain.
5. fluorescence real-time quantitative RT-PCR:
Utilize Real-time PCR that Eimeria tenella thermal shock protein 60 (EtHSP60) gene that obtains is analyzed at the expression of the different developmental phases life history (not spore egg capsule, spore egg capsule, sporozoite, merozoite), the house-keeping gene 18s rRNA that selects Eimeria tenella is as confidential reference items.
At first extract not total RNA of spore egg capsule, spore egg capsule, sporozoite of Eimeria tenella, behind the removal genomic dna, utilize the random primer reverse transcription to become cDNA first chain, the primer of EtHSP60 gene quantification PCR is:
Sense?Primer：5′-GCTGGCAACGAGAAGGAC-3′，
Antisense?Primer：5′-GACCTGCGGCTTGAAGTAG-3′
The primer of 18S rRNA is Sense Primer:5 '-TGTAGTGGAGTCTTGGTGATTC-3 ',
Antisense?Primer 5′-CCTGCTGCCTTCCTTAGATG-3′
Adopt SYBR Green I fluorescence dye to carry out real-time quantitative PCR.Reaction system 20 μ L:10 μ mol/L upstream primers 0.8 μ L, 10 μ mol/L downstream primers, 0.8 μ L, 25 * SYBR Green I, 10 μ L, Easy dilutiobn 8.2 μ L, template (cDNA) 1.0 μ L.Reaction conditions: 95 ℃ of 90s; 95 ℃ of 5s, 58 ℃ of 30s, 80 ℃ of 10s, 40 circulations, wherein 58 ℃ of 30s concluding time points are the fluorescent signal check point.Each etap of polypide makees 3 samples and repeats, and each sample is done 3 technology and repeated.
6. the structure of recombinant expression plasmid:
Will be through identifying correct recombinant plasmid pGEM-T-Et HSP60, utilize the multiple clone site of cloning vector pGEM-T-easy carrier and expression vector pET28a (+), select suitable enzyme BamH I and Not I to carry out double digestion, enzyme is cut the back and is reclaimed Et HSP60 fragment and pET28a (+) fragment, connect and make up recombinant expression plasmid (pET28a (+)-EtHSP60), connect back transformed into escherichia coli TOP10 competent cell, carry out the evaluation (PCR identifies and double digestion is identified) of positive colony, to transformed into escherichia coli BL21 (DE3) behind the positive colony extraction plasmid of screening.
7. recombinant expression plasmid pET28a (+)-expression of Et HSP60 in intestinal bacteria:
To identify that good pET28a (+)-Et HSP 60/BL21 (DE3) transformed bacteria is inoculated in liquid LB (containing that penicillin of card) substratum, 37 ℃ of concussion overnight incubation, the bacterium liquid of overnight incubation is inoculated in another LB (containing that penicillin of card) liquid nutrient medium in 1% ratio, 37 ℃, 200r/min, shaking culture 2h-3h, make bacterial growth to logarithmic phase, during OD600=0.6-1.0, adding final concentration is the IPTG abduction delivering of 1mmoL/L, induce back 0h at adding IPTG, 2h, 4h, 6h, 8h, 10h, 12h collect thalline respectively, use SDS-PAGE and analyze tropina, determine best induction time, the discovery expression amount is inducing 6h promptly to peak.Et HSP60 gene ORF contains 1455 Nucleotide, 484 amino acid of encoding, theoretical molecular is 53.5kDa, adopt His gene fusion expression system, goal gene is efficiently expressed, the fusion rotein of expressing has the His label that molecular weight is 3.5kDa, and then the recombinant protein molecular weight of recombinant plasmid pET28a (+)-Et HSP expression is approximately 57kDa, and the SDS-PAGE electrophoresis result is big or small consistent with expection.
8. the separation and purification of recombinant protein:
According to the best induction time of determining, behind recombinant plasmid pET28a (+)-Et HSP60 transformed into escherichia coli BL21, adding final concentration is 1mmoL/L IPTG, in 37 ℃ of shaking table shaking culture, induces Recombinant Protein Expression, when expression amount peaks, centrifugal, collect thalline, determine that recombinant expression protein exists with soluble form, still exist with the inclusion body form, utilize His Resin (resin) purification of Recombinant expressing protein.Because pET28a (+)-EtHSP60 expression vector has the His mark after initiator codon, can utilize His Resin affinity column that target protein is adsorbed, the fusion rotein that is combined on the post is eluted, thereby reach the purpose of separation and purification recombinant protein.PET28a (+)-recombinant expressed bacterium of Et HSP60 is behind ultrasonic degradation, and is centrifugal, goes up cleer and peaceful precipitation and do not carry out the SDS-PAGE electrophoretic analysis, found that recombinant protein exists with the inclusion body form.Adopt the inclusion body protein purification technique, inclusion body protein is dissolved in the 8mmoL/L urea, renaturation fusion rotein after dialysing utilizes His column purification recombinant protein pET28a (+)-Et HSP60 again, and the SDS-PAGE analysis revealed has obtained the recombinant protein of higher degree.
9. Western-blot detects recombinant expression protein:
The recombinant protein of purifying is carried out being transferred on the pvdf membrane behind the SDS-PAGE electrophoresis, anti-as one with the antiserum(antisera) (after pET28a (+)/BL21 intestinal bacteria lysate adsorption treatment) of Eimeria tenella egg capsule oral immunity chicken, the goat-anti chicken IgG of horseradish peroxidase mark two anti-ly carries out the Western-blot check and analysis.
The clone and the bioinformatic analysis of a kind of new heat shock protein 60 of Eimeria tenella of the present invention (Et HSP60) gene are as follows:
This test utilizes inhibition subtractive hybridization (SSH) technology and cDNA microarray technology screening Eimeria tenella sporozoite stage polypide difference expression gene, obtain a clone and number be the est sequence of ZB2-D07 gene, utilize the RACE technology est sequence to be carried out the extension amplification of 3 ' and 5 ' end, the dna fragmentation of a 2356bp will have been obtained with the est sequence splicing after 3 ' and 5 ' the end RACE amplified production order-checking that obtain, further utilize round pcr to obtain the cDNA (see figure 1) of a 1802bp, this gene contains the open reading frame of a 1455bp, 484 amino acid of encoding.Utilize the Blast on-line analysis of NCBI website to find that this sequence and known Eimeria tenella gene do not have obvious homology.Utilize the CDD program of NCBI that the amino acid whose conserved domain of this genes encoding is searched for, the result shows that the amino acid of this genes encoding has the conserved domain (ClpB_D2-small) of a ClpB of HSPs family, with the nucleotide sequence result that records and E.tenella gene order-checking website (
Http:// www.sanger.ac.uk./projects/E_tenella/OmniBLAST) carry out homology search comparison, find that the genomic HSP gene of this gene and E.tenella has high homology.In GenBank, carry out Blast search, find the E.tenella gene order that matches well with it to show that this gene is the new gene of E.tenella, by its molecular weight size called after Et HSP60 gene. Bioinformatic analysis finds that this albumen has protein kinase phosphorylation site, 4 casein kinase i I phosphorylation sites, 6 N end cardamom acylations sites, 10 PKC phosphorylation sites, 1 Tyrosylprotein kinase phosphorylation site, 1 nuclear localization sequence (NLS) and 1 NACHT structural domain (seeing Table 1) that 2 amidation sites, 1 N end glycosylation site, 1 ATP/GTP binding site, 1 cAMP and cGMP rely on.
The structure function domain analysis of table 1 proteins encoded
Antigenic program (the http://weblab.cbi.pku.edu.cn/program.inputForm.do that provides among the information biology center WebLab of Peking University is provided? program=antigenic) analyze its antigen site, found that this albumen has 9 antigen sites (seeing Table 2).
Signal peptide and stride membrane structure analysis revealed Et HSP60 n-end of albumen and do not have signal peptide does not have the membrane structure of striding (Fig. 2) yet.Instability index in solution is 41.86, is higher than thresholding 40, in solution neutral matter instability.Aliphatics index 90.68, total wetting ability-0.430, the higher (see figure 3) of the overall hydrophobicity of protein.
The antigen peptide site of table 2Et HSP60 proteins encoded is analyzed
The present invention is to the analysis of Eimeria tenella thermal shock protein 60 (Et HSP60) gene in the different developmental phases life history:
In order further to verify the reliability and the expression of Et HSP60 gene in Eimeria tenella different developmental phases polypide of inhibition subtractive hybridization (SSH) technology and cDNA array screening difference expression gene, extracted not total RNA of spore egg capsule, spore egg capsule, sporozoite and s-generation merozoite of Eimeria tenella respectively, select housekeeping gene 18sRNA as confidential reference items, utilize the fluorescence quantitative RT-RCR method to detect the expression of this gene in Eimeria tenella different developmental phases polypide.Experimental result proves, Et HSP60 gene Eimeria tenella not spore egg capsule, spore egg capsule express hardly, in sporozoite and s-generation merozoite, express, but be higher than s-generation merozoite (see figure 4) in the expression in sporozoite stage.
The present invention expresses in prokaryotic expression system a kind of new heat shock protein 60 of Eimeria tenella (Et HSP60) gene:
The Et HSP60 gene that obtains is connected among the prokaryotic expression carrier pET28a (+), made up prokaryotic expression recombinant plasmid (pET28a (+)-Et HSP60), connect back transformed into escherichia coli TOP10 competent cell, carry out evaluation (PCR identifies and the double digestion is identified) (see figure 5) of positive colony, to transformed into escherichia coli BL21 (DE3) behind the positive colony extraction plasmid of screening.Discovery recombinant expression protein expression amount is inducing 6h promptly to peak behind the IPTG abduction delivering.Et HSP60 gene ORF contains 1455 Nucleotide, 484 amino acid of encoding, theoretical molecular is 53.5kDa, adopt His gene fusion expression system, goal gene is efficiently expressed, the fusion rotein of expressing has the His label that molecular weight is 3.5kDa, then the recombinant protein molecular weight of recombinant plasmid pET28a (+)-Et HSP expression is approximately 57kDa, the big or small consistent (see figure 6) of SDS-PAGE electrophoresis result and expection, from figure, also can see, recombinant expression plasmid induces down at IPTG that expression product promptly appears in 2h, and 6h reaches high expression level amount.And utilizing His Resin purification of recombinant proteins pET28a (+)-Et HSP60, the SDS-PAGE analysis revealed has obtained the recombinant protein (see figure 7) of higher degree
Another purpose of the present invention has provided the application of above-mentioned Eimeria tenella heat shock protein 60 (EtHSP60) gene in anti-coccidiosis of chicken medicine of preparation or anti-coccidiosis of chicken vaccine.
The present invention has carried out antigenic evaluation to Eimeria tenella heat shock protein 60 (EtHSP60) gene recombinant protein through above-mentioned purifies and separates:
Recombinant protein pET28a (+)-Et HSP60 of purifying is carried out SDS-PAGE, transfer on poly(vinylidene fluoride) (PVDF) film, antiserum(antisera) with Eimeria tenella spore egg capsule oral immunity chicken is anti-as one, and the goat-anti chicken IgG of horseradish peroxidase mark analyzes as the two anti-Western-blot that carry out.The reaction band has appearred in pET28a (+)-EtHSP60 recombinant protein as a result, and molecular weight is consistent with the expected results size, shows that this recombinant protein all has certain antigenicity.(see figure 8)
Description of drawings
Fig. 1: the pcr amplification of the new heat shock protein of Eimeria tenella (EtHSP60) gene
1, pcr amplification product
M, standard molecular weight (be followed successively by from top to bottom: 2000bp, 1500bp, 750bp, 500bp, 250bp, 100bp)
Fig. 2: Et HSP60 gene coded protein stride the membrane structure analysis
Fig. 3: the hydrophobicity analysis of Et HSP60 gene coded protein
Fig. 4: real-time quantitative PCR detects the expression of HSP60 gene in the E.tenella different developmental phases
1, spore egg capsule not; 2, spore egg capsule, 3, sporozoite; 4, s-generation merozoite
Fig. 5: recombinant expression plasmid (pET28a (+)-Et HSP60) double digestion is identified
1, BamH I and Not I enzyme are cut evaluation
(be followed successively by from top to bottom: 2000bp, 1500bp, 750bp, 500bp, 250bp, 100bp) Fig. 6: SDS-PAGE analyze the not expressing protein of phase simultaneously of pET28a (+)-Et HSP60/BL21 for M, standard molecular weight
1～6, recombinant plasmid pET28a (+)-Et HSP induces the expression product of back 0h, 2h, 4h, 6h, 8h, 10h at IPTG
M, standard protein molecular weight (from top to bottom: 94.0KDa, 66.2KDa, 45.0KDa, 35.0KDa, 26.0KDa, 20.0KDa, 14.4KDa)
Fig. 7: the pET28a (+) of purifying-Et HSP60 recombinant protein
1～2, the pET28a (+) of purifying-Et HSP recombinant protein
3, recombinant plasmid pET28a (+)-Et HSP induces the expression product of back 6h at IPTG
M, standard protein molecular weight (from top to bottom: 94.0KDa, 66.2KDa, 45.0KDa, 35.0KDa, 26.0KDa, 20.0KDa, 14.4KDa)
Fig. 8: recombinant protein Western-Blot analyzes
1, the recombinant protein pET28a (+) of purifying-Et HSP60
M, the standard protein molecular weight (from top to bottom: 170KDa, 130KDa, 95KDa, 72KDa, 55KDa, 43KDa, 34KDa, 26KDa, 17KDa, 11KDa) that dyes in advance,
Embodiment:
The clone of Eimeria tenella heat shock protein 60 (Et HSP60) gene:
1, material
(1) laboratory animal
The yellow plumage chicken of Luo Man high-quality is planted chicken house in converging available from Shanghai, transports laboratory rearing back after going out shell, and cage tool, feed, drinking-water etc. are all through strict sterilization.
(2) experiment worm strain
Eimeria tenella (Eimeria tenella): Eimeria tenella spore egg capsule, numbering: CAAS21111601 is provided by China Agriculture Academe Shanghai Veterinary Institute's preservation.
(3) main agents
Trizol, GeneRaceTM Kit are available from Invitrogen company; TaKaRa Agarose Gel DNAPurification Kit is available from the precious biotechnology in Dalian company limited; Agarose, PGEM-T-easy vector are available from Promega company; The TOP10 competent cell is available from the precious biological company limited in Dalian; Block that penicillin, IPTG available from magnificent biotechnology company limited; DNA Marker is available from Shanghai Mei Ji Bioisystech Co., Ltd; DEPC, X-Gal, Tag Plus I archaeal dna polymerase are given birth to worker's biotechnology company limited available from Shanghai; Bacto-yeastextract, Agar A, bacto-tryptone are OXOID company product.
(4) RACE (the terminal rapid amplifying of cDNA) primer
Utilize suppression subtractive hybridization technique (SSH) and cDNA microarray technology screening Eimeria tenella (E.tenella) spore development stage (not spore egg capsule, spore egg capsule, sporozoite) polypide difference expression gene, obtained sporozoite stage polypide cance high-expression gene clone ZB2-D07.According to its EST (expressed sequence tag) sequence, designed 3 ' and 5 ' RACE primer (primer is synthetic by the biological company limited in match Parkson, Shanghai).
3’Primer 5’-TCAGACTGGACATGGTGGAATATCAA-3’
3’Nested?Primer 5’-AGCGTGGTGBTTGTTCGACGAAGT-3’
5’Primer 5’-CTTCACTGCTCGGTCTTGTCCAACA-3’
5’Nested?Primer 5’-CGCGAGACTTCGTCTTCCGTCATT-3’；
2, method
(1) collection of Eimeria tenella sporozoite
Take out the Eimeria tenella spore egg capsule of preserving from 4 ℃ of refrigerators, room temperature is centrifugal, and behind the flush away potassium bichromate solution, the quantity of counting spore egg capsule is pressed spore egg capsule 5 * 10
4Individual/plumage peroral infection non-ball worm chick in 2 age in week.The egg capsule that collected respectively in caecum and the ight soil on the 8th day the inoculation back.The not spore egg capsule of collecting is cultivated into the spore egg capsule under suitable condition.The spore egg capsule under the digestion of the good Fel Gallus domesticus of pancreatin, discharges sporozoite after using the broken egg capsule wall of glass homogenizer, utilizes G3 and the repurity of G4 sand core funnel to go out sporozoite.It is standby that the sporozoite of purifying is preserved liquid nitrogen.
(2) extraction of the total RNA of Eimeria tenella sporozoite
Get Eimeria tenella sporozoite frozen in the liquid nitrogen, carry out the extraction of total RNA by Trizol reagent specification sheets.
(3) RACE product amplification
Concrete steps are pressed GeneRacer
TMThe test kit operational manual carries out.The RACE product cloning that amplification obtains is selected positive colony in the pGEM-T-easy carrier, (the handsome Bioisystech Co., Ltd in Shanghai) checks order.Search 3 ' and the lap of 5 ' RACE product sequence and former est sequence according to sequencing result, with three sections sequence assemblies.
(4) contain complete open reading frame (ORF) Cloning of Entire Gene:
CDNA sequences Design upstream and downstream primer according to splicing contains the pulsating pcr amplification of ORF cDNA.
Upstream primer: 5 '-CAGATGTGCATTTAAGGCGATTTGA-3 '
Downstream primer: 5 '-CAGTTGCCTCACGGTAGCCA-3 '
MRNA reverse transcription synthetic cDNA first chain is a template when increasing with RACE, carries out pcr amplification, 94 ℃ of 2min of reaction conditions; 94 ℃ of 30s, 52 ℃ of 40s, 72 ℃ of 2min, 30 circulations, 72 ℃ of 10min; The purified back of the PCR product that amplification obtains is connected with the pGEM-T-easy carrier, the recombinant plasmid pGEM-T-EtHSP60 that makes up transforms TOP 10 competent cells, carries out blue hickie screening, select hickie bacterium colony incubated overnight after, carry out PCR and identify, to identifying correct positive bacterium colony order-checking.
(5) bioinformatic analysis:
Utilize online software ORF finder (
Http:// www.ncbi.nlm.nih.gov/gorf/gorf.html) full length cDNA sequence of the new gene that analyze to obtain, find out encoder block.Utilize the ProtParam instrument (
Http:// cn.expasy.org/tools/protparam.html) the proteinic theoretical molecular of calculation code, iso-electric point, amino acid composition etc.Utilize the Antigenic program that provides among the information biology center WebLab of Peking University (
Http:// weblab.cbi.pku.edu.cn/program.inputForm.do? program=antigenic) analyze its antigen site.Utilize Singal P3.0 on-line analysis software (
Http:// www.cbs.dtu.dk/services/SingnalP/) analysis of encoding albumen has no signal peptide.ProtScale on-line analysis software (
Http:// www.expasy.org/cgi-bin/protscale.pl) the proteic hydrophobicity of analysis of encoding.Utilize the TMHMM server (
Http:// www.cbs.dtu.dk/services/TMHMM-2.0/) analysis of encoding albumen has or not and stride membrane structure.BLASTp software (
Http:// www.ncbi.nlm.nih.gov/BLAST/) and FASTA software (
Http:// www.ebi.ac.uk/fasta33) be used for the search of homologous protein, utilize CDD
(http://www.ncbi.nlm.nih.gov/Structure/cdd/cdd.shtml) the functional domain database of software inquiry NCBI conserved regions, inquiry has or not conservative functional domain.Utilize motif_scan (
Http:// myhits.isb-sib.ch/cgi-bin/motif_scan), the analytic function structural domain.
3, result
This research and utilization inhibition subtractive hybridization (SSH) technology and cDNA microarray technology screening Eimeria tenella sporozoite stage polypide difference expression gene, obtain a clone and number be the est sequence of ZB2-D07 gene, utilize the RACE technology est sequence to be carried out the extension amplification of 3 ' and 5 ' end, the dna fragmentation that has obtained a 2356bp is spliced with est sequence in the RACE product order-checking back that obtains, further utilize round pcr to obtain the cDNA (see figure 1) of a 1802bp, this gene contains the complete open reading frame of a 1455bp, 484 amino acid of encoding.Utilize the CDD program of NCBI that the amino acid whose conserved domain of this genes encoding is searched for, the result shows that the amino acid of this genes encoding has the conserved domain (ClpB-_D2-small) of a ClpB of HSPs family, with the nucleotide sequence result that records and E.tenella gene order-checking website (
Http:// www. Sanger.ac.uk./projects/E_tenella/OmniBLAST) carry out homology search comparison, find that the genomic HSP gene of this gene and E.tenella has high homology.In GenBank, carry out Blast search, find the E.tenella gene order that matches well with it to show that this gene is the new gene of E.tenella, by its molecular weight size called after Et HSP60 gene. Bioinformatic analysis finds that this albumen has protein kinase phosphorylation site, 4 casein kinase i I phosphorylation sites, 6 N end cardamom acylations sites, 10 PKC phosphorylation sites, 1 Tyrosylprotein kinase phosphorylation site, 1 nuclear localization sequence (NLS) and 1 NACHT structural domain that 2 amidation sites, 1 N end glycosylation site, 1 ATP/GTP binding site, 1 cAMP and cGMP rely on.Signal peptide and stride membrane structure analysis revealed Et HSP60 n-end of albumen and do not have signal peptide does not have the membrane structure of striding (see figure 2) yet.Instability index in solution is 41.86, is higher than thresholding 40, in solution neutral matter instability.Aliphatics index 90.68, total wetting ability-0.430, the higher (see figure 3) of the overall hydrophobicity of protein.
Antigenic program (the http://weblab.cbi.pku.edu.cn/program.inputForm.do that provides among the information biology center WebLab of Peking University is provided? program=antigenic) analyze its antigen site, found that this albumen has 9 antigen sites (seeing Table 2).
The expression of Eimeria tenella heat shock protein 60 (EtHSP60) gene in intestinal bacteria
1, material
(1) main agents
Restriction enzyme is available from the precious biotinylated biomolecule technology in Dalian company limited.T
4Dna ligase is available from Promega company, and DNA Marker and standard protein molecular weight are available from TIANGEN Biotech (Beijing) Co., Ltd..
(2) plasmid and bacterial classification
Recombinant clone plasmid pGEM-T-Et HSP60 is the above-mentioned recombinant plasmid of having cloned.Plasmid pET28a (+), BL21 (DE3) are provided by China Agriculture Academe Shanghai Veterinary Institute.
2, method
(1) structure of recombinant expression plasmid:
Will be through identifying correct recombinant plasmid pET28a (+)-Et HSP, utilize the multiple clone site of cloning vector pGEM-T-easy and expression vector pET28a (+), select suitable enzyme to carry out double digestion (BamH I and Not I), enzyme is cut the back and is reclaimed Et HSP60 and pET28a (+) fragment, connect and make up recombinant expression plasmid (pET28a (+)-Et HSP), connect back transformed into escherichia coli TOP10 competent cell, carry out the evaluation (double digestion evaluation) of positive colony, to transformed into escherichia coli BL21 (DE3) behind the positive colony extraction plasmid of screening.
(2) recombinant expression plasmid pET28a (+)-expression of Et HSP60 in intestinal bacteria:
To identify that good pET28a (+)-Et HSP 60/BL21 (DE3) transformed bacteria is inoculated in liquid LB (containing that penicillin of card) substratum, 37 ℃ of concussion overnight incubation, the bacterium liquid of overnight incubation is inoculated in another LB (containing penbritin) liquid nutrient medium in 1% ratio, 37 ℃, 200r/min, shaking culture 2h-3h makes bacterial growth to logarithmic phase, during OD600=0.6-1.0, adding final concentration is the IPTG abduction delivering of 1mmoL/L, induces back 0h, 2h at adding IPTG, 4h, 6h, 8h, 10 collect thalline respectively, use SDS-PAGE and analyze tropina, determine best induction time.
3, result
Recombinant expression plasmid pET28a (+)-Et HSP60 that makes up, connect back transformed into escherichia coli TOP10 competent cell, carry out evaluation (double digestion evaluation) (see figure 5) of positive colony, to the positive colony of screening, transformed into escherichia coli BL21 (DE3) behind the extraction plasmid.
Behind recombinant plasmid pET28a (+)-Et HSP60 transformed into escherichia coli BL21 (DE3), add final concentration and be 1mmoL/L IPTG in 37 ℃ of shaking table shaking culture, induce Recombinant Protein Expression, find that expression amount inducing 6h promptly to peak.Et HSP60 gene ORF contains 1455 Nucleotide, 484 amino acid of encoding, theoretical molecular is 53.5KDa, adopt His gene fusion expression system, goal gene is efficiently expressed, the fusion rotein of expressing has the GST label that molecular weight is 3.5KDa, then the recombinant protein molecular weight of recombinant plasmid pET28a (+)-Et HSP60 expression is approximately 57KDa, the big or small consistent (see figure 6) of SDS-PAGE electrophoresis result and expection, from figure, also can see, recombinant expression plasmid induces down at IPTG that expression product promptly appears in 2h, and 6h reaches high expression level amount.
Sequence table
Eimeria tenella heat shock protein 60 gene order of the present invention:
CAGATGTGCATTTAAGGCGATTTGAATAAGCTTGTGGGGGCCACGACTTTGGA
AGAGTATAAACTCCACATTGAAAAGGACGCGGCCTTTTGCCGCCGCTTCCAGA
ACATCGTCGTGGAGGCGCCCAGCAAGGAGAAGGCCCTTTCAATCCTGCAAAGA
GTGCGTCCGCACTACGAGCAGTTCCACCAGCTGGAAATCCCGGAAGAAGTGCT
GGAGGCGGTGACGAAC
ATGTCGGACCAGTACGTGAAGCAGCGGGCCTTTCCCG
ACAAGGCGCTGGACCTCCTCGACGAGTCTTGTTCTTGGAAACGCGTTTCCCACA
ACAAAAAAATAAATGTCCCCAACAAGCAGATCGCGCAGCTCAAGAAGAACAA
GCTCCCCGAGGAAGAAGAGGAGCTGAAGAAACTGCAGGAGGAGTTGGCTGCT
CTCGAGGCGCTCACTGCGGGGGGGCGGCGGCTGGTGCTGGAGACCAACGACGT
GGCCCACATCTTGAGCCAGTGGACTGGAATCCCGATGGGCAAAATGACGGAAG
ACGAAGTCTCGCGGGTGTTGAGGCTCGCCGACATTTTGTCTCTGAGGGTTGTTG
GACAAGACCGAGCAGTGAAGGCCGTGGCCGACGCGCTGGCTATTCAGCGCGCG
GGGCTGAGTCCGAAGAACAAGCCGCTGGGCACTTTCCTGTTCCTGGGGTCTTCG
GGGGTGGGCAAGACGGAGCTGGCGAAGGCGGTGGCCGAGGAAATGTTTGACT
CTGAAAAGAACTTAATCAGACTGGACATGGTGGAATATCAAGAAGCCCACAGC
ATTTCGCGGCTGATCGGCCCGCCGCCGGGCTACATGGGCAACGACGAGGGCGG
GCAGCTCACGGAGGCCGTGCGCCAAAAGCCCCACAGCGTGGTGTTGTTCGACG
AAGTCGAAAACGCGCACAAGAACTTGTGGTCTTTGCTGCTGCCGATGCTGGAC
GAGGGCCACCTGTCGGACTCGAAGGGAAACCGGGTGGACTTTACGAATTGTTT
GATAATTTTGACTTCCAATATTGGCCAGCAGTACATTTTGGACAGTTACAAGGA
AGTGCGGGCGCTGACGGCTGGCAACGAGAAGGACAAGGCCAGCAGCAACGGC
AGCAGCAGCAGCAACGGCGAAGAGCCCGGCAAGTCCTCCTTCAAAGGCACGG
GCAAATCCCCCAAAGACATTCTCCGGAGAATGCGCCAGAAGGTTCTTAAGGAG
GTCTTCGGCTACTTCAAGCCGCAGGTCATCGGCAGGATGAGCGAGATCATCAT
ATTTGAGCCTCTGGGGGAAACCGCCATGAAGGGGGTTTTGAACTTGAAGCTTT
CGGCGCTGCGGAACAGTTTAGCAGCAAAAGGAATTGACTTCAAAGTCGCCGAC
TCCGCCCTGGGCTACATCTTGGAAAGGGCCTGGTCCCACAAGTTCGGAGGCCG
CAGAATGGCCAAGTACCTGGAGAAGTACATAAAGCCCCGAGTGGCGCCGCTTT
TGATTTCCGGCAAACTCAAGGCGGGAGACAGAGCCGTCTTGGCGCGCTCCAAC
ACAAACCCCAATCAGCTCAACTTGATTGTGTGCGAGCTGAACGAAGAAGGCGT
TTGCAAGCCGGGAACGAAGTACGGCACGAAGCTGGTCACGCAGGAAGTGAAG
CCGCAGGACGGAAACGAGGATGAAGAGGACGCAATGGACTAGCAAAAGAATT
AAAAGCATTTAAAACATTTAAATGATGCTTTTTATCCCTGGAAAGCGGAGAGA
CAAAGTGAGGAAATGAGGACGGAGCTCCCGTTTTTGGCTACCGTGAGGCAACT
GA
Described
ATGBe initiator codon,
TAGBe terminator codon.
Claims (6)
1. Eimeria tenella heat shock protein 60 gene is characterized in that described Eimeria tenella heat shock protein 60 gene has following sequence:
TCAGATGTGCATTTAAGGCGATTTGAATAAGCTTGTGGGGGCCACGACTTTGG
AAGAGTATAAACTCCACATTGAAAAGGACGCGGCCTTTTGCCGCCGCTTCCAG
AACATCGTCGTGGAGGCGCCCAGCAAGGAGAAGGCCCTTTCAATCCTGCAAAG
AGTGCGTCCGCACTACGAGCAGTTCCACCAGCTGGAAATCCCGGAAGAAGTGC
TGGAGGCGGTGACGAAC
ATGTCGGACCAGTACGTGAAGCAGCGGGCCTTTCCC
GACAAGGCGCTGGACCTCCTCGACGAGTCTTGTTCTTGGAAACGCGTTTCCCAC
AACAAAAAAATAAATGTCCCCAACAAGCAGATCGCGCAGCTCAAGAAGAACA
AGCTCCCCGAGGAAGAAGAGGAGCTGAAGAAACTGCAGGAGGAGTTGGCTGC
TCTCGAGGCGCTCACTGCGGGGGGGCGGCGGCTGGTGCTGGAGACCAACGACG
TGGCCCACATCTTGAGCCAGTGGACTGGAATCCCGATGGGCAAAATGACGGAA
GACGAAGTCTCGCGGGTGTTGAGGCTCGCCGACATTTTGTCTCTGAGGGTTGTT
GGACAAGACCGAGCAGTGAAGGCCGTGGCCGACGCGCTGGCTATTCAGCGCGC
GGGGCTGAGTCCGAAGAACAAGCCGCTGGGCACTTTCCTGTTCCTGGGGTCTTC
GGGGGTGGGCAAGACGGAGCTGGCGAAGGCGGTGGCCGAGGAAATGTTTGAC
TCTGAAAAGAACTTAATCAGACTGGACATGGTGGAATATCAAGAAGCCCACAG
CATTTCGCGGCTGATCGGCCCGCCGCCGGGCTACATGGGCAACGACGAGGGCG
GGCAGCTCACGGAGGCCGTGCGCCAAAAGCCCCACAGCGTGGTGTTGTTCGAC
GAAGTCGAAAACGCGCACAAGAACTTGTGGTCTTTGCTGCTGCCGATGCTGGA
CGAGGGCCACCTGTCGGACTCGAAGGGAAACCGGGTGGACTTTACGAATTGTT
TGATAATTTTGACTTCCAATATTGGCCAGCAGTACATTTTGGACAGTTACAAGG
AAGTGCGGGCGCTGACGGCTGGCAACGAGAAGGACAAGGCCAGCAGCAACGG
CAGCAGCAGCAGCAACGGCGAAGAGCCCGGCAAGTCCTCCTTCAAAGGCACG
GGCAAATCCCCCAAAGACATTCTCCGGAGAATGCGCCAGAAGGTTCTTAAGGA
GGTCTTCGGCTACTTCAAGCCGCAGGTCATCGGCAGGATGAGCGAGATCATCA
TATTTGAGCCTCTGGGGGAAACCGCCATGAAGGGGGTTTTGAACTTGAAGCTTT
CGGCGCTGCGGAACAGTTTAGCAGCAAAAGGAATTGACTTCAAAGTCGCCGAC
TCCGCCCTGGGCTACATCTTGGAAAGGGCCTGGTCCCACAAGTTCGGAGGCCG
CAGAATGGCCAAGTACCTGGAGAAGTACATAAAGCCCCGAGTGGCGCCGCTTT
TGATTTCCGGCAAACTCAAGGCGGGAGACAGAGCCGTCTTGGCGCGCTCCAAC
ACAAACCCCAATCAGCTCAACTTGATTGTGTGCGAGCTGAACGAAGAAGGCGT
TTGCAAGCCGGGAACGAAGTACGGCACGAAGCTGGTCACGCAGGAAGTGAAG
CCGCAGGACGGAAACGAGGATGAAGAGGACGCAATGGAC
TAGCAAAAGAATT
AAAAGCATTTAAAACATTTAAATGATGCTTTTTATCCCTGGAAAGCGGAGAGA
CAAAGTGAGGAAATGAGGACGGAGCTCCCGTTTTTGGCTACCGTGAGGCAACT
GA
Described
ATGBe initiator codon;
TAGBe terminator codon.
2. a kind of Eimeria tenella heat shock protein 60 gene according to claim 1 is characterized in that described full length gene 1802bp, contains the open reading frame of 1455bp, 484 amino acid of encoding; The amino acid of described genes encoding has the conserved domain of a ClpB of HSPs family, with the genomic HSP gene of E.tenella high homology is arranged.
3. a kind of Eimeria tenella heat shock protein 60 gene according to claim 1 is characterized in that described gene has protein kinase phosphorylation site, 4 casein kinase i I phosphorylation sites, 6 N end cardamom acylations sites, 10 PKC phosphorylation sites, 1 Tyrosylprotein kinase phosphorylation site, 1 nuclear localization sequence and 1 NACHT structural domain that 2 amidation sites, 1 N end glycosylation site, 1 ATP/GTP binding site, 1 cAMP and cGMP rely on.
4. a kind of Eimeria tenella heat shock protein 60 gene according to claim 1 is characterized in that the n-end of albumen of described gene does not have signal peptide, does not also have the membrane structure of striding; Instability index in solution is 41.86, is higher than thresholding 40, in solution neutral matter instability; Aliphatics index 90.68, total wetting ability-0.430, the overall hydrophobicity of protein is higher.
5. the clone and the expression method of Eimeria tenella heat shock protein 60 gene according to claim 1 is characterized in that this method comprises the following steps:
(1) reagent and material
Trizol, GeneRace
TMKit; TaKaRa Agarose Gel DNA Purification Kit, restriction enzyme; PGEM-T-easy vector; DEPC, X-Gal, Tag Plus I archaeal dna polymerase; Bacto-yeastextract, AgarA, bacto-tryptone; Acrylamide, N, N '-methylene radical methylene diacrylamide, TEMED, ammonium persulphate; HRP-goat anti-rabbit igg 3; HRP-goat-anti chicken IgG; Protein dyes Marker in advance; High-AffinityGST Resin; The yellow plumage chicken of Luo Man high-quality; Eimeria tenella; PET28a (+) expression vector, intestinal bacteria TOP10, e. coli bl21 DE3;
(2) method
1. the collection of Eimeria tenella sporozoite
Take out the Eimeria tenella spore egg capsule of preserving from 4 ℃ of refrigerators, room temperature is centrifugal, and behind the flush away potassium bichromate solution, the quantity of counting spore egg capsule is pressed spore egg capsule 5 * 10
4Individual/plumage peroral infection non-ball worm chick in 2 age in week.The egg capsule that collected respectively in caecum and the ight soil on the 8th day the inoculation back.The not spore egg capsule of collecting is cultivated into the spore egg capsule under suitable condition.The spore egg capsule under the digestion of the good Fel Gallus domesticus of pancreatin, discharges sporozoite after using the broken egg capsule wall of glass homogenizer, utilizes G3 and the repurity of G4 sand core funnel to go out sporozoite.It is standby that the sporozoite of purifying is preserved liquid nitrogen;
2. the extraction of the total RNA of Eimeria tenella sporozoite
Get Eimeria tenella sporozoite frozen in the liquid nitrogen, carry out the extraction of total RNA by Trizol reagent specification sheets;
3. the amplification of the synthetic and RACE product of the terminal rapid amplifying primer of cDNA
Utilize suppression subtractive hybridization technique and cDNA microarray technology not spore egg capsule, spore egg capsule, the sporozoite polypide difference expression gene in screening Eimeria tenella spore development stage, obtain sporozoite stage polypide cance high-expression gene clone ZB2-D07, according to its expressed sequence tag sequence, designed 3 ' and 5 ' RACE primer:
3’Primer 5’-TCAGACTGGACATGGTGGAATATCAA-3’
3’Nested?Primer 5’-AGCGTGGTGBTTGTTCGACGAAGT-3’
5’Primer 5’-CTTCACTGCTCGGTCTTGTCCAACA-3’
5’Nested?Primer 5’-CGCGAGACTTCGTCTTCCGTCATT-3’；
Utilize the synthetic primer to carry out the amplification of RACE product, the RACE product cloning that amplification obtains is selected positive colony in the pGEM-T-easy carrier, check order, search the lap of 3 ' and 5 ' RACE product sequence and former est sequence according to sequencing result, with three sections sequence assemblies;
4. contain complete open reading frame Cloning of Entire Gene
CDNA sequences Design upstream and downstream primer according to splicing contains the pulsating pcr amplification of ORF cDNA;
Upstream primer: 5 '-CAGATGTGCATTTAAGGCGATTTGA-3 '
Downstream primer: 5 '-CAGTTGCCTCACGGTAGCCA-3 '
MRNA reverse transcription synthetic cDNA first chain is a template when increasing with RACE, carries out pcr amplification, 94 ℃ of 2min of reaction conditions; 94 ℃ of 30s, 52 ℃ of 40s, 72 ℃ of 2min, 30 circulations, 72 ℃ of 10min; The purified back of the PCR product that amplification obtains is connected with the pGEM-T-easy carrier, the recombinant plasmid pGEM-T-EtHSP60 that makes up transforms TOP 10 competent cells, carries out blue hickie screening, select hickie bacterium colony incubated overnight after, carry out PCR and identify, to identifying correct positive bacterium colony order-checking;
5. bioinformatic analysis
Utilize online software ORF finder to analyze the full length cDNA sequence of the new gene that obtains, find out encoder block; The proteinic theoretical molecular of ProtParam instrument calculation code, iso-electric point, amino acid are formed; Its antigen site of Antigenic programanalysis; Utilize Singal P3.0 on-line analysis software analysis proteins encoded that no signal peptide is arranged; The hydrophobicity of ProtScale on-line analysis software analysis proteins encoded; Utilize TMHMM server analysis of encoding albumen to have or not and stride membrane structure; BLASTp software and FASTA software are used for the search of homologous protein; Utilize the functional domain database of CDD software inquiry NCBI conserved regions, inquiry has or not conservative functional domain; Utilize motif_scan analytic function structural domain;
6. fluorescence real-time quantitative RT-PCR
Utilize Real-time PCR to Eimeria tenella thermal shock protein 60 (EtHSP60) gene that obtains in the different developmental phases life history: the expression of spore egg capsule, spore egg capsule, sporozoite, merozoite is not analyzed, the house-keeping gene 18s rRNA that selects Eimeria tenella is as confidential reference items
At first extract not total RNA of spore egg capsule, spore egg capsule, sporozoite of Eimeria tenella, behind the removal genomic dna, utilize the random primer reverse transcription to become cDNA first chain, the primer of EtHSP60 gene quantification PCR is:
Sense?Primer：5′-GCTGGCAACGAGAAGGAC-3′，
Antisense?Primer：5′-GACCTGCGGCTTGAAGTAG-3′
The primer of 18S rRNA is Sense Primer:5 '-TGTAGTGGAGTCTTGGTGATTC-3 ',
Antisense?Primer 5′-CCTGCTGCCTTCCTTAGATG-3′
Adopt SYBR Green I fluorescence dye to carry out real-time quantitative PCR.Reaction system 20 μ L:10 μ mol/L upstream primers 0.8 μ L, 10 μ mol/L downstream primers, 0.8 μ L, 25 * SYBR Green I, 10 μ L, Easy dilutiobn 8.2 μ L, template cDNA1.0 μ L.Reaction conditions: 95 ℃ of 90s; 95 ℃ of 5s, 58 ℃ of 30s, 80 ℃ of 10s, 40 circulations, wherein 58 ℃ of 30s concluding time points are the fluorescent signal check point.Each etap of polypide makees 3 samples and repeats, and each sample is done 3 technology and repeated;
7. the structure of recombinant expression plasmid
Will be through identifying correct recombinant plasmid pGEM-T-Et HSP60, utilize the multiple clone site of cloning vector pGEM-T-easy and expression vector pET28a (+), select suitable restriction enzyme Bam HI and Not I to carry out double digestion, enzyme is cut the back and is reclaimed Et HSP and pET28a (+) fragment, connect and make up recombinant expression plasmid: pET28a (+)-EtHSP60, connect back transformed into escherichia coli TOP10 competent cell, carry out the evaluation of positive colony, to transformed into escherichia coli BL21DE3 behind the positive colony extraction plasmid of screening.
8. recombinant expression plasmid pET28a (+)-expression of Et HSP60 in intestinal bacteria
To identify that good pET28a (+)-Et HSP60/BL21 (DE3) transformed bacteria is inoculated in liquid LB and contains the kantlex substratum, 37 ℃ of concussion overnight incubation, the bacterium liquid of overnight incubation is inoculated into another LB in 1% ratio to be contained in the kantlex liquid nutrient medium, 37 ℃, 200r/min, shaking culture 2h-3h makes bacterial growth to logarithmic phase, during OD600=0.6-1.0, adding final concentration is the IPTG abduction delivering of 1mmoL/L, induces back 0h, 2h at adding IPTG, 4h, 6h, 8h, 10h collect thalline respectively, use SDS-PAGE and analyze tropina, determine best induction time;
9. the separation and purification of recombinant protein
According to the best induction time of determining, behind recombinant plasmid pET28a (+)-Et HSP60 transformed into escherichia coli BL21, adding final concentration is 1mmoL/L IPTG, in 37 ℃ of shaking table shaking culture, induces Recombinant Protein Expression, when expression amount peaks, centrifugal, collect thalline, determine that recombinant expression protein exists with soluble form, still exist with the inclusion body form, utilize His Resin purification of Recombinant expressing protein;
10. Western-blot detects recombinant expression protein
The recombinant protein of purifying is carried out being transferred on the pvdf membrane behind the SDS-PAGE electrophoresis, antiserum(antisera) with Eimeria tenella egg capsule oral immunity chicken is anti-as one after pET28a (+)/BL21 intestinal bacteria lysate adsorption treatment, the goat-anti chicken IgG of horseradish peroxidase mark is two anti-, carries out the Western-blot check and analysis.
6. the application of Eimeria tenella heat shock protein 60 gene in anti-coccidiosis of chicken medicine of preparation or anti-coccidiosis of chicken vaccine according to claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910055725XA CN101988069A (en) | 2009-07-31 | 2009-07-31 | Eimeria tenella heat shock protein 60 gene as well as cloning, expression and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910055725XA CN101988069A (en) | 2009-07-31 | 2009-07-31 | Eimeria tenella heat shock protein 60 gene as well as cloning, expression and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101988069A true CN101988069A (en) | 2011-03-23 |
Family
ID=43744863
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910055725XA Pending CN101988069A (en) | 2009-07-31 | 2009-07-31 | Eimeria tenella heat shock protein 60 gene as well as cloning, expression and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101988069A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103361364A (en) * | 2012-03-27 | 2013-10-23 | 中国农业科学院上海兽医研究所 | Eimeria tenella eIF3d gene and application thereof |
| CN104611366A (en) * | 2014-12-26 | 2015-05-13 | 东北农业大学 | Chicken eimeria acervulina genetic recombinant vaccine as well as primer and application thereof |
| CN106854653A (en) * | 2015-12-09 | 2017-06-16 | 中国农业科学院上海兽医研究所 | The gene of Eimeria tenella calcium-dependent protein kinase 4 and its application |
| CN110204604A (en) * | 2019-05-13 | 2019-09-06 | 中国农业科学院上海兽医研究所(中国动物卫生与流行病学中心上海分中心) | A kind of Eimeria tenella AN1 sample zinc finger protein and its application in inhibition coccidia invasion |
| CN113234747A (en) * | 2021-05-19 | 2021-08-10 | 华中农业大学 | Expression and purification method of heat shock protein HSP60 and application thereof |
-
2009
- 2009-07-31 CN CN200910055725XA patent/CN101988069A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103361364A (en) * | 2012-03-27 | 2013-10-23 | 中国农业科学院上海兽医研究所 | Eimeria tenella eIF3d gene and application thereof |
| CN104611366A (en) * | 2014-12-26 | 2015-05-13 | 东北农业大学 | Chicken eimeria acervulina genetic recombinant vaccine as well as primer and application thereof |
| CN106854653A (en) * | 2015-12-09 | 2017-06-16 | 中国农业科学院上海兽医研究所 | The gene of Eimeria tenella calcium-dependent protein kinase 4 and its application |
| CN110204604A (en) * | 2019-05-13 | 2019-09-06 | 中国农业科学院上海兽医研究所(中国动物卫生与流行病学中心上海分中心) | A kind of Eimeria tenella AN1 sample zinc finger protein and its application in inhibition coccidia invasion |
| CN110204604B (en) * | 2019-05-13 | 2022-02-08 | 中国农业科学院上海兽医研究所(中国动物卫生与流行病学中心上海分中心) | Eimeria tenella AN1-like zinc finger protein and application thereof in inhibition of coccidium invasion |
| CN113234747A (en) * | 2021-05-19 | 2021-08-10 | 华中农业大学 | Expression and purification method of heat shock protein HSP60 and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101418309B (en) | Cloning, expression and application of eimeria tenella protein disulfide isomerase gene | |
| CN101988069A (en) | Eimeria tenella heat shock protein 60 gene as well as cloning, expression and application thereof | |
| CN101575606A (en) | Clone, expression and application of tender Eimeria tenella protein kinase (EtPK) gene | |
| US7323547B2 (en) | Highly expressed peptide of white spot syndrome virus in hosts and application thereof | |
| Tian et al. | RPS8—a New informative DNA marker for phylogeny of Babesia and Theileria parasites in China | |
| Liu et al. | Molecular characterization and expression analysis of the large yellow croaker (Larimichthys crocea) chemokine receptors CXCR2, CXCR3, and CXCR4 after bacterial and poly I: C challenge | |
| CN104479004A (en) | Black carp IFN-gamma gene and application | |
| Gao et al. | Full-length transcriptome sequence analysis of Eimeria necatrix unsporulated oocysts and sporozoites identifies genes involved in cellular invasion | |
| Montalvo-Alvarez et al. | The Leishmania HSP20 is antigenic during natural infections, but, as DNA vaccine, it does not protect BALB/c mice against experimental L. amazonensis infection | |
| CN104928386B (en) | Molecular labeling and its application of the RPS23 genes as sheep immune character | |
| Said et al. | Hd86, the Bm86 tick protein ortholog in Hyalomma scupense (syn. H. detritum): expression in Pichia pastoris and analysis of nucleotides and amino acids sequences variations prior to vaccination trials | |
| Kamau et al. | Differential transcription of two highly divergent gut‐expressed Bm86 antigen gene homologues in the tick Rhipicephalus appendiculatus (Acari: Ixodida) | |
| CN113368218A (en) | Antiviral composition containing lateolabrax japonicus interferon IFNd and receptor thereof and application | |
| Fan et al. | Complete mitochondrial genome sequences of Chinese indigenous sheep with different tail types and an analysis of phylogenetic evolution in domestic sheep | |
| Cui et al. | Molecular cloning and expression analysis of heat‐shock protein 70 in orange‐spotted grouper Epinephelus coioides following heat shock and Vibrio alginolyticus challenge | |
| Li et al. | Conservation and diversification of the transcriptomes of adult Paragonimus westermani and P. skrjabini | |
| CN103739696B (en) | Cynoglossus semilaevis female specificity CSW3 protein as well as gene and application thereof | |
| CN102154306B (en) | Codon-optimized swine CD40L gene and preparation method for recombinant rhabdovirus for expressing protein coded by same | |
| CN101979581A (en) | S7 gene and coded recombinant protein of grass carp reovirus strain, and acquisition method and application thereof | |
| CN105734143B (en) | A kind of Europe huso sturgeon real-time fluorescence PCR specific detection system and application | |
| CN101070539A (en) | Sheep coenurus skrjabini specific gene and its separation and identification | |
| Wang et al. | Comparative genomics reveals unique features of two Babesia motasi subspecies: Babesia motasi lintanensis and Babesia motasi hebeiensis | |
| CN108586596B (en) | Oyster apoptosis gene SMAC gene and application thereof in preparation of pathological detection diagnostic reagent | |
| Chen et al. | Molecular cloning and expression analysis of myd88 from oriental weatherfish (Misgurnus anguillicaudatus) in response to bacterial challenge | |
| CN101914545A (en) | Leucine-rich protein ALM gene of branchiostoma japonicum and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20110323 |