CN102847167B - A kind of structure of the modified model potentiation nucleic acid vaccine preventing bovine mastitis - Google Patents
A kind of structure of the modified model potentiation nucleic acid vaccine preventing bovine mastitis Download PDFInfo
- Publication number
- CN102847167B CN102847167B CN201210236074.6A CN201210236074A CN102847167B CN 102847167 B CN102847167 B CN 102847167B CN 201210236074 A CN201210236074 A CN 201210236074A CN 102847167 B CN102847167 B CN 102847167B
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- vaccine
- acid vaccine
- fnbpa
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Abstract
The present invention relates to the vaccine in biological technical field and construction method thereof, be the design of a kind of modified model potentiation nucleic acid vaccine and construction method and application.This invention is that the fusion gene insertion vector after being connected with GPI anchor series by the antigen epitope genes selecting staphylococcus aureus FnBPA carries out expressing and immunity, experiment shows that this follow-on vaccine has good immunogenicity, and it is the most immune that immune effect is better than nonfused gene.In protest test, immune mouse is served the effect of immunoprotection.This nucleic acid vaccine can safely, effectively, drug residue free ground preventing and treating mammitis of cow, the preventing and treating to bovine mastitis has a good application prospect.
Description
Technical field
This invention relates to the vaccine in biological technical field and construction method thereof, especially relates to improvement and the construction method thereof of the DNA vaccination as target with the FnBPA molecule A district of area epidemic link and the partial sequence in B district.
Background technology
In recent years, along with expansion and the increase of stocking density of raising scale, the infection of mastitis is in rising trend.Ending China's milch cow live-stock inventory in 2011 13000000, the economic loss caused by mastitis every year is up to 4,000,000,000 yuan.In the last few years, a large amount of uses of antibiotic are even abused, and make the antimicrobial spectrum of golden yellow Portugal fungus ball bacterium gradually expand, and propose new challenge to clinical treatment and prevention golden yellow Portugal fungus ball bacterium mastitis.It is now recognized that vaccine is the effective ways that prevention and control golden yellow Portugal fungus ball bacterium infects.S. aureus vaccines development so far experienced by full bacterium inactivated vaccine, subunit vaccine and 3 major transformations of DNA vaccination.
Woods peak waits by force (Lin Fengqiang, Hu Songhua, Hu Qilin, Deng. staphylococcus aureus mastitis in dairy cows vaccine adjuvant present Research animal medicine is in progress, 2004,25 (6): 49-51.) deficiency for inactivated vaccine have developed the subunit vaccine for staphylococcus aureus single component.
Staphylococcus aureus adhesin fibronectin binding protein A (FnbpA) is the prerequisite (Zhou Hong that antibacterial infects, Li Hanping. progress of Staphylococcus aureus surface proteins. biotechnology communication, 2004,15 (1): 73-75.) approach of infection of staphylococcus aureus can be cut off after suppressing its activity from root.Almost all of staphylococcus aureus is owned by FnbpA gene, can express fibronectin binding protein A, and this albumen, owing to having the special Adhering capacity with host tissue, is just becoming anti-Staphylococcus aureus and infecting the focus molecule of vaccine development.At present the D district in FnBP molecular structure is referred to as ligand binding domain it is considered to be main immunodominant epitope, occupies important effect at present in developing S. aureus vaccines.
The FnBPA recombinant protein vaccine vaccine head of domestic development exempts from rear 7d, i.e. can detect that antibody, and along with the prolongation of immunization time, antibody titer is obvious ascendant trend, reaches top level at 21d, and antibody horizontal is gradually lowered afterwards in immune group mice serum.By the Immunization of mice is tested; FnBPA genetic engineering subunit vaccine can be effectively improved the antibody horizontal of mice; immune protection index PI reaches 80%; illustrate that this vaccine has stronger immune protective efficiency (Zhang Haiyan, Yang Hongjun, Wang Changfa to staphylococcus aureus; He Hongbin; secondary peak of mounting, Ma Weiming. the development of recombination staphylococcus aureus FnbpA subunit vaccine. Journal of Northwest Sci Tech University of Agriculture and Forestry .2011,5 (39): 39-43.).
Although genetic engineering subunit vaccine has that antigen dose is big, purity is high and without the advantage (Zhang Yanling such as composition of hereditary material and host and culture medium, Zhang Hui. vaccinology. Beijing: Science Press 2004:345-377,421-504.) the immunne response persistent period of the big animal of genetic engineering subunit vaccine induction is short, and the cost height made, the immune cost of the biggest animal is high.
For overcoming these shortcomings, we have selected nucleic acid vaccine.Nucleic acid vaccine is also known as gene vaccine, DNA vaccination; it is on exogenous gene cloning to plasmid or viral vector, by recombiant plasmid or viral DNA direct immunization, makes exogenous gene in vivo with the form antigen-presenting of native protein; activate body immune system, and the initiation immunoreation that energy is lasting.Its avirulence atavism, also works to virus variant.Therefore DNA vaccination is to enjoy a kind of new generation vaccine of concern in recent years.The anti-Staphylococcus aureus nucleic acid vaccine of adherence mechanism development based on bacterial surface protein is it is considered to be there is the vaccine of wide Research Prospects, it is expected to the adhesion process of cow mammary gland epithelial cells prevents the generation of mastitis by blocking staphylococcus aureus.
nullNour etc. have developed the recombinant dna vaccine of CTLA4 and ClfA and have employed copolymer cation packaging first with nucleic acid vaccine immunity milch cow 2 times，After 3 months again with the ClfA recombiant protein booster immunization of 200 μ g once，Immune cattle creates stronger humoral immunization and cell immune response (AdelNMNourEldin，LulzimShkreta，BrIanGTalbot，eta.lDNAimunizationofdairycowswiththeclumpingfactorAofStaphylococcusaureus.Vaccine，2006，24:1997-2006.) external existing adherence mechanism based on FnBP develops the report of L-form staphylococcus aureus vaccine.
But the DNA Vaccine being currently target gene development with FnBPA is not highly desirable, as the representative of a new generation's vaccine, immunogenicity is relatively low is to limit the wide variety of principal element of DNA vaccination.The biggest animal to obtain effective immunity needs heavy dose of DNA.The effectiveness improving DNA vaccination can make it the most more effectively play immune effect to realize by improving the angtigen presentation efficiency of plasmid used.
Glycophosphatidyl inositol (GPI) anchorin is the albumen that a class is widely present in cell surface, is characterized in being transmitted without regard to Intracellular signals on cell membrane by protein anchor.nullResearch to the GPI fused cell factor finds，The GPI fused cell factor can form a long-term insoluble slow release base at immunization sites after transferring to cell surface，This will make more immunocyte come immunization sites，And make the more antigen of these cellular uptakes，Thus enhance the effect (PolosoN of vaccine，NagarajanS，BumgarnerGW，Etal.Designercancervaccinesmadeeasy:proteintransferofimm unostimulatorymoleculesforuseintherapeutictumorvaccines. FrontBiosci，2001，6:760-775.) GPI protein delivery technology can extend the GPI protein-bonded life-span to greatest extent and its function is had no significant effect (DanielR.D.Premkumar，YoshihiroFukuoka，etal.PropertiesofexogenouslyaddedGPI-anchoredproteinsfollowingtheirincorporationintocells.JournalofCellularBiochemistry，2001，82:234-245.).
Goal of the invention
For overcoming the relatively low and immune intensity of current dna vaccine immunogenicity low, improve its antigen specific aim and angtigen presentation efficiency, obtain more effectively immunity in vivo.Different from other designs, this research by PCR at the N end of FnBPA antigen epitope genes plus the signal peptide sequence of cattle IFN-γ, at C end plus the gpi signal sequence composition fusion gene of cattle source film anchor type alkali phosphatase.Together with the gene fusion that A district and the B district partial sequence of epitope adhesin molecules FnBPA ligand binding domain are encoded GPI with design, devise the modified model potentiation nucleic acid vaccine preventing bovine mastitis with FnBPA as immune targets.
Summary of the invention
(1) an object of the present invention there is provided the structure of a kind of modified model potentiation nucleic acid vaccine, offers efficiency with improve antigen.For solving above-mentioned technical problem, this invention takes techniques below scheme: in the selection of epitope, have selected A district and the B district of this area epidemic strain FnBPA gene, overcome immuning failure that the difference of the adhesin that the bovine mastitis staphylococcus aureus of separate sources produces causes and improve its antigen specific aim.
(2) for improving this nucleic acid vaccine angtigen presentation efficiency, obtain more effectively immunity in vivo, we at the N end of antigen epitope genes plus the signal peptide sequence of cattle IFN-γ, at C end plus the gpi signal sequence composition fusion gene of cattle source alkali phosphatase.
(3) fusion gene described in is positioned in carrier for expression of eukaryon PVAX-1, additionally includes all carrier pcDNA3.1 that can express in eukaryotic cell, the carrier such as pEGFP-N1, pLXSN.
(4) second object of the present invention is to provide a kind of present invention and prevents the design of nucleic acid vaccine PVAX-SGFn and the construction method thereof of bovine mastitis.
(5) present invention prevents design and the construction method thereof of bovine mastitis nucleic acid vaccine PVAX-Fn, it may include following steps:
null(A) signal peptide sequence is added for the aminoterminal at Fn，According to milch cow IFN-γ signal peptide cDNA sequence synthetic primer，FnP1-5 ' TGCTCTGTGGGCTTTTGGGTTTTTCTGGTTCTTATGGCACTAACGTTAATCATATA G3 ' FnP2-5 ' CGAggatccATGAAATATACAAGCTATTTCTTAGCTTTACTGCTCTGTGGGCTTTT GGGTTTTTC3 ' FnR5 '-GGATgaattcTTCAATGTATCCGTCAAC3 ' also introduces BamHI at forward primer、Downstream primer introduces two restriction enzyme sites of EcoRI，Extension PCR method is utilized to be merged with FnBPA antigen epitope genes by milch cow IFN-γ signal peptide sequence.
(B) it is plus plus the gpi signal sequence of cattle source alkali phosphatase at the c-terminus of antigen epitope genes, uses primer GPIF-5 ' CCGGAATTCTCAGCCAGCTCGTCCGGCAGCCCCTCCCCCGGCCCCCTGCTGCTCCT CCTGGCCCTGCTGCCCCTGGGCAGCCTGTTCTGACTCGAGCGG-3 '
GPIR-5’CCGCTCGAGTCAGAACAGGCTGCCCAGGGGCAGCAGGGCCAGGAGGAGCAGCAGGGGGCCGGGGGAGGGGCTGCCGGACGAGCTGGCTGAGAATTCCGG-3’.By PCR reaction, the gpi signal sequence nucleotide sequence of cattle source alkali phosphatase is connected with the FnBPA fusion gene of above-mentioned structure；(C) PCR primer product after double digestion (forward primer introduces BamHI, downstream primer introduces two restriction enzyme sites of XholI) connects in carrier for expression of eukaryon；(D) at this with PVAX-1 for the carrier that sets out, obtain PVAX-SGFn plasmid, check order and verify sequence.
(6) the above technical scheme of the present invention provides design and the construction method of a kind of nucleic acid vaccine with staphylococcus aureus FnBPA gene as target.The feature of the present invention can be summarized as: the DNA sequence of cattle IFN-γ signal peptide is connected by this vaccine with the N end of FnBPA epitope, and the gpi signal sequence of cattle source alkali phosphatase is connected with the C end of the FnBPA fusion gene of structure；Being designed to of this modified model potentiation makes target antigen be expressed in cell surface；This design can improve the efficiency of angtigen presentation and have long-term and be effectively protected effect, is the improvement to FnBPA gene DNA vaccine.Present invention development of new generation vaccine in bovine mastitis is prevented and treated plays an important role in terms of exploitation, has a extensive future.
Invention effect
(1) present invention is compared with subunit vaccine, and the cost of making reduces.
(2) present invention consumption compared with subunit vaccine is few.
(3) DNA sequence of cattle IFN-γ signal peptide is connected with the N end of epitope by the present invention, and the gpi signal sequence of cattle source alkali phosphatase is connected with the C end of the FnBPA fusion gene of above-mentioned structure；Can make antigen at cell surface expression, and immunization sites formed a long-term insoluble slow release base, this will make more immunocyte come immunization sites, make the more antigen of these cellular uptakes, thus enhance the effect of vaccine.
(4) this invention extends the life-span of fusion protein and has no significant effect its function in addition.Therefore present invention immunne response persistent period compared with traditional nucleic acid vaccine is long, up to more than 3 months.
(5) latter 3 months counteracting toxic substances protected effect of immunity are up to 66%.
(6) selection of immune epitope is positioned at the partial sequence in i.e. B district of A district of FnBPA, the difference that the adhesin that the bovine mastitis staphylococcus aureus of separate sources can be overcome to produce causes.
(7) compared with the DNA vaccination before improvement, its humoral immunization all increases significantly with the effect of cellular immunization and improves.
Accompanying drawing explanation
Fig. 1 is A district and the portion gene electrophoretogram in B district, the M:DL2000Marker of PCR amplification FnBPA gene；1:PCR product.
Fig. 2 PVAX-1 carrier for expression of eukaryon, is used to build the PVAX-1 carrier figure of FnBPA genetic recombinants.
Fig. 3 is recombinant eukaryon expression vector restriction enzyme digestion and electrophoresis figure, M:DL2000Marker；1:PVAX-KFn；2:PVAX-Fn-GPI；3:PVAX-Fn-GPI；4:PVAX-1；N:DL15000Marker, after having built, convert escherichia coli, picking positive colony, carry out PCR qualification.Result obtains the fragment of about 1700bp, is consistent with expected results, points out above-mentioned epitope to be already connected on expression vector.
Fig. 4 is the PVAX-KFn destination protein that WesternBlot analyzes that BHK-21 cell is expressed, M:Marker, 1:PVFn recombiant plasmid, 2:PVAX-1 empty carrier.
Fig. 5 is the PVAX-Fn-GPI destination protein that WesternBlot analyzes that BHK-21 cell is expressed, M:Marker, 1:PVAX-Fn-GPI recombiant plasmid, 2:PVAX-1 empty carrier.
Fig. 6 is the antibody horizontal detection after modified model DNA vaccination immunized mice, and testing result shows that antibody horizontal difference compared with matched group that adhesin molecules FnbpADNA vaccine immunity group is induced is the most notable.
Fig. 7 be improve before and after antibody after DNA vaccination immunized mice comparative result figure (one exempt from and two exempt from after) (*: P ＜ 0.05, *: 0.001 ＜ P ＜ 0.01, * *: P ＜ 0.001), this vaccine-induced antibody horizontal is significant difference compared with before improvement.
Fig. 8 is testing result figure (after two exempt from) (*: the P ＜ 0.05 of the cellular immune level after DNA vaccination immunized mice, * *: P ＜ 0.001), result display PVAX-Fn-GPI more can stimulate the cellular immune level of body than empty carrier group and blank group.Statistical analysis shows PVAX-KFn and empty carrier group and blank group significant difference with comparing, and the PVAX-Fn-GPI after improving is the most notable with empty carrier group and blank group difference.PVAX-Fn-GPI after improvement is significant difference (P ＜ 0.05) compared with before improvement.
Embodiment
Build the carrier for expression of eukaryon of bovine mastitis FnBPA gene
(1) genomic DNA of local epidemic link is obtained.
(2) screening has good immunogenicity and the Dominant Epitopes of antigen diversity FnBPA gene, and the A district of PCR amplification FnBPA gene and the portion gene (Fig. 1) in B district, as the candidate sequence of DNA vaccination.
null(3) signal peptide sequence is added for the aminoterminal at Fn，According to milch cow IFN-γ signal peptide cDNA sequence synthetic primer，FnP1-5 ' TGCTCTGTGGGCTTTTGGGTTTTTCTGGTTCTTATGGCACTAACGTTAATCATATA G3 ' FnP2-5 ' CGAggatccATGAAATATACAAGCTATTTCTTAGCTTTACTGCTCTGTGGGCTTTT GGGTTTTTC3 ' FnR5 '-GGATgaattcTTCAATGTATCCGTCAAC3 ' also introduces BamHI at forward primer、Downstream primer introduces two restriction enzyme sites of EcoRI，Extension PCR method is utilized to be merged with FnBPA antigen epitope genes by milch cow IFN-γ signal peptide sequence.
(4) it is plus plus the gpi signal sequence of cattle source alkali phosphatase at the C end of antigen epitope genes, uses primer GPIF-5 ' CCGGAATTCTCAGCCAGCTCGTCCGGCAGCCCCTCCCCCGGCCCCCTGCTGCTCCT CCTGGCCCTGCTGCCCCTGGGCAGCCTGTTCTGACTCGAGCGG-3 '
GPIR-5’CCGCTCGAGTCAGAACAGGCTGCCCAGGGGCAGCAGGGCCAGGAGGAGCAGCAGGGGGCCGGGGGAGGGGCTGCCGGACGAGCTGGCTGAGAATTCCGG-3’.By PCR reaction, the gpi signal sequence nucleotide sequence of cattle source alkali phosphatase is connected with the FnBPA fusion gene of above-mentioned structure.
(5) PCR primer product after double digestion (forward primer introduces BamHI, downstream primer introduces two restriction enzyme sites of XholI) connects in carrier for expression of eukaryon；
(6) at this with PVAX-1 for the carrier that sets out (Fig. 2), obtain PVAX-SGFn plasmid, check order and verify sequence.
(7), after having built, convert escherichia coli, picking positive colony, carry out PCR qualification.Result obtains the fragment (Fig. 3) of about 1700bp, is consistent with expected results, points out above-mentioned epitope to be already connected on expression vector.Simultaneously by the carrier order-checking of restructuring, to verify sequence.
The detection of recombiant plasmid vivoexpression
After the transfection collected, cell and the 5 × SDSloadingbuffer of about 48h mix and boil process, empty carrier as negative control sds polyacrylamide gel electrophoresis, then transferring film.One anti-concentration 1: 80037 DEG C hatches 2h, washes film 5 times with PBST, and by 1: 500 37 DEG C of incubation 1h of HRP labelling goat anti-rabbit igg diluted, PBST washes film 5 times, DAB nitrite ion colour developing 3min, observed result.
WesternBlot test result indicate that, can express destination protein after constructed Transfected Recombinant Plasmid BHK-21 cell, and size is about 66kD, and the restructuring destination protein expressed can be with the hyper-immune serum generation specific reaction of anti-FnBPA.
The detection of humoral immunization after experimental animal immune
(1) before immunity and after each immunity, after 2 weeks, immune mouse is carried out docking blood sampling, separate serum.Detect immune front with indirect ELISA method and respectively exempt from rear Serum Antibody titre.The sodium carbonate buffer 4 DEG C of FnBPA purifying protein PH=9.6 is overnight coated.Mus serum is carried out variable concentrations dilution: initial 100 times of dilutions, rear doubling dilution.Different dilution serum are done one and resists 37 DEG C of incubation 2h.Resist dilute at 1: 4000 by the two of sheep anti mouse HRP labelling, after 37 DEG C of incubation 1h, wash, develop the color, terminate, OD450 reading, wash plate PBST every time and wash 5 times.
The serum of different time is an anti-ELISA that makees respectively after 100 times of dilutions and detects, and OD450nm reading does matched group with empty carrier and blank group.Result such as figure.We show that antibody horizontal difference compared with matched group that adhesin molecules FnbpADNA vaccine immunity group is induced is the most notable at the result of research.In addition this vaccine-induced antibody horizontal significant difference compared with before improvement.
The detection of cellular immunization after experimental animal immune
(1) aseptic win two exempt from one month after mouse spleen, after 200 eye mesh screens grind, lymphocyte is isolated with lymphocyte separation medium, with Dhanks liquid 3000r/min, after 4 DEG C wash twice, after each sample being carried out cell counting with cell counting count board, it is diluted to 2.5 × 10 with the RPMI-1640 containing 10% hyclone4/ hole.On 96 porocyte culture plates, every hole adds 100uL lymphocyte diluent, each sample repeats 4 holes, experimental group adds 40 μ L concanavalin A, Con A (ConA, 10 μ g/mL) simultaneously matched group add equivalent RPMI-1640, another every hole adds 140 μ l640 culture fluid and sets pure blank group, adds 100ulMTT (10 μ g/mL) reagent after cultivating 48 hours.Continue to cultivate 4-6 hour, add 150uLDMSO and terminate, OD after vibrations make water-fast purple crystal thoroughly dissolve gently570nmReading.Calculate as follows: stimulation index (stimulationindex, SI)=(positive OD value-blank OD value)/(cell OD value-blank OD value).With different recombiant plasmid immune mouses constructed by equivalent 2 times, after two exempt from 90 days, the MTT experiment of splenic T lymphocyte is detected the stimulation index (stimulationindex, SI) of gained.The result display PVAX-Fn-GPI of MTT experiment more can stimulate the cellular immune level of body than empty carrier group and blank group.Statistical analysis shows PVAX-KFn and empty carrier group and blank group significant difference with comparing, and the PVAX-Fn-GPI after improving is the most notable with empty carrier group and blank group difference.PVAX-Fn-GPI after improvement is significant difference (P ＜ 0.05) compared with before improvement.
Zoopery
(1) take 18 5-7 week old female mices to be divided into 3 groups (1. blank group injects 100 μ l normal saline；2. empty carrier group, injects 100 μ gPVAX-1 expression vectors, 3.PV-Fn group, injects 100 μ gPV-Fn recombinants, and two exempt from latter 3 months mice to be carried out challenge test, with minimum lethal dose 7 × 109The mice (about body weight 25g) of the staphylococcus aureus lumbar injection 6-8 week old of CFU, Continuous Observation 7 days after counteracting toxic substances, the morbidity of record often group test Mus and death condition, Computation immunity protective efficacy
(2) after immunity inoculation 90 days; challenge test is carried out with the newborn source pathogenic staphylococcus bacterial strain separated; observed through 7 days; 6 mice 12h are the most dead for blank group; 6 mice 24h are the most dead for empty carrier group; PV-Fn recombiant plasmid group protective rate is 66%, and dead 2 of PVAX-Fn-GPI group, protective rate is 66%.
Claims (4)
1. treating and preventing a nucleic acid vaccine for bovine mastitis, described nucleic acid vaccine obtains by being inserted in carrier for expression of eukaryon by nucleotide sequence shown in SEQIDNO:1.
Nucleic acid vaccine the most according to claim 1, described carrier for expression of eukaryon is pVAX-1, pcDNA3.1, pEGFP-N1, pEGFP-C1 or pLXSN.
null3. the construction method of the nucleic acid vaccine described in claim 1，Comprise the following steps: (A) adds signal peptide sequence for the N end at FnBPA Gene A district and part B region sequence，According to milch cow IFN-γ signal peptide cDNA sequence synthetic primer，FnP1-5’TGCTCTGTGGGCTITTGGGTTTTTCTGGTTCTTATGGCACTAACGTTAATCATATAG-3’，FnP2-5’CGAggatccATGAAATATACAAGCTATTTCTTAGCTTTACTGCTCTGTGGGCTTTTGGGTTTTTC-3’，FnR5’-GGATgaattcTTCAATGTATCCGTCAAC-3’，And introduce BamHI at forward primer、Downstream primer introduces two restriction enzyme sites of EcoRI，Extension PCR method is utilized to be merged with FnBPA antigen epitope genes by milch cow IFN-γ signal peptide sequence；null(B) it is plus the gpi signal sequence of cattle source alkali phosphatase at the C end of FnBPA Gene A district and part B region sequence，Use primer GPIF-5 ' CCGGAATTCTCAGCCAGCTCGTCCGGCAGCCCCTCCCCCGGCCCCCTGCTGCTCCT CCTGGCCCTGCTGCCCCTGGGCAGCCTGTTCTGACTCGAGCGG-3 '，GPIR-5’CCGCTCGAGTCAGAACAGGCTGCCCAGGGGCAGCAGGGCCAGGAGGAGCAGCAGGGGGCCGGGGGAGGGGCTGCCGGACGAGCTGGCTGAGAATTCCGG-3’，By PCR reaction, the gpi signal sequence of cattle source alkali phosphatase is connected with the gene of above-mentioned fusion；(C) PCR primer is through double digestion, and the product after forward primer introduces BamHI, downstream primer introduces two restriction enzyme sites of XholI connects in carrier for expression of eukaryon, i.e. obtains inserting the nucleic acid vaccine of nucleotide sequence shown in SEQIDNO:1.
4. in claim 3, connected the recombination bacillus coli DH5 α that the carrier for expression of eukaryon of genetic fragment converts.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210236074.6A CN102847167B (en) | 2012-07-10 | 2012-07-10 | A kind of structure of the modified model potentiation nucleic acid vaccine preventing bovine mastitis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210236074.6A CN102847167B (en) | 2012-07-10 | 2012-07-10 | A kind of structure of the modified model potentiation nucleic acid vaccine preventing bovine mastitis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102847167A CN102847167A (en) | 2013-01-02 |
| CN102847167B true CN102847167B (en) | 2016-08-03 |
Family
ID=47394405
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210236074.6A Active CN102847167B (en) | 2012-07-10 | 2012-07-10 | A kind of structure of the modified model potentiation nucleic acid vaccine preventing bovine mastitis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102847167B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2756125C1 (en) * | 2020-07-27 | 2021-09-28 | Федеральное государственное бюджетное научное учреждение "Всероссийский научно-исследовательский ветеринарный институт патологии, фармакологии и терапии" (ФГБНУ "ВНИВИПФиТ") | Method for complex therapy of mastitis in lactating cows |
-
2012
- 2012-07-10 CN CN201210236074.6A patent/CN102847167B/en active Active
Non-Patent Citations (4)
| Title |
|---|
| Anthony Loughman，et al.Sequence diversity in the A domain of Staphylococcus aureus fibronectin-binding protein A.《BMC Microbiology》.2008,第74卷(第8期),第1-14页. * |
| 何向锋 等.GPI修饰的ESAT-6核酸疫苗的构建及其免疫功能初探.《免疫学杂志》.2011,第27卷(第9期),第737-740、746页. * |
| 张艳晶.金黄色葡萄球菌FnBA亚单位疫苗及核酸疫苗实验免疫研究.《中国优秀硕士学位论文全文数据库 农业科技辑》.2009,(第9期),内容提要. * |
| 金黄色葡萄球菌纤连结合蛋白信号肽的生物信息学分析及其真核分泌表达;王世民 等;《新疆农业大学学报》;20120515;第35卷(第3期);第212页摘要，第215-216页3讨论 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2756125C1 (en) * | 2020-07-27 | 2021-09-28 | Федеральное государственное бюджетное научное учреждение "Всероссийский научно-исследовательский ветеринарный институт патологии, фармакологии и терапии" (ФГБНУ "ВНИВИПФиТ") | Method for complex therapy of mastitis in lactating cows |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102847167A (en) | 2013-01-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112076315A (en) | Nano antigen particle fused with new coronavirus S protein and ferritin subunit, new coronavirus vaccine, and preparation method and application thereof | |
| CN103172749B (en) | Preparation of African swine fever protein engineering vaccine | |
| US20220105170A1 (en) | African swine fever vaccine | |
| CN104248762B (en) | A kind of pig epidemic diarrhea vaccine combination and its preparation method and application | |
| CN105934441A (en) | A novel sars immunogenic composition | |
| EP4410843A1 (en) | Recombinant fusion protein derived from hr region of s2 protein of sars-cov-2 and application of recombinant fusion protein | |
| CN102227444A (en) | Vaccins of plasmodium, antigens, compositions and process | |
| CN115246874A (en) | Recombinant novel coronavirus S-RBD trimer protein, preparation method and application thereof | |
| KR101919002B1 (en) | Soluble Multi-Epitope Antigen of Foot-and-Mouth Disease Virus and Uses Thereof | |
| CN107098974A (en) | A kind of fusion protein and its application | |
| KR101600959B1 (en) | Recombinant Protein Comprising Epitope of Avian reovirus sigma C Protein and Antibody thereto | |
| CN102816246B (en) | Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof | |
| US20220088167A1 (en) | Vaccine composition for preventing tuberculosis, comprising glycosylated ag85a protein and method for preparing same | |
| CN104628865B (en) | A kind of pseudo- mad dog epitope polypeptide recombinant vaccine | |
| CN114524862B (en) | Construction and application of avian influenza (H5 + H7) trivalent DNA vaccine | |
| CN106279431B (en) | A kind of pig circular ring virus subunit inactivated vaccine | |
| AU2012296834A1 (en) | Influenza H5 vaccines | |
| US8501927B2 (en) | Vaccine produced using optimized immobilization antigen cDNA of cryptocaryon irritans and producing method and use thereof | |
| CN102847168B (en) | The design of a kind of nucleic acid vaccine PV-Fn preventing bovine mastitis and structure thereof | |
| TW202206598A (en) | A vaccine against sars-cov-2 and preparation thereof | |
| Katsura et al. | Novel bovine viral diarrhea virus (BVDV) virus-like particle vaccine candidates presenting the E2 protein using the SpyTag/SpyCatcher system induce a robust neutralizing antibody response in mice | |
| CN102847167B (en) | A kind of structure of the modified model potentiation nucleic acid vaccine preventing bovine mastitis | |
| CN104560780B (en) | Toxin attenuation mutant for epsilon toxin of clostridium perfringens and application of toxin attenuation mutant | |
| CN114805599B (en) | VLPs based on ADDOmer chimeric porcine O-type foot-and-mouth disease virus epitope and application | |
| WO2003086453A1 (en) | Purified subfragment codifying for neuroaminidase, recombinant neuroaminidase and its use in zooprophylaxis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |