CN102839158B - Canine distemper attenuated vaccine strain and medical purpose - Google Patents
Canine distemper attenuated vaccine strain and medical purpose Download PDFInfo
- Publication number
- CN102839158B CN102839158B CN 201210311202 CN201210311202A CN102839158B CN 102839158 B CN102839158 B CN 102839158B CN 201210311202 CN201210311202 CN 201210311202 CN 201210311202 A CN201210311202 A CN 201210311202A CN 102839158 B CN102839158 B CN 102839158B
- Authority
- CN
- China
- Prior art keywords
- canine distemper
- strain
- vaccine strain
- gene
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention provides a canine distemper attenuated vaccine strain, and simultaneously discloses a preparation method and a medical purpose of the canine distemper attenuated vaccine strain. FK81 passage domestication attenuated canine distemper attenuated vaccine strain CC12-30 has typical characteristics of canine distemper viruses and is stable in heredity, inoculates dogs can produce high-titer neutralizing antibodies and can resist attacks of virulent strains, and the problem of variation between existing canine distemper vaccines and the canine distemper viruses popular in present clinical operation can be effectively resolved.
Description
Technical field
The invention provides a strain canine distemper attenuated vaccine strain, also disclose preparation method and the medical application of this canine distemper attenuated vaccine strain simultaneously, belong to biological technical field.
Background technology
Canine distemper is the important eqpidemic disease that influences dog class aquaculture, and vaccine inoculation is the effective means of prevention canine distemper.Yet because the canine distemper virus variation is very fast clinically, may causes widely used vaccine strain can not protect fully existing epidemic strain, and by separating clinical canine distemper epidemic strain and being domesticated for vaccine strain, can overcome existing predicament in the current canine distemper control.At present canine distemper virus is tamed to cause and extensively adopt African green monkey kidney cell (Vero) continuous passage method when subtracting; the cycle was longer a little less than this method went down to posterity and causes; and causing the canine distemper virus main protection antigen---the hemagglutinin expression level descends, and having a strong impact on the Vero cell is the immunogenicity of the prepared canine distemper vaccine of matrix.
Summary of the invention
The invention provides a canine distemper attenuated vaccine strain, be a kind of new vaccine strain, tamed by passage cell by the canine distemper virus virulent strain of current popular.
The invention also discloses the preparation method of this canine distemper attenuated vaccine strain.
The present invention further provides the purposes of this canine distemper attenuated vaccine strain.
Hundstaupe pyreticosis attenuated vaccine strain disclosed by the invention, called after: the canine distemper virus attenuated vaccine strain (
Attenuated caninc distempervirus virus vaccine strain), be called for short: CC12-30; In preservation on July 4 in 2012 " China Committee for Culture Collection of Microorganisms common micro-organisms center ", the depositary institution address is No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City to this vaccine strain; Preserving number is: CGMCC6339.
The H gene order of described canine distemper attenuated vaccine strain is: SEQ ID NO:2.
The N gene order of described canine distemper attenuated vaccine strain: SEQ ID NO:5.
The sequence of the NP gene of described canine distemper attenuated vaccine strain: SEQ ID NO:6.
The objective of the invention is to realize by the following technical solutions:
The clinical epidemic strain CC12 that screens is inoculated into cat kidney passage cell FK81 cell, continuous passage according to a conventional method, in per 5 generations, increase and sequential analysis to its protective antigen gene, when the homology of the canine distemper virus main protection antigen gene of passage and attenuation is close with classical vaccine strain, termination is gone down to posterity, and with the canine distemper virus of this generation as candidate vaccine strain; Candidate vaccine strain by susceptible dog and vero passage, is estimated its genetic stability, and therefrom the canine distemper virus strain that has good stability of screening is as the canine distemper attenuated vaccine strain, called after CC12-30.
Obtain the method for canine distemper attenuated vaccine strain of the present invention, concrete steps are as follows:
1) preparation of MEM serum free medium
With RPMI MEM, glutamine, NaHCO
3Use deionized water dissolving, adjust pH to 7.2 back constant volume to 1000 milliliter, 0.22 μ m membrane filtration degerming, aseptic subpackaged;
2) two anti-preparations
Preparation contains the two anti-solution of penicillin 1,000,000 units, Streptomycin sulphate 1,000,000 units;
3) preparation of MEM perfect medium
Get the MEM serum free medium of 89 milliliters of steps 1, add 10 milliliters of foetal calf serums, 1 milliliter of two anti-solution;
4) the virus culture medium preparation that goes down to posterity
Get the MEM serum free medium of 97 milliliters of steps 1, add 2 milliliters of foetal calf serums, 1 milliliter of two anti-solution;
5) propagation of the cultivation of passage cell and canine distemper virus
Cat kidney passage cell FK81 and Vero cell are disperseed respectively according to a conventional method, add the MEM perfect medium, when cell is grown logarithmic growth during the later stage, normal dispersion, and add the virus substratum that goes down to posterity, the clinical epidemic strain CC12 that screens with 1% inoculation of substratum cumulative volume simultaneously, the nutrient solution of freeze-thaw method results 96h is used for going down to posterity or the amplification of canine distemper virus protective antigen gene;
6) the clinical epidemic strain of screening and candidate vaccine strain
The main epidemic strain of relatively acquisition by clinical popular canine distemper virus main protection antigen gene; on the passage cell main epidemic strain tamed cause a little less than, go down to posterity genetic stability and the immunogenicity of strain of the canine distemper virus that meets the vaccine strain requirement further identified.
Attenuated vaccine strain of the present invention and pharmaceutically acceptable adjuvant can be made the control canine distemper vaccine.
The purposes of canine distemper attenuated vaccine strain of the present invention in preparation control canine distemper medicine.
The purposes of canine distemper attenuated vaccine strain of the present invention in preparation diagnosis or detection canine distemper virus reagent.
Positively effect of the present invention is:Cause weak canine distemper attenuated vaccine strain CC12-30 by the domestication of FK81 passage, characteristic feature with canine distemper virus, inheritance stability, the inoculation dog can produce the neutralizing antibody of high titre, and the attack that can resist virulent strain, can effectively solve the variation problem between existing canine distemper vaccine and current clinical popular canine distemper virus.
Description of drawings
Fig. 1 is the N of CC12, H and NP gene PCR product electrophorogram;
Fig. 2 is the N of CC12-30, H and NP gene PCR product electrophorogram;
Fig. 3 is the aspect graph of CC12-30 virus particle under the Electronic Speculum.
Embodiment
For the ease of understanding the present invention, the spy enumerates following examples.Its effect is understood to be to explaination of the present invention but not to any type of restriction of the present invention.
Embodiment 1
1, the screening of main epidemic strain:
1) extraction and the reverse transcription of total RNA
Gathering clinical definite is the lung tissue of hundstaupe pyreticosis dog, grinds with aseptic PBS and makes 10% lung tissue suspension ,-80 ℃ of storages.From stock solution, get 100 μ L suspensions, extract total RNA according to a conventional method, use PrimeScript RT reagent test kit and carry out reverse transcription reaction.The reverse transcription system is as follows:
Table 1, the RT reaction system
Reverse transcription carries out in the PCR instrument, and reaction conditions is 37 ℃ of reverse transcription reaction 15 min, and 85 ℃ of heating 5 s make the reversed transcriptive enzyme inactivation.Reaction is positioned over-20 ℃ of preservations with cDNA solution after finishing.
2) pcr amplification of H gene
Be template with cDNA, use the primer at the H gene
QH1：TTCTG AGGCA GATGA GTTCT TC，
QH2：CTTGG ATGCT ATTTC TGACA CT，
Carry out pcr amplification by table 4 system.
Table 2, the PCR reaction system
Pcr amplification condition: 95 ℃ of pre-sex change 4 min; 94 ℃ of sex change 1 min, 57.5 ℃ of annealing 2 min, 72 ℃ are extended 1 min, 30 circulations; 72 ℃ are extended 10 min.Pcr amplification product is through 1.0% agarose gel electrophoresis.
3) sequencing of amplified production
Find that by sequencing and sequence alignment to a plurality of strain isolateds strain isolated (name CC12) reaches more than 99% with the strain isolated sequence homology that domestic a plurality of NCBI in the period of 2006-2011 include, and is current main clinical epidemic strain with CC12 therefore.
The CC12 sequence that increases is seen SEQ ID NO:1, and fragment length is 846bp
Table 3. and CC12 sequence alignment have the strain isolated sequence of remarkable meaning
| The strain background | Maximum score | The E value | Maximum similar value |
| Canine distemper virus isolate BA134 hemagglutinin gene, complete cds | 1554 | 0.0 | 99% |
| Canine distemper virus strain SS(10) hemagglutinin gene, complete cds | 1543 | 0.0 | 99% |
| Canine distemper virus hemagglutinin gene, complete cds | 1543 | 0.0 | 99% |
| Canine distemper virus strain LDH(06) hemagglutinin gene, complete cds | 1537 | 0.0 | 99% |
| Canine distemper virus strain HLJ(08)1 hemagglutinin (H) gene, partial cds | 1537 | 0.0 | 99% |
| Canine distemper virus strain 07Q72 hemagglutinin gene, complete cds | 1537 | 0.0 | 99% |
| Canine distemper virus strain SD(09)3 hemagglutinin protein (H) gene, complete cds | 1531 | 0.0 | 99% |
| Canine distemper virus strain FH(10) hemagglutinin gene, complete cds | 1526 | 0.0 | 99% |
| Canine distemper virus strain HeB(09)2 hemagglutinin protein (H) gene, complete cds | 1520 | 0.0 | 99% |
| Canine distemper virus strain JL(07)1 hemagglutinin protein (H) gene, complete cds | 1520 | 0.0 | 99% |
| Canine distemper virus strain SD(09)1 hemagglutinin protein (H) gene, complete cds | 1515 | 0.0 | 99% |
| Canine distemper virus strain JL(07)4 hemagglutinin protein (H) gene, complete cds | 1515 | 0.0 | 99% |
| Canine distemper virus isolate HZ026 hemagglutinin protein mRNA, complete cds | 1515 | 0.0 | 99% |
| Canine distemper virus strain LN(06)1 hemagglutinin protein (H) gene, complete cds | 1515 | 0.0 | 99% |
| Canine distemper virus strain HeB(07)1 hemagglutinin protein (H) gene, complete cds | 1515 | 0.0 | 99% |
2, the acquisition of the passage and attenuation of epidemic strain and candidate vaccine strain
1) preparation of MEM serum free medium
With RPMI MEM, glutamine, NaHCO
3Use deionized water dissolving, adjust pH to 7.2 back constant volume to 1000 milliliter, 0.22 μ m membrane filtration degerming, aseptic subpackaged;
2) two anti-preparations
Preparation contains the two anti-solution of penicillin 1,000,000 units, Streptomycin sulphate 1,000,000 units;
3) preparation of MEM perfect medium
Get the MEM serum free medium of 89 milliliters of steps 1, add 10 milliliters of foetal calf serums, 1 milliliter of two anti-solution;
4) the virus culture medium preparation that goes down to posterity
Get the MEM serum free medium of 97 milliliters of steps 1, add 2 milliliters of foetal calf serums, 1 milliliter of two anti-solution;
5) propagation of the cultivation of passage cell and canine distemper virus
FK81 and Vero cell are disperseed respectively according to a conventional method; add the MEM perfect medium; when cell is grown logarithmic growth during the later stage; normal dispersion; and add the virus substratum that goes down to posterity; the clinical epidemic strain CC12 that screens with 1% inoculation of substratum cumulative volume simultaneously, the nutrient solution of freeze-thaw method results 96h is used for going down to posterity or the amplification of canine distemper virus protective antigen gene.
6) the clinical epidemic strain of screening and candidate vaccine strain
The main epidemic strain of relatively acquisition by clinical popular canine distemper virus main protection antigen gene; on the passage cell main epidemic strain tamed cause a little less than, go down to posterity genetic stability and the immunogenicity of strain of the canine distemper virus that meets the vaccine strain requirement further identified.
CC12 is inoculated into the virus cat kidney passage cell FK81(China Patent No. 99112891.5 that substratum (MEM) keeps that goes down to posterity), the viral liquid of results 96h, after freeze thawing, inoculate the FK81 cell again, passed for 5 generations so continuously, the CC12 virus liquid that passes after 5 generations is extracted total RNA, the H gene is increased and sequential analysis.When the FK81 cell uploaded for 30 generations, when institute's calling sequence has typical vaccine strain characteristic, stop going down to posterity called after CC12-30.Find by sequence alignment, the H gene of CC12-30 and Taiwan vaccine strain (Vacc-N), Nobivac, South Africa vaccine strain (VaccineA, VaccineE), vaccine strain homologys such as Hungary's vaccine strain (COMP5C), Onderstepoort strain reach more than 98%, therefore assert the characteristic of the vaccine strain that its H gene had possessed when CC12 passed to for 30 generations.
The H gene order of CC12-30 is seen SEQ ID NO:2, and fragment length is 871bp.
The strain that table 4. is high with the H gene order homology of CC12-30
| The number of including | The strain background | Maximum score | The E value | Maximum similar value |
| FJ461709.1 | Canine distemper virus isolate VaccineB hemagglutinin (H) gene, complete cds | 1576 | 0.0 | 99% |
| FJ705237.1 | Canine distemper virus strain Vacc-N hemagglutinin protein (H) gene, complete cds | 1570 | 0.0 | 99% |
| FJ461701.1 | Canine distemper virus isolate VaccineA hemagglutinin (H) gene, complete cds | 1565 | 0.0 | 99% |
| JN622007.1 | Canine distemper virus clone COMP5C hemagglutinin (H) gene, partial cds | 1554 | 0.0 | 99% |
| AB212966.1 | Canine distemper virus H gene for haemagglutinin, complete cds, isolate: vaccine strain | 1554 | 0.0 | 99% |
| AF378705.1 | Canine distemper virus strain Onderstepoort, complete genome | 1543 | 0.0 | 99% |
| FJ461710.1 | Canine distemper virus isolate VaccineE hemagglutinin (H) gene, complete cds | 1526 | 0.0 | 98% |
| AB472691.1 | Canine distemper virus H gene for hemaglutination, partial cds, strain: Vn86 | 1526 | 0.0 | 98% |
| AB472690.1 | Canine distemper virus H gene for hemaglutination, partial cds, strain: Vn99 | 1526 | 0.0 | 98% |
| EU143737.1 | Canine distemper virus strain Onderstepoort hemagglutinin (H) gene, complete cds | 1526 | 0.0 | 98% |
| AF014953.1 | Canine distemper virus, complete genome | 1526 | 0.0 | 98% |
| D00758.1 | Canine distemper virus (CDV) genomic RNA for attachment protein H, complete cds | 1526 | 0.0 | 98% |
| AF305419.1 | Canine distemper virus, isolate Onderstepoort complete genome | 1515 | 0.0 | 98% |
| Z35493.1 | Canine distemper virus (Convac vaccine strain) H gene for viral glycoprotein | 1509 | 0.0 | 98% |
| FJ705239.1 | Canine distemper virus strain Vacc-Q hemagglutinin protein (H) gene, complete cds | 1502 | 0.0 | 98% |
Embodiment 2
The clinical epidemic strain CC12 that embodiment 1 is screened and total RNA of CC12-30 increase and sequential analysis to its N gene and NP gene respectively.Wherein QN1 and QN2 are N gene amplification primer, and QNP1 and QNP2 are NP gene amplification primer.The N of CC12 and CC12-30, H and NP gene PCR product electrophoresis are seen Fig. 1, Fig. 2.
Table 5, the amplimer of N gene and NP gene
| The primer title | Primer sequence |
| QN1 | TTCTG AGGCA GATGA GTTCT TC |
| QN2 | CTTGG ATGCT ATTTC TGACA CT |
| QNP1 | ACAGGATTGCTGAGGACCTAT |
| QNP2 | CAAGATAACCATGTACGGTGC |
Clinical epidemic strain N gene order is seen SEQ ID NO:3, and fragment length is 829bp.
Clinical epidemic strain NP gene order SEQ ID NO:4, fragment length is 289bp.
The N gene order SEQ ID NO:5 of CC12-30, fragment length is 829bp
The sequence SEQ ID NO:6 of the NP gene of CC12-30, fragment length is 289bp.
Conclusion: show by sequential analysis, N and the NP gene order of the above clinical epidemic strain of measuring and CC12-30 have the feature of clinical street strain and vaccine strain respectively, the CC12-30 that proves absolutely seed selection among the present invention has the characteristic of typical vaccine strain in genomics, is expected to for the exploitation of canine distemper attenuated vaccine from now on.
Embodiment 3
The genetic stability checking of vaccine strain of the present invention
1) passage checking
CC12-30 of the present invention was passed for 10 generations continuously on the vero cell, vaccine virus to per 5 generations extracts total RNA, the method of Application Example 1 is carried out H gene amplification and sequencing, and institute's calling sequence is found by sequence alignment, and its H gene and CC12-30 are identical.
2) the susceptible dog checking of going down to posterity
Get the FK81 cell culture of CC12-30,1 monthly age of intramuscular inoculation is than 5 of lattice pups, every 2ml, after 5 days dog is put to death, gather lung tissue respectively, prepare 10% lung tissue suspension, twice of-80 ℃ of freeze thawing, collect the centrifugal supernatant of 5000g, getting 40000g precipitation then and suspending with PBS is 2ml, inoculates identical monthly age pup again, the same collection and preparation PBS suspension, passed for 5 generations so altogether, extract total RNA then, listed method in the Application Example 1 is carried out amplification and the sequential analysis of H gene, the result shows, it is identical that the susceptible dog passes after 5 generations sequence and the CC12-30 of H gene.
3) the viral particle morphology feature of vaccine strain CC12-30
Get the FK81 cell culture of CC12-30, use the form that negative staining electron microscope is observed virus particle, as Fig. 3 finding.This virus particle has the characteristic feature of canine distemper virus.
Embodiment 4
Adopt the CC12-30 cell culture of embodiment 2 preparations and the vaccine composition that pharmaceutically acceptable adjuvant is made the control canine distemper, its preparation technology should meet " Pharmacopoeia of People's Republic of China 2010 editions " related request.
The test example
The canine distemper candidate vaccine strain (CC12-30) that application the present invention screens is made canine distemper vaccine, and beasle dog is carried out immunity, uses the canine distemper virulent strain after 30 days and attacks, and the canine distemper vaccine with other sources compares simultaneously.
Operation steps is as follows:
1. the beasle dog with 25 canine distemper virus negative antibodies is divided into 5 groups at random; every group 5; upload epidemic strain (CC12-10) and the PBS in 10 generations with domestic commercial vaccine, external import vaccine, vaccine of the present invention, cell respectively; inoculate above-mentioned dog; gather the dog serum of immunity back 15d and 30d; carry out neutralization test and detect, and carried out strong virus attack at the 31st day, the protection ratio of each group of record.
Table 6. dog serum neutralization tire (extent of dilution)
| Immunogen | Before the immunity | 10d | 30d |
| State's intradermal vaccine | <1:4 | 1:132 | 1:186 |
| External vaccine | <1:4 | 1:177 | 1:235 |
| Vaccine of the present invention | <1:4 | 1:210 | 1:287 |
| CC12-10 | <1:4 | 1:80 | 1:139 |
| The PBS contrast | <1:4 | <1:4 | <1:4 |
*. institute's column data is the geometric mean of each dog serum extension rate
Table 7. dog is attacked the poison protection
| Immunogen | Attack malicious number | There is number |
| State's intradermal vaccine | 5 | 3 |
| External vaccine | 5 | 4 |
| Vaccine of the present invention | 5 | 5 |
| CC12-10 | 5 | 2 |
| The PBS contrast | 5 | 0 |
As seen from Table 6, the antibody of all dogs is all negative before the immunity, the dog serum neutralizing antibody of back 10 days of immunity and 30 days detected find, except PBS contrast dog still is lower than the 1:4, all canine distemper vaccine immunity dog antibody all are higher than 1:80, the level when the serum neutralizing antibody level of identical vaccine inoculation dog in the time of its 30 days all is higher than 10 days.4 immune group antibody horizontals are followed successively by vaccine of the present invention from high to low〉external vaccine〉state's intradermal vaccine〉CC12-10.
Attack malicious protection test (table 7) and find, vaccine immunity dog 5/5 protection of the present invention, external vaccine 4/5 protection, 3/5 protection of state's intradermal vaccine, CC12-10 2/5 protection, and PBS contrast dog is all dead.
From serum neutralization test with attack malicious protection test and all confirm, the candidate vaccine strain that screens among the present invention all is better than other vaccines aspect the malicious protection ratio inducing neutralizing antibody to produce and attack.
The H gene order of CC12: SEQ ID NO:1
＜110〉Yang Shenghua, Zhang Mao woods, Chen Qijun
＜120〉canine distemper attenuated vaccine strain and medical application
<160> 1
<170> PatentIn Version 2.1
<210> 1
<211> 846
<212> DNA
＜213〉canine distemper virus (Canine distemper virus)
atggttcacaagatggtattctagtagtgacattgggaatatttggggcaacacctatggatcaagttgaagaggtgata
cctatcgctcacccatcagtggagagaatacatataacaaatcaccgagggttcataaaagactcaatagtaacctggat
ggtgcctgtattggtctctgagaaacaagaggagcaaaaaaactgtctggagtctgcttgtcacagaaaatcctacccta
tgtgcaaccagacgtcatgggaaccctttggaggaggacagttgccttcttatgggcggttgacattgcctctagatcca
agcattgaccttcagcttaacatatcatttacatatggtccggttatactgaacggagacggtatggattattatgaaag
cccacttttggactccggatggcttaccatacctcctaagaacgggacagtccttggattgataaacaaagcaagtagag
gagaccagttcactgtgaccccccatgtgttgacatttgcgcccagggaatcaagtggaaattgttatttacctattcaa
acatcccagattatggataaagatgtccttactgagtccaatttagtggtgttacctacacagaattttagatatgtcat
agcaacatatgatatatcccggggcgatcatgcaattgtttattatgtttatgacccaatccggacgatttcttatacat
acccatttagactaactaccaagggtagacctgatttcttaaggattgaatgttttgtgtgggatgacgatttgtggtgt
catcaattttaccgattcgaggctaacatcactaactccacaacca 846
The H gene order of CC12-30: SEQ ID NO:2
＜110〉Yang Shenghua, Zhang Mao woods, Chen Qijun
＜120〉canine distemper attenuated vaccine strain and medical application
<160> 1
<170> PatentIn Version 2.1
<210> 1
<211> 871
<212> DNA
＜213〉canine distemper virus (Canine distemper virus)
ttatcatgacagtaatggttcacaagatggtattctagtagtgacactggggatattttgggcaacacctatggatcaca
ttgaggaagtgatacctgtcgctcacccatcaatggagaaaatacatataacaaaccaccggggttttataaaagattca
attgcaacctggatggtgcctgccctggcctctgagaaacaagaagaacaaaaaggttgtctggagtcagcttgtcaaag
aaaaacctaccccatgtgcaaccaaacgtcatgggaacccttcggaggaagacagttgccatcttatgggcggttgacat
tacctctagatgcaagtgttgaccttcaacttaacatatcgttcacatacggtccggttatactgaatggagatggtatg
gattattatgaaagcccacttttgaactccggatggcttaccattcctcccaaaaacggaacaatctctggattgataaa
caaagcaggtagaggagaccagttcactgtactcccccatgtgttaacatttgcgcccagggaatcaagtggaaattgtt
atttacctattcaaacatctcaaattatagatagagatgtcctcattgagtccaatatagtggtgttgcctacacagagt
tttagatatgtcatagcaacgtatgacatatcacgaagtgatcatgcgattgtttattatgtttatgacccaatccggac
gatttcttatacgcacccatttagactaactaccaagggtagacctgatttcctaaggattgaatgttttgtgtgggata
acaatttgtggtgtcaccaattttacagattcgaggctgacatcgccaactccacaaccagtatcgaaaatta 871
Clinical epidemic strain N gene order: SEQ ID NO:3
＜110〉Yang Shenghua, Zhang Mao woods, Chen Qijun
＜120〉canine distemper attenuated vaccine strain and medical application
<160> 1
<170> PatentIn Version 2.1
<210> 1
<211> 829
<212> DNA
＜213〉canine distemper virus (Canine distemper virus)
tgagggcagatgagttcttcaaaattgtagacgaagggtcgaaagctcaaggacaattaggctggttggagaataaggat
attgtagacatagaagttgatgatgctgagcaattcaatatattgctagcttccatcttggcccaaatttggatcctgct
cgctaaagcagtgactgctcctgatactgcagccgactcggaaatgaggagatggattaagtatacccaacagagacgtg
tggtcggggaatttagaatgaacaaaatctggcttgatattgttaggaacaggattgctgaggacttatctttgaggcga
ttcatggtggcactcatcttggacatcaaacgatccccagggaacaagcctagaattgctgaaatgatttgtgatataga
taactacattgtggaagctggattagctagtttcatcttgactatcaaatttggcattgaaactatgtatccggctcttg
ggttgcatgagttttccggagagttaacaactattgaatcccttatgatgctatatcaacagatgggtgaaacagcaccg
tacatggttattctggaaaattctgttcagaacaaatttagtgcaggatcctacccactgctctggagttatgctatggg
agttggtgttgaacttgaaaactccatgggagggttaaatttcggtagatcctactttgatccggcctatttcaggctcg
ggcaagaaatggtgagaagatctgccggcaaagtaagctctgcacttgccgccgagcttggcatcaccaaggaagaggct
cagctagtgtcagaaatagcatccaaga 829
Clinical epidemic strain NP gene order: SEQ ID NO:4
＜110〉Yang Shenghua, Zhang Mao woods, Chen Qijun
＜120〉canine distemper attenuated vaccine strain and medical application
<160> 1
<170> PatentIn Version 2.1
<210> 1
<211> 287
<212> DNA
＜213〉canine distemper virus (Canine distemper virus)
acaggattgctgaggacctatctttgaggcgattcatggtggcactcatcttggacatcaaacgatccccagggaacaag
cctagaattgctgaaatgatttgtgatatagataactacattgtggaagctggattagctagtttcatcttgactatcaa
atttggcattgaaactatgtatccggctcttgggttgcatgagttttccggagagttaacaactattgaatcccttatga
tgctatatcaacagatgggtgaaacagcaccgtacatggttatctta 287
The N gene order of CC12-30: SEQ ID NO:5
＜110〉Yang Shenghua, Zhang Mao woods, Chen Qijun
＜120〉canine distemper attenuated vaccine strain and medical application
<160> 1
<170> PatentIn Version 2.1
<210> 1
<211> 829
<212> DNA
＜213〉canine distemper virus (Canine distemper virus)
tcttgggatggctatttctgacactagctgagcttcctccttggtgatgccaagctcggcggcaagtgcagagcttactt
tgccggcagatctcctaaccatttcttgcccgagtctgaagtaagctgggtcaaagtaagatcgaccgaaatttaaccct
cccatggagttttcaagttcaacaccaacccccatagcataactccagagcaatgggtaggaccctgcactaaatttgtt
ttgaacagagttttccaagataaccatgtacggtgctgtttcacccatctgttgatatagcatcatgagggattcaatag
ttgttaattctccggaaaactcatgcaacccaagagccggatacatagtttcaatgccaaacttgatagttaggatgaaa
ctagctaacccagcttccacaatgtagttatctatatcacaaatcatttcagcaattctaggcttgttccctggggatcg
tttgatgtccaagatgagtgccaccatgaatcgcctcaaagataggtcctcagcaatcctgtttctaacaatatcaagcc
agattttgttcattctaaattctccgaccacacgtctttgctgggtatacttaatccaccttctcatctccgagtcggct
gcagtatcaggagcagtcaccgctttagctagcaggatccaaatttgagccaagatggaagctagcaatatattgaattg
ctcagcattatcaacttctatgtctactatatccttattctctaaccagcctaattgcccttgagctttcgacccttcgt
ctacaattttgaagaactcattggcctcagaa 829
The sequence of the NP gene of CC12-30: SEQ ID NO:6
＜110〉Yang Shenghua, Zhang Mao woods, Chen Qijun
＜120〉canine distemper attenuated vaccine strain and medical application
<160> 1
<170> PatentIn Version 2.1
<210> 1
<211> 287
<212> DNA
＜213〉canine distemper virus (Canine distemper virus)
tcaagataaccatgtacggtgctgtttcacccatctgttgatatagcatcatgagggattcaatagttgttaattctccg
gaaaactcatgcaacccaagagccggatacatagtttcaatgccaaacttgatagttaggatgaaactagctaacccagc
ttccacaatgtagttatctatatcacaaatcatttcagcaattctaggcttgttccctggggatcgtttgatgtccaaga
tgagtgccaccatgaatcgcctcaaagataggtcctcagcaatcctgt 287
Claims (4)
1. canine distemper attenuated vaccine strain, called after canine distemper virus attenuated vaccine strain (
Attenuated caninc distempervirus virus vaccine strain), in preservation on July 4 in 2012 " Chinese typical culture collection center ", preserving number is this vaccine strain: CGMCC6339.
2. according to the H gene of the described canine distemper attenuated vaccine strain of claim 1, its sequence is shown in SEQ ID NO:2.
3. according to the N gene of the described canine distemper attenuated vaccine strain of claim 1, its sequence is shown in SEQ ID NO:5.
4. canine distemper attenuated vaccine strain according to claim 1 is preparing the purposes of preventing in the canine distemper disease vaccine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210311202 CN102839158B (en) | 2012-08-29 | 2012-08-29 | Canine distemper attenuated vaccine strain and medical purpose |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210311202 CN102839158B (en) | 2012-08-29 | 2012-08-29 | Canine distemper attenuated vaccine strain and medical purpose |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102839158A CN102839158A (en) | 2012-12-26 |
| CN102839158B true CN102839158B (en) | 2013-08-28 |
Family
ID=47366877
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210311202 Expired - Fee Related CN102839158B (en) | 2012-08-29 | 2012-08-29 | Canine distemper attenuated vaccine strain and medical purpose |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102839158B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103059133B (en) * | 2013-01-31 | 2015-12-09 | 江苏省农业科学院 | With the monoclonal antibody of canine distemper virus and antibody compositions in a kind of |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1088598C (en) * | 1999-05-04 | 2002-08-07 | 杨盛华 | Culture process of high-yield weak-toxicity distemper cell strain |
| CN101914503B (en) * | 2010-07-30 | 2012-04-18 | 中国农业科学院哈尔滨兽医研究所 | Canine distemper attenuated vaccine strain and application thereof |
-
2012
- 2012-08-29 CN CN 201210311202 patent/CN102839158B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN102839158A (en) | 2012-12-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Bello et al. | Diagnostic and vaccination approaches for Newcastle disease virus in poultry: The current and emerging perspectives | |
| Kahya et al. | Presence of IS/1494/06 genotype-related infectious bronchitis virus in breeder and broiler flocks in Turkey. | |
| CN101935637B (en) | Recombinant low-virulent vaccine strain of chicken infectious bursal disease viruses (IBDV) and application thereof | |
| CN105543180B (en) | The separation identification of one pnca gene VII type Newcastle disease poison strain and purification process and its application | |
| Wang et al. | Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china | |
| CN101914503B (en) | Canine distemper attenuated vaccine strain and application thereof | |
| CN115287270B (en) | Subtype B avian metapneumovirus (APV) subculture attenuated strain and application thereof | |
| Abolnik et al. | Characterization of pigeon paramyxoviruses (Newcastle disease virus) isolated in South Africa from 2001 to 2006 | |
| Alvarado et al. | Molecular characterization of avian infectious bronchitis virus strains isolated in Colombia during 2003 | |
| Choi et al. | Molecular epidemiological investigation of velogenic Newcastle disease viruses from village chickens in Cambodia | |
| CN104353070B (en) | Genetic engineering subunit vaccine of chicken infectious bronchitis virus and preparation method thereof | |
| CN104928260B (en) | A kind of infectious bovine rhinotrachetis virus IBRV-JN03 separation strains and its application | |
| CN102321661A (en) | Eukaryotic expression recombinant plasmid and construction method thereof and Vero cell line stably expressing the plasmid | |
| CN102634605B (en) | Method for detecting egg drop syndrome viruses and kit for method | |
| CN108866240A (en) | For identifying primer and enzyme and its application of DAdV-3 and DAdV-A | |
| CN105671002A (en) | Construction and application of H9N2-subtype avian influenza virus cell high-yield vaccine strain | |
| CN102839158B (en) | Canine distemper attenuated vaccine strain and medical purpose | |
| CN101875974A (en) | Primer group for detecting Bordetella pertussis, detection test kit and detection method | |
| CN111057682A (en) | Avian H9N2 subtype avian influenza strain separation identification and application | |
| CN104419686A (en) | Recombinant prrs virus hv-nsp9 and application thereof | |
| CN103667524B (en) | Fluorescent quantitative RT-PCR kit used for detection of Newcastle disease virus class I and application of fluorescent quantitative RT-PCR kit | |
| CN103555821A (en) | Detection method for yeast-like symbiotes in brown planthopper on rice varieties with different resistance | |
| Fringe et al. | Molecular characterisation of Newcastle disease virus isolates from different geographical regions in Mozambique in 2005 | |
| CN103361444A (en) | Kit for testing Marek's disease virus of chicken by using MEQ gene and detection method thereof | |
| CN107435041A (en) | Chimeric the newcastle Disease poisonous carrier H9 live vaccines Candidate Strain and its construction method for overcoming chicken Newcastle disease maternal antibody to influence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130828 Termination date: 20170829 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |